ID: 1128874667

View in Genome Browser
Species Human (GRCh38)
Location 15:71192367-71192389
Sequence AATCACTTGAACCTGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328874
Summary {0: 13227, 1: 40037, 2: 76891, 3: 95818, 4: 102901}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128874667_1128874672 5 Left 1128874667 15:71192367-71192389 CCACCTCCCAGGTTCAAGTGATT 0: 13227
1: 40037
2: 76891
3: 95818
4: 102901
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749
1128874667_1128874671 1 Left 1128874667 15:71192367-71192389 CCACCTCCCAGGTTCAAGTGATT 0: 13227
1: 40037
2: 76891
3: 95818
4: 102901
Right 1128874671 15:71192391-71192413 TCTTGCCTCAAGTACCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 266
1128874667_1128874674 6 Left 1128874667 15:71192367-71192389 CCACCTCCCAGGTTCAAGTGATT 0: 13227
1: 40037
2: 76891
3: 95818
4: 102901
Right 1128874674 15:71192396-71192418 CCTCAAGTACCCGAGTGGCTGGG 0: 1
1: 0
2: 6
3: 438
4: 10948

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128874667 Original CRISPR AATCACTTGAACCTGGGAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr