ID: 1128883098

View in Genome Browser
Species Human (GRCh38)
Location 15:71261345-71261367
Sequence GATCCTTCCTCCAGAGACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128883094_1128883098 3 Left 1128883094 15:71261319-71261341 CCAGAAACCAGGAAAATGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 191
1128883097_1128883098 -4 Left 1128883097 15:71261326-71261348 CCAGGAAAATGCGTGGAAGGATC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 191
1128883091_1128883098 23 Left 1128883091 15:71261299-71261321 CCAAGGATTGCCAGCAACTTCCA 0: 1
1: 5
2: 49
3: 176
4: 681
Right 1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 191
1128883093_1128883098 13 Left 1128883093 15:71261309-71261331 CCAGCAACTTCCAGAAACCAGGA 0: 1
1: 1
2: 7
3: 60
4: 477
Right 1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG 0: 1
1: 0
2: 0
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128883098 Original CRISPR GATCCTTCCTCCAGAGACTT TGG Intronic
904395479 1:30218530-30218552 GATCTTTCCTACAGGGACTCAGG + Intergenic
906855686 1:49301925-49301947 AATCCATCCTCCAGAGAATTTGG - Intronic
907718726 1:56951893-56951915 GTTCCTTCCTCCAGACATTGTGG - Intronic
911088640 1:94000596-94000618 GATGCCCCATCCAGAGACTTGGG + Intronic
915423581 1:155805233-155805255 GATCCTTCCTCTAAACAATTTGG + Intronic
916017549 1:160763466-160763488 GGTCCTTCCTCCAGAGAACTCGG + Intergenic
917552454 1:176047946-176047968 GTTCTTGTCTCCAGAGACTTGGG + Intronic
917695139 1:177514908-177514930 GATCCATCTTCCAGAAACTAAGG - Intergenic
917980851 1:180268019-180268041 CCTCCTTCCTCCAGAGACCTGGG + Intronic
919830626 1:201538415-201538437 CCTCCTTCTTCCAGGGACTTGGG - Intergenic
920666662 1:207967710-207967732 GATCCTTCCCCTATAGGCTTTGG + Intergenic
922162550 1:223089139-223089161 GATCCCTCGTCCAGAGGCATGGG - Intergenic
1062824316 10:557135-557157 GCTCCTTTCTGCAGAGACATAGG - Intronic
1065538872 10:26741154-26741176 GATCCTGTTCCCAGAGACTTTGG - Intronic
1068021249 10:51587735-51587757 AATCCTGGCTCCAGAAACTTTGG + Intronic
1068860827 10:61846185-61846207 GGCCCTGCCTCCAGAGATTTGGG - Intergenic
1069786674 10:70992733-70992755 GAGCCTCCGTCCACAGACTTTGG + Intergenic
1070498105 10:77043500-77043522 GATCCTTCTTCCAGTTCCTTTGG - Intronic
1070814274 10:79313169-79313191 GAGCCTCCCTCCAGTGACTGTGG + Exonic
1071021584 10:81063638-81063660 GAATCTTCCCCTAGAGACTTTGG + Intergenic
1074531844 10:114303738-114303760 GATGCTTCCTCCAGCTACTGGGG - Intronic
1076203690 10:128578294-128578316 GACTCTTCCTCCAGCGCCTTAGG + Intergenic
1076811845 10:132890470-132890492 GATCCTTCAACCAAAGCCTTAGG - Intronic
1079621792 11:22564731-22564753 GAGCTTTCAGCCAGAGACTTTGG + Intergenic
1080667604 11:34349498-34349520 CCTCCTTGCACCAGAGACTTTGG + Intronic
1081419499 11:42856874-42856896 AATCCTACCTGCAGAGAGTTAGG - Intergenic
1081648721 11:44808569-44808591 AATACATCCTCCAGAGACCTTGG + Intronic
1082490908 11:53532319-53532341 GCTCCCTGCTCCAGATACTTAGG - Intergenic
1083261613 11:61526117-61526139 GCACCTTCCCCCAGAGACTCTGG + Intronic
1083938816 11:65884258-65884280 GAGCTTTGGTCCAGAGACTTTGG + Intronic
1086498078 11:87424581-87424603 CACCCTTCCTCCAGGGAATTAGG + Intergenic
1088002371 11:104897670-104897692 GGTCCTTGCACCAGAGGCTTTGG - Intergenic
1088019089 11:105097524-105097546 GATGCTTCCTCCTGAGCCTGAGG + Intronic
1088155930 11:106803388-106803410 TATCCTTCCTTCACAGTCTTTGG + Intronic
1088840773 11:113625891-113625913 GATCTTTACTCCAGAGAATCTGG + Intergenic
1089032410 11:115346092-115346114 GTTCCTTTTTCCAGAGACTTCGG + Intronic
1090878069 11:130808917-130808939 TTTGTTTCCTCCAGAGACTTGGG + Intergenic
1091212307 11:133872579-133872601 GATCCTTCCTCAGGAGAATCTGG - Intergenic
1092542799 12:9430511-9430533 GATGGTTCCTCCAGACACCTGGG - Intergenic
1093930716 12:24952520-24952542 GATCCTTCCACCTCAGCCTTGGG - Intergenic
1094105135 12:26803148-26803170 CACCCATCCTCCAGAGGCTTAGG + Intronic
1094510216 12:31091926-31091948 GATGGTTCCTCCAGACACCTGGG + Intronic
1095981526 12:47977229-47977251 GCTCCTTAGTCCAGAGACTGCGG + Intronic
1096370042 12:51061787-51061809 GAGCCTTCCTGCAGAGACAGTGG + Exonic
1097083515 12:56450631-56450653 GATGCTTGCCCCAGGGACTTGGG - Exonic
1099987846 12:89688720-89688742 GATCCTTACTGCAGGGTCTTGGG + Intronic
1100922293 12:99501640-99501662 AATCCTTCCTCCATAGAACTAGG - Intronic
1102244952 12:111349660-111349682 AACCCTTCCTCCAGCGTCTTTGG + Exonic
1103437932 12:120941344-120941366 GATCATCCCTCCAGCTACTTGGG - Intergenic
1104367172 12:128188335-128188357 GATCCCTTCCACAGAGACTTTGG - Intergenic
1104803299 12:131569383-131569405 GCTGCTTCCTCCAGTGACCTGGG - Intergenic
1105253730 13:18725539-18725561 GCTGCTTCCTCCAGGGACATGGG + Intergenic
1107073205 13:36294376-36294398 GAGCCTGCCCCCAGAGACTGAGG + Intronic
1110063739 13:71073842-71073864 GATCCTTCTTCCACATCCTTTGG - Intergenic
1110295605 13:73860636-73860658 GATCCTTCTTCCTCAGTCTTTGG - Intronic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1117423492 14:55571942-55571964 GATCCTTCCACCTCAGACTCTGG + Intronic
1121252799 14:92512633-92512655 GATCCTTTCACCAGAGCCCTGGG + Intergenic
1121603737 14:95225512-95225534 CATCCTGCCTGCAGAGCCTTGGG + Intronic
1122278224 14:100606117-100606139 GTTCGTGCCTCCAGAGACGTTGG - Intergenic
1122654173 14:103246203-103246225 GCTCCTTCCTCCAGGCACATGGG + Intergenic
1122941418 14:104983097-104983119 GCCCCTTCCTCCTGAGACTAGGG + Intergenic
1123106887 14:105845944-105845966 GGTCTTCCCTCCAGAGGCTTTGG + Intergenic
1123439067 15:20276935-20276957 GATCCTCCCTGCAGGGACTGGGG - Intergenic
1126127363 15:45308153-45308175 GTTGCTTCATCCAGAGACTGGGG - Intergenic
1127465116 15:59236594-59236616 GGTCCCTCCTCCAGACACTCTGG + Exonic
1128335852 15:66785422-66785444 GTTCCTTCCTCCAGAGAGGTTGG - Intergenic
1128883098 15:71261345-71261367 GATCCTTCCTCCAGAGACTTTGG + Intronic
1132163185 15:99562308-99562330 CATCCCTCCACAAGAGACTTGGG + Intergenic
1133216780 16:4297321-4297343 GATTTCTCCTCCAGAGTCTTGGG - Intergenic
1136846103 16:33577409-33577431 GATCCTCCCTGCAGGGACTGGGG + Intergenic
1137584664 16:49657271-49657293 TCTCCATCCTCCAGATACTTGGG - Intronic
1140138193 16:72227295-72227317 GATCCTTCCTCTTGAGTCTAGGG + Intergenic
1140572577 16:76125875-76125897 CATCCTTCCTGCAGGGTCTTGGG + Intergenic
1141875216 16:86819602-86819624 ACTCCTACCTCCAGAGACTGGGG - Intergenic
1142145536 16:88491430-88491452 GTCTCCTCCTCCAGAGACTTGGG - Intronic
1203107811 16_KI270728v1_random:1426063-1426085 GATCCTCCCTGCAGGGACTGGGG + Intergenic
1146539056 17:33679226-33679248 CATCCTTCATGCAGAGATTTAGG + Intronic
1147426682 17:40349033-40349055 GTTTCTTCCTCCAGAGATTGGGG + Intronic
1147553813 17:41463732-41463754 GGTCCCACCTCCAGAGACTCTGG + Intronic
1148722906 17:49767560-49767582 GTTCCTGCTTTCAGAGACTTTGG + Intronic
1152352183 17:79790165-79790187 GGGCTTTCCTCCTGAGACTTCGG - Intergenic
1152379171 17:79933615-79933637 GACTCTTACTCCAGAGACTCAGG - Exonic
1153003795 18:479931-479953 GATTCTTCCTTCAGAGCCTCAGG - Intronic
1153458116 18:5300874-5300896 GATCCTACATCCAGAAAGTTGGG + Intergenic
1157296855 18:46451300-46451322 GATTCTACCTCTACAGACTTAGG - Intronic
1159361529 18:67410851-67410873 GTTCCTCCCTCCAGAAGCTTTGG - Intergenic
1161939497 19:7394132-7394154 GATCATGCCTCCAGAGGCTGAGG - Intronic
1165035028 19:33026703-33026725 GATCCTCCCTGCAGGGACTGGGG - Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1168236861 19:55069086-55069108 GACCCATCCCCCAGAGACCTGGG + Intronic
926245622 2:11120784-11120806 CACCCTTCCTCCAGAGTCCTGGG - Intergenic
927741154 2:25570709-25570731 GATCCTGCCTCCAGTGAGGTGGG - Intronic
929297180 2:40261541-40261563 GTTCCTTCTTTCAGAGATTTAGG + Intronic
930111294 2:47681052-47681074 GATCCTTGCTCCTGAGATTGGGG + Intergenic
931186926 2:59961838-59961860 GTTCTTTCTTCCAGAGCCTTAGG - Intergenic
932314327 2:70769286-70769308 GAGCCTACCTCCAGAGATTCTGG - Intergenic
935233353 2:101118167-101118189 GGTCCTACCTCCAGAGCCCTGGG + Intronic
935287041 2:101574246-101574268 ATTCCTTCCTCCAAAAACTTGGG + Intergenic
935846244 2:107168476-107168498 GTTCCTTCTTACAGGGACTTTGG + Intergenic
937325561 2:120987985-120988007 GATCCTCCCTCCTCAGACTCTGG - Intronic
939173467 2:138722764-138722786 GATCTTTGCTCAAGAGATTTTGG + Intronic
940882121 2:158957189-158957211 CATCCTCCCTCCAGAGGCTCTGG - Intergenic
941204679 2:162557295-162557317 GATGCTTCTTCTAGAAACTTAGG - Intronic
941900983 2:170677841-170677863 GTTTCATCCTCCAGAGACTTGGG - Intergenic
942076243 2:172359375-172359397 GATCCTTCCTGCACAGCCCTTGG - Intergenic
942326377 2:174780165-174780187 GACCCTTCTCCCAGAGACTTGGG + Intergenic
942859888 2:180596914-180596936 GAATCCTCCTCTAGAGACTTTGG - Intergenic
942882840 2:180883393-180883415 GATCACTCCTCCAGTGACTGAGG - Intergenic
943781737 2:191831356-191831378 GCTACTTCCTCCAAAGGCTTTGG - Intergenic
944803417 2:203258269-203258291 GATCCTTCCTCCTGAGTAGTTGG - Intronic
1174798325 20:53541064-53541086 GATCCTTCCACCTCAGCCTTCGG - Intergenic
1176343402 21:5718764-5718786 TCTCCATCCTTCAGAGACTTGGG - Intergenic
1176501425 21:7605692-7605714 TCTCCATCCTTCAGAGACTTGGG + Intergenic
1176537723 21:8116833-8116855 TCTCCATCCTTCAGAGACTTGGG - Intergenic
1176839239 21:13825535-13825557 GCTGCTTCCTCCAGGGACATGGG + Intergenic
1183164776 22:36139468-36139490 GATCCTTCTTCCAGGGACTCAGG - Intergenic
1183176080 22:36225679-36225701 GATCCTTCTTCCAGGGTCTCAGG - Intergenic
1183182254 22:36268034-36268056 GATCCTTCTTCCAGGGTCTCGGG + Intergenic
1183573371 22:38671056-38671078 TGTCCTTCCTCCAGAGACAGGGG + Exonic
1203242669 22_KI270733v1_random:33188-33210 TCTCCATCCTTCAGAGACTTGGG - Intergenic
952087839 3:29848080-29848102 ATTCCTTCATTCAGAGACTTAGG - Intronic
952491343 3:33876556-33876578 GATCCTGGCTCCAGTGGCTTCGG + Intergenic
952774002 3:37027275-37027297 GATCCTTCCACCTGAGCCTCCGG - Intronic
953120826 3:40039879-40039901 GATTCTCCCCCAAGAGACTTGGG - Intronic
954344105 3:49981741-49981763 TATACTTCCTCCAGAGATCTTGG + Intronic
954454915 3:50592609-50592631 GATCCTCCATCCAGAGTCTCAGG - Intergenic
954838437 3:53491755-53491777 CAGCCTTCCTCCACAGATTTGGG + Intergenic
955665416 3:61344694-61344716 GATCCTTTCCTCAGGGACTTGGG + Intergenic
959703078 3:109316389-109316411 GATCCTCCCTCCGCAGCCTTCGG + Exonic
962688083 3:137866702-137866724 GGTCCTGCCTCCACAGATTTGGG + Intergenic
962762493 3:138528148-138528170 GATCCTTCCACCTCAGTCTTCGG + Intronic
965082614 3:164054048-164054070 ATTCCTTCCTCCAGCGACTAGGG + Intergenic
967194716 3:187016469-187016491 GAAGCTTCCTCCAGGGACATGGG + Intronic
970343748 4:15133261-15133283 GATCCTCCCTCCTCAGCCTTCGG + Intergenic
970868523 4:20785813-20785835 GATCCTTCCACCAAGGTCTTAGG - Intronic
972699718 4:41482413-41482435 ACTCCTTCCTCCACAGCCTTAGG - Intronic
974798203 4:66780719-66780741 GGACCTTCCTCCAGAAACCTAGG - Intergenic
979604664 4:122625209-122625231 TTTCCAGCCTCCAGAGACTTCGG + Intergenic
979762483 4:124423941-124423963 GATTCTTCCTCCAGAAAATCGGG + Intergenic
980938154 4:139246016-139246038 GATCCTCCCACCTCAGACTTTGG - Intergenic
982062508 4:151618596-151618618 GTGCCTTCCTCCACAGATTTTGG - Intronic
983730813 4:170991587-170991609 GCTCCCTGCTCCAGATACTTAGG + Intergenic
985148177 4:186916580-186916602 AATCCTTCCTCCAGAGTATATGG - Intergenic
987250442 5:16095388-16095410 GATCCTTCTTCCAGACACTGAGG - Intronic
988650737 5:33147795-33147817 GGTACATCCTCCAGAGAATTAGG - Intergenic
988995776 5:36713811-36713833 AATGATTACTCCAGAGACTTAGG - Intergenic
990222748 5:53611632-53611654 GATACTTCCTACAGATACTAAGG + Intronic
990826784 5:59909338-59909360 GAACCTTACTCCAGAGATTCTGG - Intronic
990849807 5:60190136-60190158 TTTCCTTCCTGCAGATACTTTGG - Intronic
992011389 5:72531180-72531202 GGTGCTTCCTCCAGAGATTCTGG - Intergenic
992483398 5:77173089-77173111 GCTCCTTCCTCCAGAGTTTTTGG + Intergenic
997202084 5:132016921-132016943 TCTCCCTCCTCCAGAGACTATGG + Intergenic
997372974 5:133373805-133373827 GATGCTTCATCCTGAGATTTTGG - Intronic
999099597 5:149012455-149012477 GACCCTTTCTCCACAGGCTTAGG + Intronic
999829881 5:155308249-155308271 GAGCCTTTTTCCAGTGACTTGGG - Intergenic
1000458984 5:161488366-161488388 TATCCTTCCTCCAGAGGCTAAGG - Intronic
1000479475 5:161753786-161753808 GATCCTTTCTCCCCAGATTTTGG + Intergenic
1001094310 5:168764469-168764491 GATCATTCCTACAGGGACCTGGG - Intronic
1001804559 5:174572160-174572182 GATCCTGCCAGCTGAGACTTGGG - Intergenic
1003665696 6:8109386-8109408 GAGCCTTCCTCCAGGGAGTGTGG - Intergenic
1005364124 6:25060423-25060445 GATTCTTCCTCCTGAGAATTTGG - Intergenic
1007604018 6:43103530-43103552 GATCCTTCCTCCTTTCACTTGGG - Intronic
1010933755 6:81835580-81835602 GATCTTTCCTTGAGGGACTTGGG + Intergenic
1015777163 6:136825450-136825472 GATCCTTCTGCCTCAGACTTGGG - Intronic
1015863063 6:137700494-137700516 TATCCTTTATCCTGAGACTTAGG - Intergenic
1016814026 6:148287133-148287155 TCTCCTTCCTCCAGATGCTTGGG + Intronic
1017352541 6:153459211-153459233 GCTCCCTCCTCCAGACCCTTGGG + Intergenic
1019021863 6:168925589-168925611 GATCCTGCTGCCAGAGACTGAGG - Intergenic
1022258543 7:28682699-28682721 GATCCTTCCTAGAGAGAGCTGGG - Intronic
1022442834 7:30447940-30447962 AATCCCTCATCCAGAGCCTTTGG - Intronic
1026736034 7:72949312-72949334 GATCCTTCCTGCAGTGGCTCGGG - Exonic
1026786381 7:73304229-73304251 GATCCTTCCTGCAGTGGCTCGGG - Exonic
1027107694 7:75415749-75415771 GATCCTTCCTGCAGTGGCTCGGG + Intergenic
1027685606 7:81276517-81276539 GGTCCTTCCTCAAGTGAATTGGG - Intergenic
1028843956 7:95459554-95459576 GCTCCTTCCTCCAGGGTCTGTGG - Intergenic
1029529599 7:101116571-101116593 GCTTCTTTCTCCAGAGACTGGGG + Intergenic
1034153252 7:148933686-148933708 GATCCTTCCACCACAGTCTCCGG - Intergenic
1037256072 8:16955766-16955788 GATACTTGCTTCTGAGACTTTGG + Intergenic
1037638772 8:20723671-20723693 CATCCTCCCTCCAGAGACGCTGG + Intergenic
1040295607 8:46147549-46147571 GGGCCTTCCACGAGAGACTTAGG + Intergenic
1040311021 8:46236913-46236935 GGTCCTTCCTCGAGAGACACAGG - Intergenic
1040313155 8:46247258-46247280 GGGCCTTCTTCCAGAGGCTTAGG - Intergenic
1041189089 8:55334938-55334960 GGTCCTTCATCCATAGGCTTTGG + Intronic
1042466798 8:69137230-69137252 GATCATTCCTGCTGAGAATTTGG + Intergenic
1045852407 8:106718434-106718456 GATCCTTTATCCAAATACTTAGG - Intronic
1048267566 8:133000960-133000982 GATCCTTCCCACAGGGACCTTGG - Intronic
1053919623 9:42974931-42974953 GCTCCTTCCTCCGGGGACATGGG - Intergenic
1055568988 9:77597345-77597367 CATCATTTCTCCAGAGACTCAGG - Intronic
1059823288 9:117997671-117997693 GATCCTTCTTCCTCAGCCTTTGG + Intergenic
1203458995 Un_GL000220v1:16271-16293 TCTCCATCCTTCAGAGACTTGGG - Intergenic
1188165777 X:26861690-26861712 GGTCCTTCCTGCTGTGACTTTGG + Intergenic
1188414190 X:29912542-29912564 TCTCCTTTCTCCATAGACTTTGG - Intronic
1189110236 X:38282044-38282066 GATGTGTACTCCAGAGACTTTGG - Intronic
1189663790 X:43331693-43331715 GATCCTCCCTCCAAAGCCTCTGG + Intergenic
1190050861 X:47147353-47147375 GATGCTTCCTGCAGGGACTCTGG - Exonic
1190194706 X:48307106-48307128 GATCCTTCCACCACAGCCTCGGG + Intergenic
1192231091 X:69265539-69265561 TAGCCTTCCTCCAGAGACCCAGG + Intergenic
1192915967 X:75651824-75651846 GCTCTTTCCTCCAGAAGCTTCGG + Intergenic
1197393566 X:125898291-125898313 GCTACTTCCTCCAGACCCTTGGG + Intergenic
1198277774 X:135112733-135112755 GCTCCCTCCTCCAGATCCTTGGG + Intergenic
1198401090 X:136269002-136269024 GTTCCTTCCTGCTCAGACTTAGG - Intergenic
1198677333 X:139144696-139144718 GATCGTTGCTCTAGAGGCTTTGG - Intronic
1200304129 X:155007790-155007812 GATAATTTTTCCAGAGACTTTGG - Intronic