ID: 1128874672

View in Genome Browser
Species Human (GRCh38)
Location 15:71192395-71192417
Sequence GCCTCAAGTACCCGAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10130
Summary {0: 1, 1: 0, 2: 4, 3: 376, 4: 9749}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128874667_1128874672 5 Left 1128874667 15:71192367-71192389 CCACCTCCCAGGTTCAAGTGATT 0: 13227
1: 40037
2: 76891
3: 95818
4: 102901
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749
1128874670_1128874672 -2 Left 1128874670 15:71192374-71192396 CCAGGTTCAAGTGATTCTCTTGC 0: 1676
1: 40591
2: 89463
3: 105531
4: 123425
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749
1128874666_1128874672 8 Left 1128874666 15:71192364-71192386 CCTCCACCTCCCAGGTTCAAGTG 0: 6203
1: 24732
2: 65365
3: 109290
4: 136894
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749
1128874668_1128874672 2 Left 1128874668 15:71192370-71192392 CCTCCCAGGTTCAAGTGATTCTC 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749
1128874669_1128874672 -1 Left 1128874669 15:71192373-71192395 CCCAGGTTCAAGTGATTCTCTTG 0: 1042
1: 25818
2: 93395
3: 151939
4: 170191
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749
1128874664_1128874672 27 Left 1128874664 15:71192345-71192367 CCATCTCAGCTCACTGCAGCCTC 0: 357
1: 5123
2: 12770
3: 16749
4: 11920
Right 1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG 0: 1
1: 0
2: 4
3: 376
4: 9749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128874672 Original CRISPR GCCTCAAGTACCCGAGTGGC TGG Intronic
Too many off-targets to display for this crispr