ID: 1128873777

View in Genome Browser
Species Human (GRCh38)
Location 15:71185195-71185217
Sequence CTTATAAGGAATCCTGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128873777_1128873783 27 Left 1128873777 15:71185195-71185217 CCAGATACAGGATTCCTTATAAG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1128873783 15:71185245-71185267 AAGAGTTATACCTAATTTAAAGG 0: 1
1: 0
2: 2
3: 60
4: 258
1128873777_1128873782 1 Left 1128873777 15:71185195-71185217 CCAGATACAGGATTCCTTATAAG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1128873782 15:71185219-71185241 CAAATATAAAGATCTTAGGGTGG 0: 1
1: 0
2: 2
3: 9
4: 235
1128873777_1128873784 28 Left 1128873777 15:71185195-71185217 CCAGATACAGGATTCCTTATAAG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1128873784 15:71185246-71185268 AGAGTTATACCTAATTTAAAGGG 0: 1
1: 0
2: 5
3: 72
4: 342
1128873777_1128873780 -2 Left 1128873777 15:71185195-71185217 CCAGATACAGGATTCCTTATAAG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1128873780 15:71185216-71185238 AGCCAAATATAAAGATCTTAGGG 0: 1
1: 0
2: 3
3: 17
4: 250
1128873777_1128873779 -3 Left 1128873777 15:71185195-71185217 CCAGATACAGGATTCCTTATAAG 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1128873779 15:71185215-71185237 AAGCCAAATATAAAGATCTTAGG 0: 1
1: 0
2: 3
3: 29
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128873777 Original CRISPR CTTATAAGGAATCCTGTATC TGG (reversed) Intronic
902460142 1:16568705-16568727 CTCATAAGGAATTTTGTAGCTGG + Intronic
907739656 1:57152360-57152382 CTAATAGGGAATGCTTTATCTGG + Intronic
909522371 1:76584671-76584693 CATATAAGGAATCCTACTTCTGG + Intronic
909724044 1:78812253-78812275 CTTAAAAGGAATCCAGAGTCCGG - Intergenic
911421528 1:97647297-97647319 CTTATAAGTAATCTTATATTTGG + Intronic
913193352 1:116432277-116432299 CTTATAAGGTATCGTGTCCCTGG - Intergenic
913372526 1:118116737-118116759 CTTTAAAGGAATCCTTTCTCTGG - Intronic
913605271 1:120459876-120459898 CTCATAAGGAATTTTGTAGCTGG - Intergenic
913642140 1:120822613-120822635 CTCATAAGGAATTTTGTAGCTGG - Intronic
914083263 1:144429332-144429354 CTCATAAGGAATTTTGTAGCTGG + Intronic
914189287 1:145394610-145394632 CTCATAAGGAATTTTGTAGCTGG + Intronic
914211140 1:145580322-145580344 CTCATAAGGAATTTTGTAGCTGG + Intergenic
914276338 1:146127751-146127773 CTCATAAGGAATTTTGTAGCTGG + Intronic
914366478 1:146983437-146983459 CTCATAAGGAATTTTGTAGCTGG - Intronic
914380857 1:147114946-147114968 CTCATAAGGAATTTTGTAGCTGG + Intergenic
914485967 1:148110010-148110032 CTCATAAGGAATTTTGTAGCTGG + Intronic
914537382 1:148578706-148578728 CTCATAAGGAATTTTGTAGCTGG + Intronic
914586300 1:149065158-149065180 CTCATAAGGAATTTTGTAGCTGG + Intronic
914628543 1:149486639-149486661 CTCATAAGGAATTTTGTAGCTGG - Intergenic
915415231 1:155736785-155736807 CATATGTGGAGTCCTGTATCAGG + Intronic
920837079 1:209520896-209520918 TTTATAAAGTATCCAGTATCAGG + Intergenic
1067129924 10:43554248-43554270 GTTGAAAGGATTCCTGTATCAGG - Intergenic
1067289557 10:44931379-44931401 CCTTTGAGGCATCCTGTATCAGG + Intronic
1069191603 10:65498109-65498131 CTTTTAAGAAATGCTGTATTTGG + Intergenic
1074495173 10:113973903-113973925 CTTATAAGGATGCCTGTCACTGG + Intergenic
1079556286 11:21761701-21761723 ATTATAAGTTATCCAGTATCAGG - Intergenic
1084956096 11:72692532-72692554 CTGATAAGGAACCCTATATTGGG + Intronic
1085953714 11:81365213-81365235 CTAATAAGAAACCCTGTATATGG + Intergenic
1090504026 11:127290337-127290359 CTTATTGGGTCTCCTGTATCTGG - Intergenic
1091487647 12:905370-905392 CTCATAGAGAATCCTGTATTAGG + Intronic
1093552177 12:20426786-20426808 CATATAAGAATTCCTGTATATGG + Intronic
1095960986 12:47834036-47834058 CTTATAAGGAAGACGATATCAGG + Intergenic
1097996597 12:65894421-65894443 TTTATAGGGAATCCTGAATCAGG + Intronic
1100210901 12:92397720-92397742 TTTATAAGTTATCCTGTCTCAGG - Intergenic
1104949368 12:132432178-132432200 CTTATAAGGATGCCTGTGTTTGG - Intergenic
1107103470 13:36619090-36619112 CTTATAAAGAAACTTGTATGGGG - Intergenic
1109521758 13:63522370-63522392 GTTAAAAGGAAACCTGTATTAGG - Intergenic
1114433147 14:22679529-22679551 TTTATAAATAATCCAGTATCAGG + Intergenic
1115910311 14:38249264-38249286 CTTATAAGGACACCAGTAACTGG - Intergenic
1116521339 14:45850992-45851014 CTTGTAATGTATCCAGTATCTGG + Intergenic
1116667953 14:47801595-47801617 TTTATAAGGTATCCTGTTTATGG + Intergenic
1117564264 14:56977351-56977373 TTTATAAGGCATCCAGTTTCTGG + Intergenic
1118855485 14:69618619-69618641 CTTCTCTGGATTCCTGTATCTGG + Intronic
1119691652 14:76677640-76677662 CTTATAAATAATCCAGTCTCAGG + Intergenic
1120488880 14:85151421-85151443 CTTAATAGGAATCATTTATCTGG + Intergenic
1125622997 15:41081447-41081469 CTCCTAATGATTCCTGTATCTGG - Intronic
1126555429 15:49982681-49982703 CTAATAAGGAATCCTTTTTATGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128263528 15:66249922-66249944 TTTAAATTGAATCCTGTATCAGG + Intronic
1128873777 15:71185195-71185217 CTTATAAGGAATCCTGTATCTGG - Intronic
1128892492 15:71343652-71343674 CTTATAAGGACACCTGTCACTGG + Intronic
1130853932 15:87824225-87824247 CTTACAAGGACTCCTGTCACTGG - Intergenic
1131885873 15:96912107-96912129 CTTATAAAGCATCCAGTTTCAGG + Intergenic
1132848157 16:2010214-2010236 CTTATTAGGAAACCGGTCTCTGG + Intronic
1133883739 16:9807133-9807155 CTTATAAATTATCCAGTATCGGG + Intronic
1135904032 16:26493921-26493943 CTTTTAATGAATCTTGTTTCTGG + Intergenic
1137327522 16:47456745-47456767 CTTATCAGGCATCCTTTCTCAGG + Intronic
1137567381 16:49541926-49541948 CTTATAAAGTATCCAGTGTCAGG + Intronic
1146225684 17:31064223-31064245 GTTATTAGGAATCCTGTTCCAGG + Intergenic
1146781381 17:35676380-35676402 ATAATATGGAATCTTGTATCTGG + Intronic
1149134725 17:53350871-53350893 CTTATAAGGAATCCACTGTAGGG - Intergenic
1155388394 18:25306682-25306704 CTTATAAGGCCTCTTGTAGCTGG - Intronic
1158272553 18:55732706-55732728 TTTCTCAGGACTCCTGTATCAGG - Intergenic
1159256961 18:65959193-65959215 CTTATATGAAATCCTGCAACAGG + Intergenic
1160402090 18:78618681-78618703 CTTTTTAGGAGTCCTGTACCAGG - Intergenic
1167061439 19:47149741-47149763 CTTAGAAGGAAGCCTGCATAAGG + Intronic
1202676573 1_KI270711v1_random:12433-12455 CTCATAAGGAATTTTGTAGCTGG + Intergenic
931184369 2:59935503-59935525 ATTTTAAGAAATCCTGTCTCTGG + Intergenic
931432974 2:62223678-62223700 CTTATCTGAAATCCTGTTTCTGG + Exonic
931785576 2:65615750-65615772 CTTATAAACAATGCTGCATCAGG + Intergenic
932633512 2:73367712-73367734 CTTATAAATTATCCTGTATGTGG + Intergenic
937101134 2:119270319-119270341 TTTGTAAAGATTCCTGTATCTGG + Intergenic
939286977 2:140144371-140144393 CTTCCAAAGTATCCTGTATCAGG + Intergenic
939588492 2:144033858-144033880 CATTTTAGGAATTCTGTATCAGG + Intronic
940807779 2:158207225-158207247 CTTATAAGGACAGCAGTATCCGG - Intronic
944322524 2:198364705-198364727 TCTATAAGGAAACCTGTGTCTGG + Intronic
945797088 2:214378478-214378500 CTTATAAGGGAACCAGTTTCAGG - Intronic
947044681 2:225968032-225968054 CTAATACGGAATTCTGTACCTGG - Intergenic
1169541706 20:6606664-6606686 CTTATAAACAATCCAGTCTCAGG - Intergenic
1178679784 21:34664282-34664304 ATTATAAGGAATCATGAAGCAGG - Intergenic
1179142929 21:38742771-38742793 CTTCTAAGGAATGCTGCTTCAGG + Intergenic
1180523502 22:16232354-16232376 GTGATAAGGAATCCTTTATGAGG + Intergenic
949208794 3:1473460-1473482 CTTATAAAGCATCTTGAATCTGG + Intergenic
951283091 3:20776746-20776768 ATTAGAAGGAATGCTGTATGGGG + Intergenic
953930793 3:47004795-47004817 CTCAAAAGGAATCCTGTTCCAGG + Intronic
955841577 3:63118590-63118612 CTTGTAAAGACTTCTGTATCTGG + Intergenic
959792868 3:110385637-110385659 CTTATAAGGAACCCTGTCATTGG - Intergenic
966483665 3:180443507-180443529 CTTAAAAATAATCCTGTATGTGG - Intergenic
968799080 4:2730285-2730307 TTTAAAAGGATTCCTGTGTCAGG - Intronic
970023387 4:11594046-11594068 CTTATAAGTAAGCCGGTAACTGG - Intergenic
971351303 4:25858464-25858486 CTTACAGGGAATCCTGTACAAGG + Intronic
971996543 4:33972719-33972741 CTTATAAATTATCCTGTGTCAGG + Intergenic
972877792 4:43385963-43385985 TTTACAAGAAATCATGTATCAGG + Intergenic
974735228 4:65921654-65921676 CTTATAAGTTACCCAGTATCAGG + Intergenic
975954519 4:79821777-79821799 CTTATAAATTATCCTGTCTCAGG - Intergenic
976887660 4:90005980-90006002 CTTATAAGCTATGCTTTATCTGG - Intergenic
978500065 4:109399966-109399988 CTTATAAGGATACCTGTCACTGG + Intergenic
981132626 4:141174865-141174887 GTTACCTGGAATCCTGTATCAGG + Intronic
984288493 4:177763606-177763628 ATCATAAGCAATACTGTATCAGG - Intronic
987686974 5:21217389-21217411 GTGAAAAGGAATCATGTATCTGG + Intergenic
988141210 5:27243211-27243233 CTTATATGGAATCCTGCAACAGG + Intergenic
988231557 5:28485921-28485943 CTTATAAATAATGCTTTATCTGG - Intergenic
989278430 5:39615318-39615340 CTGATAAAGAATCCTGAACCTGG + Intergenic
989566306 5:42904648-42904670 TTTTTAAGGAATCTTGTACCGGG - Intergenic
989721623 5:44535593-44535615 ATTATAAAGAATTATGTATCTGG + Intergenic
992596365 5:78351447-78351469 CTTATAAGTTATCCAGTCTCAGG + Intergenic
994602685 5:101926798-101926820 CTTATAAGGAAACCCTTATAAGG - Intergenic
994719881 5:103368103-103368125 TTTATAAAGTATCCTGTCTCAGG + Intergenic
996121391 5:119677188-119677210 GCTAGAAGAAATCCTGTATCTGG - Intergenic
997027235 5:130079379-130079401 CTTATAAGGAAAGCTTTTTCTGG + Intronic
998939634 5:147267209-147267231 CTTAGAAGGTATATTGTATCTGG + Intronic
1001139048 5:169128371-169128393 CTAAGAAGGAATCCTTTTTCTGG + Intronic
1010430292 6:75770271-75770293 CTTAAAAGTTATCCTGTGTCAGG + Intronic
1011765661 6:90616661-90616683 CTAATAATGAATACTGTCTCGGG + Intergenic
1015230998 6:130914935-130914957 GTTATAAGGAATCCTAAAACAGG + Intronic
1015256785 6:131186405-131186427 CTTATAAGTTATCCAGTCTCAGG + Intronic
1021372225 7:19862929-19862951 CTTATAAAAAATCAAGTATCTGG - Intergenic
1022337401 7:29434594-29434616 CTTATAAGGAATCCTGTCATTGG + Intronic
1025013517 7:55419092-55419114 TTTATTAGGAATCAGGTATCAGG + Intronic
1025759217 7:64374605-64374627 CTAATAAGGACTCTTGTACCTGG + Intergenic
1026259639 7:68743562-68743584 TTTATAAGTGATGCTGTATCTGG + Intergenic
1027961508 7:84951795-84951817 CTTATAAATAATCTTATATCAGG - Intergenic
1031003070 7:116439796-116439818 TTAATATGGAATCCTGTTTCAGG - Intronic
1031381466 7:121091230-121091252 CTTTAAAGGAATTCTGTATTAGG - Intronic
1032616587 7:133479128-133479150 CTTAGAAGGATTCCTCCATCTGG + Intronic
1034321668 7:150189617-150189639 CTTATAAGACATTCTGTAACAGG - Intergenic
1034771080 7:153777663-153777685 CTTATAAGACATTCTGTAACAGG + Intergenic
1038379343 8:27077699-27077721 CATTTAAGGAATACTGTTTCTGG - Intergenic
1039713238 8:40080353-40080375 CCTATAATAAATGCTGTATCTGG - Intergenic
1040710726 8:50185384-50185406 TTTATAAGGTATCCAGTCTCAGG + Intronic
1042286257 8:67114645-67114667 CTTATCAGGAATGATTTATCAGG - Intronic
1044329563 8:90900675-90900697 CAGATAAAGAATCCTGTACCTGG - Intronic
1046358218 8:113116080-113116102 CTTATAAGGTACCCTGTTTATGG + Intronic
1050330698 9:4542359-4542381 CTTTAAAAAAATCCTGTATCTGG + Intronic
1052979840 9:34440117-34440139 CTTATCAGGAATCCTGTACTGGG + Intronic
1055324037 9:75110021-75110043 CTTTTTAAGAATGCTGTATCTGG - Intronic
1056630223 9:88287415-88287437 ACTATAAGAAATCCTTTATCTGG + Intergenic
1059551873 9:115237248-115237270 CTAATGAGGAATCCTGTGGCAGG + Intronic
1059838041 9:118179200-118179222 CTTATAAGGTACCCAGTCTCAGG + Intergenic
1060838459 9:126776038-126776060 CTTATATGGTATCCTGTAAAAGG - Intergenic
1062729479 9:138101100-138101122 CTTATAATGAATCCGGCAACTGG - Intronic
1188168132 X:26887612-26887634 CTTATAAGGACTCCAGTAATTGG - Intergenic
1189760639 X:44318403-44318425 CTTCAAAGGAAACCTGTACCCGG - Intronic
1192300220 X:69893245-69893267 CTTATAAGGACACCTGTCTTTGG + Intronic
1192901586 X:75504171-75504193 CTTATAATGATTCCTGTACTGGG - Intronic
1193984414 X:88222511-88222533 TTTATAAGTAACCCAGTATCAGG + Intergenic
1194850389 X:98861607-98861629 CTTATATGGAATCCAGGATCTGG + Intergenic
1195940230 X:110161708-110161730 CTTAGAGGGAATCCTGGAGCTGG - Intronic
1196355744 X:114789828-114789850 GATATAAGGAATCGTGTATGAGG + Intronic
1197322213 X:125046470-125046492 CTTCTATGTAATCCCGTATCAGG + Intergenic