ID: 1128874664

View in Genome Browser
Species Human (GRCh38)
Location 15:71192345-71192367
Sequence GAGGCTGCAGTGAGCTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46919
Summary {0: 357, 1: 5123, 2: 12770, 3: 16749, 4: 11920}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128874664_1128874672 27 Left 1128874664 15:71192345-71192367 CCATCTCAGCTCACTGCAGCCTC 0: 357
1: 5123
2: 12770
3: 16749
4: 11920
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749
1128874664_1128874674 28 Left 1128874664 15:71192345-71192367 CCATCTCAGCTCACTGCAGCCTC 0: 357
1: 5123
2: 12770
3: 16749
4: 11920
Right 1128874674 15:71192396-71192418 CCTCAAGTACCCGAGTGGCTGGG 0: 1
1: 0
2: 6
3: 438
4: 10948
1128874664_1128874671 23 Left 1128874664 15:71192345-71192367 CCATCTCAGCTCACTGCAGCCTC 0: 357
1: 5123
2: 12770
3: 16749
4: 11920
Right 1128874671 15:71192391-71192413 TCTTGCCTCAAGTACCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128874664 Original CRISPR GAGGCTGCAGTGAGCTGAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr