ID: 1128874668

View in Genome Browser
Species Human (GRCh38)
Location 15:71192370-71192392
Sequence GAGAATCACTTGAACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519554
Summary {0: 20599, 1: 62494, 2: 120157, 3: 154110, 4: 162194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128874668_1128874677 30 Left 1128874668 15:71192370-71192392 CCTCCCAGGTTCAAGTGATTCTC 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194
Right 1128874677 15:71192423-71192445 CAGATGTGCGCCAACACGCCTGG 0: 1
1: 50
2: 1318
3: 13970
4: 67139
1128874668_1128874671 -2 Left 1128874668 15:71192370-71192392 CCTCCCAGGTTCAAGTGATTCTC 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194
Right 1128874671 15:71192391-71192413 TCTTGCCTCAAGTACCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 266
1128874668_1128874674 3 Left 1128874668 15:71192370-71192392 CCTCCCAGGTTCAAGTGATTCTC 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194
Right 1128874674 15:71192396-71192418 CCTCAAGTACCCGAGTGGCTGGG 0: 1
1: 0
2: 6
3: 438
4: 10948
1128874668_1128874672 2 Left 1128874668 15:71192370-71192392 CCTCCCAGGTTCAAGTGATTCTC 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128874668 Original CRISPR GAGAATCACTTGAACCTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr