ID: 1128874666

View in Genome Browser
Species Human (GRCh38)
Location 15:71192364-71192386
Sequence CACTTGAACCTGGGAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342484
Summary {0: 6203, 1: 24732, 2: 65365, 3: 109290, 4: 136894}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128874666_1128874674 9 Left 1128874666 15:71192364-71192386 CCTCCACCTCCCAGGTTCAAGTG 0: 6203
1: 24732
2: 65365
3: 109290
4: 136894
Right 1128874674 15:71192396-71192418 CCTCAAGTACCCGAGTGGCTGGG 0: 1
1: 0
2: 6
3: 438
4: 10948
1128874666_1128874671 4 Left 1128874666 15:71192364-71192386 CCTCCACCTCCCAGGTTCAAGTG 0: 6203
1: 24732
2: 65365
3: 109290
4: 136894
Right 1128874671 15:71192391-71192413 TCTTGCCTCAAGTACCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 266
1128874666_1128874672 8 Left 1128874666 15:71192364-71192386 CCTCCACCTCCCAGGTTCAAGTG 0: 6203
1: 24732
2: 65365
3: 109290
4: 136894
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128874666 Original CRISPR CACTTGAACCTGGGAGGTGG AGG (reversed) Intronic
Too many off-targets to display for this crispr