ID: 1128874670

View in Genome Browser
Species Human (GRCh38)
Location 15:71192374-71192396
Sequence GCAAGAGAATCACTTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360686
Summary {0: 1676, 1: 40591, 2: 89463, 3: 105531, 4: 123425}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128874670_1128874677 26 Left 1128874670 15:71192374-71192396 CCAGGTTCAAGTGATTCTCTTGC 0: 1676
1: 40591
2: 89463
3: 105531
4: 123425
Right 1128874677 15:71192423-71192445 CAGATGTGCGCCAACACGCCTGG 0: 1
1: 50
2: 1318
3: 13970
4: 67139
1128874670_1128874672 -2 Left 1128874670 15:71192374-71192396 CCAGGTTCAAGTGATTCTCTTGC 0: 1676
1: 40591
2: 89463
3: 105531
4: 123425
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749
1128874670_1128874674 -1 Left 1128874670 15:71192374-71192396 CCAGGTTCAAGTGATTCTCTTGC 0: 1676
1: 40591
2: 89463
3: 105531
4: 123425
Right 1128874674 15:71192396-71192418 CCTCAAGTACCCGAGTGGCTGGG 0: 1
1: 0
2: 6
3: 438
4: 10948
1128874670_1128874671 -6 Left 1128874670 15:71192374-71192396 CCAGGTTCAAGTGATTCTCTTGC 0: 1676
1: 40591
2: 89463
3: 105531
4: 123425
Right 1128874671 15:71192391-71192413 TCTTGCCTCAAGTACCCGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128874670 Original CRISPR GCAAGAGAATCACTTGAACC TGG (reversed) Intronic
Too many off-targets to display for this crispr