ID: 1128874937

View in Genome Browser
Species Human (GRCh38)
Location 15:71194123-71194145
Sequence GACTCACAGTACCACGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21102
Summary {0: 3, 1: 591, 2: 4655, 3: 7724, 4: 8129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128874937_1128874940 15 Left 1128874937 15:71194123-71194145 CCAGCCACGTGGTACTGTGAGTC 0: 3
1: 591
2: 4655
3: 7724
4: 8129
Right 1128874940 15:71194161-71194183 TCTTCATAAATTCCCAGTCTCGG 0: 2
1: 2
2: 32
3: 95
4: 344
1128874937_1128874941 16 Left 1128874937 15:71194123-71194145 CCAGCCACGTGGTACTGTGAGTC 0: 3
1: 591
2: 4655
3: 7724
4: 8129
Right 1128874941 15:71194162-71194184 CTTCATAAATTCCCAGTCTCGGG 0: 4
1: 20
2: 104
3: 273
4: 646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128874937 Original CRISPR GACTCACAGTACCACGTGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr