ID: 1128883546

View in Genome Browser
Species Human (GRCh38)
Location 15:71265003-71265025
Sequence GGGCAGGGCCCTGATCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 5, 2: 23, 3: 112, 4: 424}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128883546 Original CRISPR GGGCAGGGCCCTGATCTGAT AGG Intronic
900576440 1:3384884-3384906 GGCCAGGGCAGTGATCTGCTCGG + Intronic
900637113 1:3671433-3671455 GGGCAGGGCTGTGATCTTGTGGG - Intronic
900694057 1:3999423-3999445 GCGCAGGGCCCTGAGCTCCTGGG + Intergenic
900703111 1:4060261-4060283 GGGAAGGGCTTTGATCTGAAAGG - Intergenic
900725804 1:4215799-4215821 ATGCAGGGCTCTGATCTGTTTGG + Intergenic
900884079 1:5403172-5403194 GGATGGGGCCTTGATCTGATGGG - Intergenic
901190530 1:7407401-7407423 GGGAAGGGCCCTGCTCTGTGGGG + Intronic
901491415 1:9598212-9598234 GGGCAGGGCCCACAAGTGATGGG - Intronic
901544646 1:9946728-9946750 GTGTGGGGCCCTGATCCGATAGG + Intronic
901915786 1:12498848-12498870 GGTTGGGGCCCTGAGCTGATAGG - Intronic
902097618 1:13959549-13959571 GGGCAGGGCCATGTTCCAATAGG - Intergenic
902133756 1:14286301-14286323 AGGGTGGGTCCTGATCTGATAGG - Intergenic
902800896 1:18829344-18829366 GGGGAGGGCCCTGAGCTCCTGGG + Intergenic
902946696 1:19846005-19846027 GGGGAGGGCTCTGATTTGAGGGG - Intergenic
904051516 1:27642333-27642355 GGGTAGGACCCCGATCTGATAGG - Intergenic
904595870 1:31644938-31644960 GGGCTGGGCCCGCATCTGATTGG + Intergenic
904833334 1:33319729-33319751 TGGCAGGACCCTGAGCTGACAGG - Intronic
904833830 1:33322290-33322312 TGGCAGGACCCTGAGCTGACGGG - Intergenic
904891564 1:33783367-33783389 GGGCAGGGCCCCGATCTGAGAGG + Intronic
905452462 1:38065408-38065430 GGGCAGGGCCCTGTGCTGCCTGG + Intergenic
905749193 1:40447307-40447329 GGGTGGGGCCCTGATCTGTTAGG + Intergenic
905935785 1:41823049-41823071 GGGTGGGGCCCTAATCTGAAAGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906211656 1:44015677-44015699 AGGCTGGGCCCTGCACTGATAGG - Intronic
906660892 1:47580809-47580831 GGGCAGGCCCCTCATGTGGTGGG + Intergenic
906685374 1:47759940-47759962 GGGCAGGGACCAGATCTTAGAGG + Intergenic
906923277 1:50087698-50087720 GGGTAGGGTCCTAGTCTGATAGG + Intronic
906990607 1:50733546-50733568 GGGCTGGGTCCTAATCTGATGGG + Intronic
907299700 1:53478921-53478943 GAGCGGGGCCCTGATCCAATAGG + Intergenic
907321923 1:53608289-53608311 GGGTGGAGCCCTGATCAGATAGG - Intronic
907792113 1:57677042-57677064 GGGTGGGGCACTGATTTGATAGG + Intronic
907862043 1:58363069-58363091 AGGATGGACCCTGATCTGATGGG - Intronic
907877124 1:58501852-58501874 GGGTGGGGCCCTGATCGAATAGG + Intronic
907939147 1:59070497-59070519 GGGCAGGGACCACATCTTATAGG - Intergenic
908000705 1:59675904-59675926 GGGCAGGAGCCTAGTCTGATGGG + Intronic
908502415 1:64757382-64757404 GGGTGGGTTCCTGATCTGATAGG + Intronic
909900024 1:81121942-81121964 AGGCAGGGTCCTGTTTTGATTGG - Intergenic
911653524 1:100417141-100417163 AGGCAGGGGCCTGATCTTATTGG + Intronic
912233609 1:107823752-107823774 GGGTGAGGCCCTGATCTGACAGG + Intronic
912284825 1:108357985-108358007 GCATGGGGCCCTGATCTGATAGG + Intergenic
912795228 1:112689267-112689289 GGGCAGGGAACTGGTCTGCTGGG + Intronic
912941202 1:114046671-114046693 AGGCAGGGCCTTGATTTAATAGG + Intergenic
913522147 1:119654771-119654793 GGGAAAGGCCCTGATCTGGGTGG - Intergenic
914503916 1:148272095-148272117 AAGCAGGGCCCTAATCTGGTAGG - Intergenic
914719936 1:150281640-150281662 GGGTAGGTCCCTGATCTCCTAGG - Intergenic
915323654 1:155069786-155069808 GGGCAGGGCCCCAAGCGGATGGG - Intergenic
916727488 1:167535729-167535751 GGTTGGGGCCCTGATCTGACAGG + Intronic
917517514 1:175720182-175720204 GGGTAGGGCTCTGATCAGATAGG + Intronic
919243227 1:194941696-194941718 GGATAGGGTCCTGATCAGATAGG - Intergenic
919957641 1:202435110-202435132 GGGTGGGGCCCTAATCTGATAGG - Intronic
921614200 1:217247573-217247595 GGTTGGGGCCCTTATCTGATAGG + Intergenic
924159584 1:241217127-241217149 GGGTGGGGCCCTGATCCAATAGG + Intronic
1062921060 10:1280138-1280160 GAGTGGGGTCCTGATCTGATGGG - Intronic
1063157912 10:3397045-3397067 GGGCAGGGCCCTAATCCAATAGG + Intergenic
1063209988 10:3871623-3871645 TGGCAGGGCCCTGATGCAATAGG + Intergenic
1063479730 10:6364519-6364541 GGGTGGGGCCCTGATCCAATAGG - Intergenic
1064097839 10:12436963-12436985 GGGCAGGGCGCAGATCAGGTGGG + Intronic
1064968524 10:21039817-21039839 GGTCAGGGCATTGATTTGATGGG - Intronic
1066231772 10:33441862-33441884 GGGTAGGGCCCTGATCCCACAGG - Intergenic
1067051529 10:43024325-43024347 GGGTAGGGCCCTGATTCAATGGG + Intergenic
1067058991 10:43068168-43068190 GGGCAGGGCCCAGGACGGATGGG + Intergenic
1067364285 10:45610668-45610690 GAGTAGGGCCCTAATCTAATAGG + Intergenic
1069807569 10:71135607-71135629 AGGTGGGGCCCTGATCTGATAGG - Intergenic
1070005718 10:72422149-72422171 GGGTGGGGCCCTAATCTGCTAGG + Intronic
1072810946 10:98461278-98461300 GGGCTAGGTCCAGATCTGATAGG + Intronic
1073433566 10:103502512-103502534 GGGTGAGGTCCTGATCTGATAGG - Intronic
1075708326 10:124516324-124516346 AGAGGGGGCCCTGATCTGATGGG - Intronic
1076574057 10:131452150-131452172 GGGCAGGGCCCAGGCTTGATTGG - Intergenic
1076756649 10:132576106-132576128 GGGCTGGGCCGTGATCTCAGAGG - Intronic
1076990135 11:268390-268412 GGGCAGGGCCGTGGTCTGGCAGG - Intergenic
1077049225 11:559313-559335 GGGTAGGGCCCTGAGCTGGGGGG - Intronic
1077221545 11:1420243-1420265 GGGCCGGCCCCTGCTCTGCTGGG + Intronic
1077334649 11:1997916-1997938 CGGGAGGGCCCTGCTCTGATTGG - Intergenic
1077896571 11:6457664-6457686 GGGCAGGGTCCTGGGCTGGTGGG - Intronic
1078435640 11:11322980-11323002 GGGTGGTGCCCTAATCTGATAGG - Intronic
1078710027 11:13782610-13782632 GGGTGGGGCCCTAATCTGATAGG - Intergenic
1078828908 11:14960173-14960195 GGGTAGGGCCCTAATCTGATAGG - Intronic
1079079797 11:17406283-17406305 GGGCAGGGAGCTGAACTCATGGG + Intronic
1079083603 11:17430305-17430327 GCGCTGGGTCCTGCTCTGATTGG - Intronic
1079331198 11:19534277-19534299 GGGCACGGACCTGATCTAGTGGG + Intronic
1080922453 11:36722616-36722638 GGATAGGGTCCTTATCTGATAGG - Intergenic
1081311093 11:41573558-41573580 AGGGTGGGGCCTGATCTGATAGG + Intergenic
1081522717 11:43898591-43898613 AGGCAGGTCCATGAGCTGATAGG - Intronic
1081622143 11:44624943-44624965 GGGAAGGGCCTTGATATGGTTGG - Intergenic
1081753444 11:45528296-45528318 GGGCAGGACCCGCATCTGATTGG + Intergenic
1083974685 11:66108328-66108350 GGGTGGGGCCCTAATCTGATAGG - Intronic
1084193795 11:67511889-67511911 GGGTAGGGCTCTGATTTGATAGG - Intergenic
1084673406 11:70620713-70620735 GGGTGGGGCCCTGATCCAATGGG + Intronic
1084775225 11:71370401-71370423 GGGCAGAGCCCTGACCTCACAGG + Intergenic
1085150223 11:74246466-74246488 GGGCAGAGCTCTGACATGATAGG - Intronic
1085345509 11:75765875-75765897 TGACAGGGCCCAGATCTGAACGG - Intronic
1085508947 11:77075600-77075622 GTGAAGGGCCCGGATCTGCTGGG + Intronic
1085712085 11:78838727-78838749 GGGCAGGGCCTTGTTCTCACAGG + Intronic
1085862311 11:80248686-80248708 AGGCAGGGACTAGATCTGATGGG - Intergenic
1087875472 11:103350818-103350840 GGTTCGGGGCCTGATCTGATAGG - Intronic
1089059766 11:115617026-115617048 AGGCAGGGCCCTGACCTCAGAGG - Intergenic
1089060996 11:115626029-115626051 GGGCCGGGCCCCAGTCTGATGGG - Intergenic
1089306538 11:117529946-117529968 ACGCGGGGCCCTGATGTGATGGG - Intronic
1089575815 11:119442224-119442246 GGGTAGGGTCCTAATCTGATAGG - Intergenic
1089799375 11:121012701-121012723 GGGTGGGACCCTGATTTGATAGG - Intergenic
1090318948 11:125824119-125824141 GGGTGGGGCCCTAATCTGATAGG - Intergenic
1090357549 11:126150091-126150113 GAGCAGGGCCCTGAGCTGGGAGG + Intergenic
1090656848 11:128852724-128852746 GGGCAGTGTCCTGTTCTGAGAGG - Intronic
1090772635 11:129934660-129934682 GGGCAGGGGCCAGATCAGGTAGG - Intronic
1202817632 11_KI270721v1_random:53098-53120 CGGGAGGGCCCTGCTCTGATTGG - Intergenic
1091535784 12:1407844-1407866 GGGTGGGGCCTTAATCTGATAGG - Intronic
1091802379 12:3332830-3332852 GGGCATGGCTCTGTTCTGCTAGG - Intergenic
1092495295 12:8987296-8987318 GGGTGGGGCCCTGATCTGATAGG + Intronic
1092953849 12:13531610-13531632 AAGCAGGGCTCTAATCTGATGGG + Intergenic
1095530378 12:43180235-43180257 GCCCAGTGCCCTGATTTGATAGG - Intergenic
1096120301 12:49084655-49084677 GGGTAGGGCCCTGATCCTACAGG - Intergenic
1097960550 12:65528145-65528167 GGGTGGGGCCCTGATCCAATAGG + Intergenic
1098023559 12:66179765-66179787 GGGTAGGGCCCTGATCCTATAGG + Intergenic
1098484428 12:71004338-71004360 GGGCTGGGCCCTAATCTGATAGG + Intergenic
1099279766 12:80629243-80629265 GGGTGAGGCCCCGATCTGATGGG - Intronic
1099500239 12:83405106-83405128 GGGTAGGGTCCTGATCTGATAGG - Intergenic
1099652657 12:85448068-85448090 GGTCAGGGACATGATCTGAGTGG + Intergenic
1099703219 12:86116157-86116179 GGTCAGGGCCCAGATCACATTGG + Intronic
1101114588 12:101519614-101519636 GGGTGGGGCCCTGATCTCCTGGG - Intergenic
1102364049 12:112316089-112316111 TGGCAGGGCCCAGATCACATAGG - Intronic
1102808024 12:115799295-115799317 AGGTGGGGTCCTGATCTGATAGG + Intergenic
1102981830 12:117247700-117247722 GGGTAAAGCCCTGATCTGATAGG + Intronic
1102988337 12:117296801-117296823 GGGTGGGGCCCTAATCTGATAGG + Intronic
1104001649 12:124864003-124864025 GGGCGGGGCGCTGATCGGACGGG + Intronic
1104487229 12:129162170-129162192 GGGTGGGGCCCTAATCTGATAGG + Intronic
1105051204 12:133052663-133052685 GGGTAGGACCCTGATCAAATAGG - Intronic
1106309885 13:28544831-28544853 GGGTAAGGCTCTGATCTGACTGG - Intergenic
1106529555 13:30577011-30577033 AGGTGGAGCCCTGATCTGATAGG + Intronic
1107799369 13:44089888-44089910 GGGGTGGGCCCTAATCTAATAGG - Intergenic
1109742139 13:66568120-66568142 AGGTGGGGCCCTAATCTGATAGG + Intronic
1109954793 13:69551662-69551684 AGGTTGGCCCCTGATCTGATAGG + Intergenic
1111461916 13:88556256-88556278 GGGCATGACCCTAATCTGATAGG - Intergenic
1112478325 13:99752378-99752400 GGGCAGGGACTTGGTCTGCTTGG - Intronic
1115702362 14:35966619-35966641 GGGTAGGGCCCTGATCTGATAGG + Intergenic
1115922598 14:38393112-38393134 GGGTAGGATCCTAATCTGATAGG - Intergenic
1116647640 14:47549692-47549714 GTGAAGAGCCCTGATCTGATAGG + Intronic
1116865759 14:50030263-50030285 GGACAGTGTCCTAATCTGATAGG + Intergenic
1117752560 14:58938996-58939018 GGGCAAGGCACAGATCTGGTTGG + Intergenic
1117755605 14:58971258-58971280 GGGGAGGGAACTAATCTGATAGG - Intergenic
1118838956 14:69496879-69496901 GGGTAGGGCCCTAATCCAATAGG - Intronic
1119864343 14:77960821-77960843 GGGTGGGTCCCTCATCTGATAGG + Intergenic
1120676987 14:87431976-87431998 GGGCAGGGCCGTAATCCAATAGG + Intergenic
1121649318 14:95545441-95545463 GAGCAGTGCTCTAATCTGATGGG - Intergenic
1121821730 14:96974078-96974100 GGATGGGGCCCTGATCTGATAGG + Intergenic
1122160390 14:99780147-99780169 GGGTGAGGCCCTGATCTGTTAGG - Intronic
1122310431 14:100791008-100791030 GGGCAGGGCCTTTATCTGGTGGG - Intergenic
1122366181 14:101196130-101196152 GGGCAGGGCTCCGAGCTGCTGGG - Intergenic
1122803759 14:104246464-104246486 GGGCAGGGCCCTGATCCTGCTGG + Intergenic
1122827908 14:104380313-104380335 GGGTGGGGCCCTAATCTGATGGG - Intergenic
1123044348 14:105504070-105504092 GGGCAGAGCCCTGGGCTGGTGGG + Intergenic
1202904890 14_GL000194v1_random:63701-63723 GGGTAAGGCCCTAATCTGTTAGG - Intergenic
1124723347 15:32132730-32132752 GGGTAGAGCCCTATTCTGATAGG - Intronic
1124929225 15:34102674-34102696 GGACAGAGGCCTGATCTTATCGG - Exonic
1125305466 15:38307498-38307520 AGGTGGGGCCCTAATCTGATAGG - Intronic
1125677529 15:41510917-41510939 AGGCAGGGACCTGCTGTGATGGG + Intronic
1125768256 15:42149256-42149278 GGGTAGGGCCTTCAACTGATAGG + Intronic
1126213892 15:46132302-46132324 GGGCAGGGCACAGATGTGGTTGG + Intergenic
1126372783 15:47964746-47964768 GGGTAGGCCCCTTACCTGATAGG - Intergenic
1127006954 15:54581571-54581593 GGGTGGGGCCCTGGCCTGATGGG - Intronic
1127550341 15:60031430-60031452 CGGTGGGGCCCTGATCTGATAGG + Intronic
1127616474 15:60690934-60690956 GAGCAGGGGACTGATGTGATCGG - Intronic
1127808852 15:62545776-62545798 TGGCAGGGCCTTATTCTGATTGG + Intronic
1128810384 15:70567081-70567103 GGGCAGGGCCCTGTGCTGCTGGG + Intergenic
1128883546 15:71265003-71265025 GGGCAGGGCCCTGATCTGATAGG + Intronic
1129694845 15:77734752-77734774 AGGCAGCTCCCTGGTCTGATGGG - Intronic
1130064376 15:80592293-80592315 GGGCAGGGGCCTGCTCTGTGGGG - Intronic
1130067441 15:80616393-80616415 GGGCAGGGCTCCGATCTGGTAGG - Intergenic
1130335974 15:82957691-82957713 GGGCAGGCCCTTGGCCTGATTGG - Intronic
1133856009 16:9549820-9549842 GGGTAAGGCTCTGATCTGATAGG + Intergenic
1134047233 16:11109710-11109732 GAGCAGGGCCCACAGCTGATAGG - Intronic
1134259918 16:12642909-12642931 GGGTGGGGCCCTGATCTGATAGG - Intergenic
1134762627 16:16727650-16727672 GGGTGGGGCCCTAATCTGATAGG + Intergenic
1134974555 16:18560748-18560770 GGGCAGGTCGCAGAGCTGATGGG + Intronic
1134983425 16:18631498-18631520 GGGTGGGGCCCTAATCTGATAGG - Intergenic
1135459487 16:22628973-22628995 GGGTGGGGCCCTAATCTAATAGG + Intergenic
1135890916 16:26356432-26356454 GGATGGGGCCCTGATCTGATAGG - Intergenic
1135989595 16:27209938-27209960 GGGGAGGGCCCTCATCTGTCTGG - Intronic
1136172365 16:28496722-28496744 GGCCAAGGACCTGAGCTGATGGG + Exonic
1137270118 16:46897770-46897792 GGGCAGGGCCCTGGGCTGGGCGG + Intronic
1137466361 16:48713372-48713394 GGTTGGGGCTCTGATCTGATAGG + Intergenic
1138203384 16:55106509-55106531 AGGGCGGGCCCTGATCTTATAGG + Intergenic
1138694649 16:58801264-58801286 GGGTAGGGCCCTAGTCTGATTGG + Intergenic
1141176971 16:81727192-81727214 AGGCAGGGCCCTCTCCTGATGGG - Intergenic
1141667465 16:85473318-85473340 GGGCAGGGCCAGGAGCTGGTGGG + Intergenic
1141862612 16:86728273-86728295 TGGCAGGTCCCTGTGCTGATTGG + Intergenic
1141992837 16:87620326-87620348 GGGCAGGGTCCTGGTGTCATGGG + Intronic
1141999665 16:87656980-87657002 GGGTGGGGCCCTAATCTGATGGG - Intronic
1142163064 16:88569385-88569407 GGGTGGGGTCCTGATCTGATAGG - Intergenic
1142355304 16:89598973-89598995 TGTCAGGGCCCTGTGCTGATCGG + Intergenic
1142355347 16:89599121-89599143 TGTCAGGGCCCTGTGCTGATCGG + Intergenic
1143253416 17:5538650-5538672 GGGCAGGGCCCATGTCTGTTTGG + Intronic
1143295833 17:5871343-5871365 GGGAGGGGTCCTGATCTGGTAGG + Intronic
1143632830 17:8148614-8148636 GGTCAGGGCCCTGGCCTGGTGGG - Intronic
1143868022 17:9938175-9938197 GGGTGCAGCCCTGATCTGATAGG + Intronic
1144287989 17:13798167-13798189 GGGTGGGGCCCTGATCTGATAGG + Intergenic
1144829826 17:18125073-18125095 GTGCAGTGCCTTGATCAGATAGG - Intronic
1144847984 17:18229960-18229982 GGCCAGGGCGCTGGGCTGATTGG - Exonic
1146262300 17:31430048-31430070 GGGGTGGGCCCTGATTGGATGGG + Intronic
1146670875 17:34736618-34736640 GGGCGGCACCCTAATCTGATAGG - Intergenic
1148205789 17:45779024-45779046 GGGGAGGGGGCTGGTCTGATGGG - Intergenic
1148958069 17:51370262-51370284 GGGCAGGTCCGTGTTCTGCTAGG + Intergenic
1149998589 17:61417712-61417734 AGGCAGGGCCCTTGTGTGATGGG - Intergenic
1150487656 17:65555022-65555044 GGGCAGGACTCTGGTCTGAGTGG - Intronic
1150613978 17:66754869-66754891 AGGTGGGGCCCTGATCTGACAGG - Intronic
1150861670 17:68806951-68806973 AGGAAGTGCCCTGGTCTGATTGG - Intergenic
1151415923 17:73964024-73964046 GAGTAGGGTCCTAATCTGATAGG + Intergenic
1151941652 17:77296018-77296040 GGGCAGGACCCTAATCTAATAGG + Intronic
1153816278 18:8792990-8793012 GGGGGGGCCCCTGAGCTGATCGG - Exonic
1154253659 18:12765262-12765284 GGCCAGGGCCCTCACCTGATAGG + Intergenic
1155233418 18:23795931-23795953 GGGTGGAGCCCTGATCTGATAGG + Intronic
1157012157 18:43662837-43662859 AGGCAGGGCAGTGATCTGAGGGG + Intergenic
1157428328 18:47602670-47602692 AGGCAGGGCCCCGTTCTAATGGG + Intergenic
1157537740 18:48472491-48472513 GGGTGGGGCCCTGATCTGATAGG + Intergenic
1157689334 18:49668358-49668380 GGGCTGGTCCCTGCTCTGAGAGG + Intergenic
1157711641 18:49853684-49853706 GGCCAGGGCCCCCATCTGAGGGG + Intronic
1157883123 18:51341092-51341114 GGGTAGGGCCCTAATCTGACAGG + Intergenic
1158619881 18:59023674-59023696 GAGCAGGGCCCTGAGCTAAGGGG - Intergenic
1158867173 18:61649094-61649116 GAGCAGGGCCCTGATCTCTGGGG - Intergenic
1159598991 18:70410915-70410937 GGGTGGGACCCTAATCTGATAGG + Intergenic
1159844989 18:73448337-73448359 GAGTGAGGCCCTGATCTGATAGG + Intergenic
1159901113 18:74046620-74046642 GGGTGGAGCCCTGATCTGATGGG + Intergenic
1161049385 19:2154661-2154683 AGGCAGGACTCTAATCTGATTGG + Intronic
1161659317 19:5536359-5536381 GAGCAGGGCCTTGATCTCAAGGG + Intergenic
1162144474 19:8605382-8605404 GGGGTGGGCCCTGGTCTTATTGG + Intronic
1162222370 19:9188866-9188888 GGGTCAGGCCCTGATCTAATAGG - Intergenic
1162724372 19:12681165-12681187 GGGAAGGGACCGGATCTGAAAGG - Intronic
1162797792 19:13095588-13095610 GGGCAGGGGCAGGAACTGATGGG - Exonic
1162885142 19:13691481-13691503 GGGTGGGGCCCTGATCCAATAGG - Intergenic
1163426817 19:17244872-17244894 GGGCAGGCCTCTGACCTGCTCGG - Intronic
1163836611 19:19578847-19578869 GGATGTGGCCCTGATCTGATAGG + Intronic
1164427762 19:28157617-28157639 GAGTGGGGCCCTGATCTGATGGG + Intergenic
1165080825 19:33305059-33305081 GGGTAGGGTCCTAATTTGATAGG + Intergenic
1165845612 19:38816123-38816145 GGTCAGCCCCCTGCTCTGATTGG - Intronic
1166517676 19:43459776-43459798 GGGCCAGGCCTTCATCTGATTGG + Intergenic
1166864501 19:45827777-45827799 GGACAGGGCCCTGCCCTGAGGGG - Intronic
1166912305 19:46167732-46167754 GGGTAGGGCCCTGATCTGATAGG + Intergenic
1167300711 19:48675917-48675939 GGGCAGGACCCTGAGTTGAGTGG + Intergenic
1167488215 19:49775872-49775894 GGGCAGGGCCCAGGTTTGACAGG + Intronic
1168250302 19:55137819-55137841 GGGCTGGGCCCTGAACTCCTGGG - Intronic
1168669323 19:58229102-58229124 GGGCAGGGGCCTGATGGGATCGG + Intronic
925183563 2:1832158-1832180 GGGTGGGGTCCTGATCTGATGGG + Intronic
925901544 2:8512720-8512742 GGGTGGGGCCCTGATCCAATAGG - Intergenic
926165691 2:10521300-10521322 GCGTAAGGCCCTGATCTGATGGG + Intergenic
926195574 2:10761772-10761794 GGGTGGGGCCCTGATCCAATAGG - Intronic
926310950 2:11675902-11675924 GGGTGGGGCCCTGATCCCATAGG + Intergenic
926805075 2:16700851-16700873 GAGTGGGTCCCTGATCTGATAGG - Intergenic
926809019 2:16740154-16740176 GGCCTGGGCACTGACCTGATTGG - Intergenic
927071249 2:19531693-19531715 TGGCAGGGATCTGATCTGACGGG + Intergenic
927450194 2:23202757-23202779 GGGTGGGGCCCTGATCCAATAGG - Intergenic
927910030 2:26890912-26890934 GGGCAGGGCCGTGATCTGCTAGG - Intronic
928364972 2:30693391-30693413 GGGTGGGGTCCTGATCAGATGGG + Intergenic
928632249 2:33205815-33205837 GGGCAGGGCCCTGATGTGATAGG + Intronic
929593628 2:43162317-43162339 GTGCAGGGCCCTGCCCTCATGGG - Intergenic
929810071 2:45182354-45182376 GGGCAGGGCCTTTGTCTGTTTGG + Intergenic
930458823 2:51643005-51643027 GGGAGGGGCCCTGATCTGATAGG + Intergenic
930904491 2:56549726-56549748 GTGAGGGGCCCTGGTCTGATAGG + Intergenic
931643429 2:64400987-64401009 GGGCAGGGCCCTGCTAGGAAGGG + Intergenic
931939795 2:67239550-67239572 GGGTGGGGCCCTGATGTGATAGG + Intergenic
931987585 2:67756497-67756519 GGGCAGGCCCCTGCAGTGATAGG - Intergenic
933187494 2:79294349-79294371 GGGTGGGGACCTGATATGATAGG - Intronic
933523093 2:83399754-83399776 GGGTTGGGTCCTAATCTGATAGG - Intergenic
934157882 2:89220074-89220096 GGGTGGGGCCCTGATCCAATAGG - Intergenic
934209380 2:89962348-89962370 GGGTGGGGCCCTGATCCAATAGG + Intergenic
934768162 2:96892183-96892205 GGGCTGGGCACTGTTCTGACTGG - Intronic
934897225 2:98129428-98129450 GGGCAGGGCCCTGATTCTATAGG - Intronic
934901930 2:98166393-98166415 AAGGAGGGCCCTAATCTGATAGG + Intronic
935201567 2:100861215-100861237 GCTCAGTGGCCTGATCTGATTGG + Intronic
935235445 2:101134657-101134679 GGGCAGGGCCCTGATCCTATAGG - Intronic
935427870 2:102940135-102940157 GGGTGGGGCTCTGATCTCATAGG + Intergenic
935563187 2:104579125-104579147 GGGCAGGGCCCTAATCCTATAGG - Intergenic
935802774 2:106715136-106715158 GGGTGGGGCCCTAATCTAATAGG - Intergenic
936902109 2:117493180-117493202 GAGTGGGGCCTTGATCTGATAGG - Intergenic
938366074 2:130735566-130735588 GGGTGGGGTCCTAATCTGATAGG + Intergenic
938378262 2:130822772-130822794 GGGCGGGGCCCTGCTCAGATGGG - Intergenic
939988912 2:148859044-148859066 GGGAAGGGCCCTAATCTAATAGG - Intergenic
940155208 2:150648851-150648873 GGGTAAAGTCCTGATCTGATAGG + Intergenic
940477864 2:154189384-154189406 GGGCAGGACCTTGGTCTGATGGG + Intronic
940672463 2:156687626-156687648 GGGTAGGGCCCTGATTCAATAGG - Intergenic
941805928 2:169712299-169712321 GGGCAGCACCCTGAACTCATAGG + Intronic
941957767 2:171221832-171221854 GGGTAGGGCCCTAACCGGATAGG - Intronic
944087445 2:195865807-195865829 GGGTAGGGCCCTAATCTTATAGG + Intronic
944441115 2:199744342-199744364 GAGTGGGGCCCTAATCTGATAGG + Intergenic
944650089 2:201821260-201821282 GGGGAGTGCCGTGCTCTGATTGG + Intronic
944862128 2:203825054-203825076 GGGTAGGTCCCTAATCTGATAGG + Intergenic
944958934 2:204846555-204846577 GGGTGGGGCCCTGATATGATAGG + Intronic
945175451 2:207039088-207039110 AGGCAGGGACCTGATCTTAATGG - Intergenic
946339496 2:219058701-219058723 GGCCAGGGCCTTGGTCTGAGGGG + Intronic
947771723 2:232675626-232675648 GAGCAGGGCCTTGACGTGATCGG + Intronic
948512987 2:238484543-238484565 AGGCGGGGCCCTGATCCGACAGG + Intergenic
1168838448 20:893510-893532 GGGCAGGGCCCTGATGCATTTGG - Intronic
1168919680 20:1520860-1520882 GGGCAGGGACCTGATCACCTAGG - Intergenic
1169191952 20:3663427-3663449 TGGCAGAGCCCTAGTCTGATAGG + Intergenic
1169451475 20:5715637-5715659 GGGTGGGGCCCTGATCTGATAGG - Intergenic
1169733124 20:8808416-8808438 GAGTAGGTCCCTGATCTGATGGG - Intronic
1169813191 20:9629652-9629674 GGGTAGGACCCTAATCTAATAGG - Intronic
1169903325 20:10574999-10575021 GGGCAGGGCTCTGAGCTAACTGG - Intronic
1169938763 20:10914295-10914317 GGGTAGGGCCTTGGTTTGATGGG + Intergenic
1171071641 20:22074421-22074443 GTGTAGGGCTCTAATCTGATTGG + Intergenic
1171436279 20:25126993-25127015 GGGCAGTGCTTTGATCTTATTGG + Intergenic
1172213683 20:33218669-33218691 GGGTATGGCCCTAAACTGATGGG - Intronic
1172839785 20:37895646-37895668 GGGTGGAGCTCTGATCTGATAGG + Intergenic
1173249424 20:41356832-41356854 GGACAGGGCCCTGATCAGCATGG + Intronic
1173525996 20:43733117-43733139 GGATGAGGCCCTGATCTGATAGG + Intergenic
1173555374 20:43961861-43961883 GGGCCAGGACCTCATCTGATTGG - Intronic
1174049735 20:47759272-47759294 GGGCAGGGGCCAGATCTCACGGG - Intronic
1175330736 20:58162090-58162112 GGGGAGGACCCAGATTTGATAGG - Intergenic
1175588791 20:60170268-60170290 GGGTAGGGCCCTACTCTGATAGG + Intergenic
1176624254 21:9078459-9078481 GGGTAAGGCCCTAATCTGTTAGG - Intergenic
1177409966 21:20717325-20717347 GGATGGGGCCCTGGTCTGATGGG + Intergenic
1177949033 21:27510798-27510820 GGGCAGGGCACTGATCTGATTGG - Intergenic
1178369601 21:32016611-32016633 AGGCAGGGCCCTAATCCAATAGG + Intronic
1179576155 21:42309798-42309820 GGGCAGGGCACAGCTGTGATTGG + Intergenic
1179652185 21:42818671-42818693 GGGTGGGACCCTCATCTGATAGG + Intergenic
1180164719 21:46018781-46018803 GGGTCAGGCACTGATCTGATAGG - Intergenic
1180867117 22:19126061-19126083 GGGCAGGGGCCAGAGCTGAAAGG + Intergenic
1181043428 22:20203630-20203652 GGGCAGGACCCTCATCTGGAGGG + Intergenic
1181791778 22:25273214-25273236 GGGAAGTGCCGTGCTCTGATTGG - Intergenic
1182091454 22:27597902-27597924 GGGCAATGCACTGATCTCATGGG + Intergenic
1182100982 22:27657148-27657170 GGGTGGGGCCCTGAACTGATAGG - Intergenic
1182534623 22:30991537-30991559 GGGTGAGGCCCTGATCTGATAGG - Intergenic
1182678925 22:32063107-32063129 GGGTGGGGCCCCAATCTGATAGG - Intronic
1182734128 22:32518920-32518942 CGGTGGGGCCCTAATCTGATAGG + Intronic
1182768371 22:32775251-32775273 GGGTGGGACCCTGATCTCATAGG - Intronic
1183075043 22:35421521-35421543 GGGCAGGGCTCTGGCCTGCTGGG + Intronic
1183100991 22:35583963-35583985 GAGCAGGGACCAGATCTGGTTGG - Intergenic
1183944272 22:41315772-41315794 GGGTAGGGCCCTGATCCAACAGG - Intronic
1184508424 22:44917960-44917982 GGCCAGGGCCCTGATGTGGGAGG - Intronic
1184645461 22:45892472-45892494 GGGCAGGGCCCTGGGCTGCGGGG + Intergenic
1184871900 22:47245922-47245944 GGGCAGGGGCCGGATCCCATGGG - Intergenic
1185090427 22:48765785-48765807 GGGTGGGGCCCTGGTTTGATGGG - Intronic
1185206044 22:49539406-49539428 GGGCTGGGCTCTGATCTGATGGG - Intronic
1185212606 22:49579391-49579413 GGGTGGGGCCCTGATCTAATAGG + Intronic
1185332979 22:50259996-50260018 GGGCAAGGCCTTGGTGTGATGGG + Intronic
949624303 3:5850074-5850096 GGGCAGAGCCCTGAGCTGTCTGG - Intergenic
950484539 3:13265263-13265285 GGGCTGGGCCCTGATCCTAGGGG - Intergenic
950579949 3:13855551-13855573 GGGCAGGGTCCTGAGCAGCTGGG + Intronic
950674388 3:14545771-14545793 GGGCAGGGCCATGATCAGGCTGG - Intergenic
952190296 3:31015833-31015855 GGATAGGGCCCTGATTTGATAGG - Intergenic
952239771 3:31519044-31519066 GGGTAGAGCTCTAATCTGATAGG - Intergenic
953138661 3:40206574-40206596 AGGAAGGGCCCTCATCTGGTTGG - Intronic
953463192 3:43097596-43097618 GGGTGGGGCCCTAATCTGATAGG - Intronic
953509119 3:43517496-43517518 GGGTGGGGCCATGATATGATAGG + Intronic
954028035 3:47798604-47798626 GGGCAGGCCCCCAATCAGATAGG + Intergenic
954143228 3:48621126-48621148 GGGCAGTGCCCAGATGGGATGGG + Intronic
954747412 3:52794995-52795017 GGGCTGGGCACTGAGCTGCTGGG + Intronic
954806135 3:53221995-53222017 GGGTGAAGCCCTGATCTGATGGG + Intergenic
956366425 3:68508206-68508228 GGGTGGGGCCCTGATCTGACAGG - Intronic
956389597 3:68757304-68757326 GGGCATGGCCTTAATCTGACAGG - Intronic
956753598 3:72364399-72364421 GGGCAGGGCCCTAACCTAATAGG - Intergenic
957181065 3:76877984-76878006 GGGTGAGGCCCTAATCTGATAGG - Intronic
957362486 3:79177163-79177185 AGGCAGGGCACTGAACTGAAAGG + Intronic
957377043 3:79371814-79371836 GGGTGGTGCCCTCATCTGATAGG + Intronic
957655216 3:83065223-83065245 ATGGAGGGCCCTGATATGATAGG - Intergenic
958461287 3:94399639-94399661 GGGTGGGGCCCTAATCTGAGAGG - Intergenic
960238017 3:115307084-115307106 GGGTGAGGCCCTGATCTGACAGG + Intergenic
960373954 3:116875666-116875688 GGGTGGGGCCCTGATCTAATAGG - Intronic
961205306 3:125076709-125076731 AGGCAGGGCCCTGAGTTGAAAGG + Intergenic
961725575 3:128926761-128926783 GGTTGGGGCCCAGATCTGATAGG + Intronic
962040713 3:131704945-131704967 GGGTAGGGCCCCAATCTGATTGG + Intronic
962049519 3:131798066-131798088 GGGTGGGACCCTAATCTGATAGG - Intronic
963329516 3:143898605-143898627 GGGTAGGGTTCTAATCTGATAGG + Intergenic
964527790 3:157633285-157633307 GGGTAGGGTCCGGGTCTGATGGG + Intronic
964998460 3:162919505-162919527 AGGCAGGGCCCTGAGTTGAAAGG - Intergenic
965967391 3:174509755-174509777 GGGTGGAGCCCTGATCTGATAGG - Intronic
966042136 3:175504484-175504506 GGGTGGGGCCCTAATCTGATAGG + Intronic
966377347 3:179309975-179309997 GGGCAGGGACCAGGTCTGAGAGG - Intergenic
966875644 3:184320249-184320271 GGGCAGGGCCCAGATCCAGTAGG - Intronic
966936998 3:184717200-184717222 AGCCAGGGCCCTGGTCTGAATGG + Intergenic
967132353 3:186484005-186484027 GGATGGGGCCCTGATCTAATAGG + Intergenic
967820803 3:193837065-193837087 GGCTAGGGCCCTAATCTGATAGG - Intergenic
967849164 3:194069607-194069629 GGGTGGGGCCCTAATCTGATAGG + Intergenic
967994674 3:195157640-195157662 GGGCAGGGTCCTGGTCAGCTTGG - Intronic
968046477 3:195626601-195626623 GGGTGGGGCCCTGATCCGATAGG - Intergenic
968130733 3:196191451-196191473 GGGCAGGGCCCTGGGCTGTCTGG - Intergenic
968308176 3:197663440-197663462 GGGTGGGGCCCTGATCCGATAGG + Intergenic
968571364 4:1343314-1343336 GGATAGAGCCCTCATCTGATAGG - Intergenic
969044980 4:4330184-4330206 GGGAAGGCCCCTGATGTGACAGG + Intergenic
969433545 4:7170318-7170340 GGGTGGGGTCCTGATCTGATGGG - Intergenic
969579304 4:8054724-8054746 GGGCAGGGCTCTAAGCTGAGAGG + Intronic
969581685 4:8069028-8069050 GGGGAGGGCCCAGATCTCAAGGG - Intronic
969990461 4:11257011-11257033 AGGTGGAGCCCTGATCTGATAGG - Intergenic
972271387 4:37513522-37513544 GGGTGGGGCCCCAATCTGATAGG - Intronic
972465254 4:39349374-39349396 GGGTGGGGCTCTGATCTGACAGG + Intronic
975656856 4:76650111-76650133 AGGTAGGGCCCTGATCAGATAGG - Intronic
976397602 4:84572929-84572951 GGGTAAGGCCATGGTCTGATAGG + Intergenic
977336030 4:95700802-95700824 GGGTGGGGCCCTGATCTGATAGG + Intergenic
978142836 4:105337182-105337204 GCTTGGGGCCCTGATCTGATAGG - Intergenic
978727854 4:111991241-111991263 GGGCAAGGCCATGTGCTGATCGG - Intergenic
980133392 4:128837208-128837230 GGGCAGAGCCTGGCTCTGATAGG - Intronic
980934607 4:139214340-139214362 AGGTGGGGCCCTAATCTGATGGG - Intergenic
981507094 4:145514190-145514212 GGGTGGGGCCCTAACCTGATAGG - Intronic
982125210 4:152178187-152178209 GGACAGGACCCTGGTCTGAGGGG + Intergenic
984090724 4:175371472-175371494 GGGTGGGGCCCTAATCTGATAGG - Intergenic
984733641 4:183090758-183090780 CGGTGGGGCCCTGATCTAATAGG + Intergenic
985518995 5:362108-362130 GGGCAGAGCTCTGATCTGATGGG + Intronic
985765553 5:1777613-1777635 GAGGAGGGCCCTGACCCGATAGG + Intergenic
985849932 5:2381563-2381585 CAGTAGGGCCCTCATCTGATGGG - Intergenic
986147178 5:5089264-5089286 GGGCAGAGCCCTTATCTTATGGG + Intergenic
986361889 5:6986458-6986480 AGGCAGGACCCTGATCAAATAGG + Intergenic
986627720 5:9738252-9738274 GGGTAAGGCCCTGATCCAATTGG + Intergenic
986669230 5:10128021-10128043 GGGTGGGGTTCTGATCTGATAGG + Intergenic
986861586 5:11932324-11932346 GGGTGGGGCTCTGATCTAATGGG + Intergenic
987884103 5:23790429-23790451 GGGTGGGACCCTGATCTGATAGG - Intergenic
988775796 5:34477255-34477277 AGGCAGGGCCCCGATCTGATAGG + Intergenic
989093392 5:37757628-37757650 GGGCAGGGCACTGTTGGGATTGG - Intergenic
989444076 5:41508427-41508449 GGTCAGATCCCTGAACTGATAGG + Intronic
990181152 5:53162304-53162326 GGGTAGGGCCCTGATCTGATGGG - Intergenic
990428571 5:55712451-55712473 GGGCTGGGCCCTGCGGTGATGGG - Exonic
991337896 5:65570800-65570822 GGGTGGGGTCCTAATCTGATGGG - Intronic
993724842 5:91355458-91355480 GGGTAAGGCCCTAATCTGATAGG - Intergenic
995520158 5:112996004-112996026 GGGCAGGGCCCTAATCTGACAGG - Intronic
996548462 5:124705976-124705998 GGGCAGGGACCTGGTCTGTTTGG - Intronic
997391782 5:133523092-133523114 GGGCAGGGCTCAAATCTGATAGG + Intronic
997732103 5:136189171-136189193 GGGTGGAGCCCTGTTCTGATAGG - Intergenic
997762670 5:136464429-136464451 GGGCAAGCCCCAGATCTGAAAGG + Intergenic
997889114 5:137659378-137659400 GGCCAGGGCCATCATCTGCTGGG + Intronic
998524776 5:142832318-142832340 GGGTGAGGCCCTGATATGATAGG + Intronic
999330489 5:150670740-150670762 AGGCAGGAGCCTAATCTGATGGG - Intronic
1001588885 5:172852112-172852134 GGGCATTGCCATGATTTGATTGG + Intronic
1001683679 5:173576931-173576953 TGGCAGGGGCCAGATCTCATAGG + Intergenic
1001848814 5:174944905-174944927 GGGCCGGGTCCTAATTTGATGGG - Intergenic
1002085056 5:176769462-176769484 GGGCAGGGACCTGGTCTGCTGGG - Intergenic
1002696135 5:181092425-181092447 GAGCAGGGCCCTGAGATGATGGG - Intergenic
1003882231 6:10489255-10489277 GGGCATGGCCCTAATCCAATAGG - Intergenic
1004038609 6:11951126-11951148 GGGTGGGGCCCTAGTCTGATAGG - Intergenic
1004566557 6:16803536-16803558 GGGCAGAATCCTGCTCTGATTGG + Intergenic
1005194986 6:23271868-23271890 GGGTAGAGCCCTGATCTGATGGG - Intergenic
1005311841 6:24566270-24566292 GGGTAGGCCCCTGATCCAATAGG + Intronic
1005811242 6:29518036-29518058 AGGCAGGGCCCCACTCTGATGGG + Intergenic
1005972468 6:30772129-30772151 GGGTGAGGCCCTAATCTGATGGG - Intergenic
1006016485 6:31085509-31085531 GGGCAGGGTCCTCATGTGCTTGG - Intergenic
1006119085 6:31793081-31793103 GGGCAGGGCCCTGAGCCCCTTGG - Exonic
1006578662 6:35064052-35064074 GGGCAGGGCCCTGACCAGGCGGG + Intronic
1007971301 6:46054676-46054698 GGGCGGGGGCCTGATCCAATAGG + Intronic
1008619108 6:53254375-53254397 GGGCAGGGGCCAGATCTTGTGGG + Intergenic
1011349359 6:86405512-86405534 GGGTGTGTCCCTGATCTGATGGG + Intergenic
1013037842 6:106404029-106404051 GGGCAGAGCCCTCTTCTGATAGG - Intergenic
1013118644 6:107122234-107122256 GGGTGGGGCCTTAATCTGATAGG + Intergenic
1013317159 6:108954103-108954125 GGGTAGGGTCCTAATATGATAGG - Intronic
1013487084 6:110607389-110607411 GGGTAGGGCCCTGAACTGACAGG - Intergenic
1013607666 6:111765319-111765341 AGGTAGGGCCCTGATCCAATAGG + Intronic
1014253308 6:119137384-119137406 GGGTGGGGTCCTAATCTGATAGG - Intronic
1014298700 6:119652837-119652859 TGGTGGGGCCTTGATCTGATAGG + Intergenic
1014635526 6:123842420-123842442 GGATAGGGCTCTAATCTGATAGG - Intronic
1014641320 6:123914441-123914463 TGGTGGGTCCCTGATCTGATAGG - Intronic
1014976003 6:127884972-127884994 AGGTGAGGCCCTGATCTGATAGG - Intronic
1015222014 6:130814670-130814692 GAGCGGGGCCCTAATCTGATAGG + Intergenic
1016701015 6:147054242-147054264 GGGTAGGGCCCTGATGTAATAGG + Intergenic
1016736355 6:147484545-147484567 TGGTAGGGCCCTGATCCAATAGG - Intergenic
1017382203 6:153844118-153844140 GGTCATGGCCCTGATCTTCTAGG - Intergenic
1018926747 6:168212231-168212253 GGGCAGGGCTCAGCTCTGAGGGG + Intergenic
1018957939 6:168424017-168424039 GGGTGGGGCCCTGATCTGATAGG - Intergenic
1019477551 7:1251325-1251347 GGGGTGGGCTCTGATCTAATAGG + Intergenic
1019586157 7:1804990-1805012 GCGTGGGGCCCTGATCTGATAGG + Intergenic
1019861207 7:3659663-3659685 GGAGAAGGCCATGATCTGATTGG + Intronic
1019967880 7:4514904-4514926 GGGCGGAGCTCTGTTCTGATAGG - Intergenic
1021924583 7:25521989-25522011 AAGCAGGGCCCTGATCTTATAGG - Intergenic
1022649062 7:32258462-32258484 GTGCAGGGCCCAGCTCTCATGGG - Intronic
1022802840 7:33792417-33792439 GGGCAGGCCCCTGAGAGGATAGG + Intergenic
1023456649 7:40346747-40346769 GGGTGGAGCCCTAATCTGATAGG + Intronic
1023725688 7:43140957-43140979 GGGCAGGGCTCTGATCCAATAGG - Intronic
1023830755 7:44037845-44037867 GGGCGGGCCCCTCATCTGGTGGG + Intergenic
1023839427 7:44088085-44088107 GGGCAGGGCCCTGGCCTGGGTGG + Intergenic
1024214402 7:47235087-47235109 GGGTGGGGCCCTGATCTGATAGG - Intergenic
1024478436 7:49839008-49839030 TGGTAGGGCCCTTCTCTGATAGG + Intronic
1024506538 7:50167051-50167073 AGGCAGGGCCCTGAAATGACAGG + Intergenic
1025818919 7:64945496-64945518 GGGCAGGGCCTGGGTATGATTGG - Intergenic
1025992028 7:66503914-66503936 GGCCATGGCCATGGTCTGATGGG - Intergenic
1026493298 7:70881643-70881665 AGGCAGGGCAGTGATCTGAACGG + Intergenic
1027615150 7:80413727-80413749 GGGTCGGGCCCTAATCTGATAGG + Intronic
1028422043 7:90644030-90644052 GAGTAGGGCCCTGATCTAATTGG + Intronic
1028579153 7:92387184-92387206 GGGTGGGGCCCTATTCTGATAGG - Intronic
1028747176 7:94340350-94340372 GGGTAGGGCCCTGATCCAATAGG - Intergenic
1029199447 7:98828867-98828889 GTGTGGGGTCCTGATCTGATAGG + Intergenic
1029741091 7:102492161-102492183 GGGCGGGCCCCTCATCTGGTGGG + Intronic
1029759083 7:102591331-102591353 GGGCGGGCCCCTCATCTGGTGGG + Intronic
1030240582 7:107318743-107318765 AGGGTGGGCCCTGATCTTATAGG - Intronic
1030364951 7:108635187-108635209 GTGTGGGGCCCTAATCTGATAGG + Intergenic
1030658483 7:112193996-112194018 GGGTGGGGCCCTGATCTGACAGG - Intronic
1030936610 7:115592864-115592886 GGGTGGGGCCCTAATCTGATAGG - Intergenic
1031449681 7:121899666-121899688 GGGAAAGGACCAGATCTGATTGG + Intronic
1031628462 7:124018000-124018022 GAGCAGGGTTCTGATCTGATAGG + Intergenic
1031857846 7:126943356-126943378 TGGCAGAGCCCTGATCTTGTGGG + Intronic
1032009528 7:128334834-128334856 AGGTTGGGCCCTAATCTGATAGG + Intronic
1032532072 7:132630178-132630200 GGGCATGGTCCTAATCTGATAGG - Intronic
1034031772 7:147774574-147774596 GGGTAGGGACCTGATCTGCTAGG + Intronic
1034634200 7:152554287-152554309 AGGCAGGGTCCTGATCATATAGG + Intergenic
1035881270 8:3246193-3246215 AGGCAGGGCCCTGATCCCACGGG - Intronic
1036410700 8:8497610-8497632 GGGCAGGGTCTTCATCAGATTGG + Intergenic
1036956424 8:13192723-13192745 GGGCAGGATCCTGATCCAATAGG + Intronic
1036971066 8:13355562-13355584 AGGTGGGGTCCTGATCTGATAGG - Intronic
1037157618 8:15724050-15724072 GAGAAGGTCCCTAATCTGATTGG + Intronic
1037237053 8:16732458-16732480 GGGTGGGGCCCTAATCTAATAGG - Intergenic
1037620391 8:20558423-20558445 AGGGTGAGCCCTGATCTGATGGG + Intergenic
1037781694 8:21873788-21873810 GGGTGGGGCCCTAATCTGATAGG - Intergenic
1038149528 8:24930091-24930113 GGGTAGGACCCTGATCTGATTGG - Intergenic
1038265587 8:26037550-26037572 AGACAGGGCCCTAATCAGATGGG - Intronic
1038485606 8:27932961-27932983 AGGGAGGGCCCTGATCCCATAGG - Intronic
1038500533 8:28039926-28039948 GGGTGGGGCCCTGATCTGACAGG + Intronic
1041369973 8:57149262-57149284 GGGCAGGGCCTTGGCCTGAAGGG - Intergenic
1041477912 8:58286039-58286061 GGGAGGGGCCCTAATCTGATAGG - Intergenic
1042176075 8:66037938-66037960 GTGCAAGGCCATGATCTGCTTGG + Intronic
1042230806 8:66552554-66552576 GCGTGGGGCCCTGATCCGATAGG + Intergenic
1043588379 8:81796098-81796120 GGGAGGGTCCCTGATCTGATAGG + Intergenic
1043984607 8:86679463-86679485 GGATAAGGCCCTAATCTGATAGG + Intronic
1044547601 8:93476971-93476993 GGGTGGTGCCCTAATCTGATGGG + Intergenic
1044586833 8:93876194-93876216 GGGTGGGGCCCAGATCTGATGGG - Intronic
1044613478 8:94116833-94116855 GGGTGGGGCCCTAATCTGAGAGG - Intergenic
1045017406 8:98011199-98011221 GGGCAGGATCCTGACCTGATAGG - Intronic
1046510840 8:115200430-115200452 GTGTGGGGCCCTAATCTGATAGG - Intergenic
1046631416 8:116626204-116626226 GGGTGGGGCCCTAACCTGATAGG + Intergenic
1046724169 8:117656284-117656306 GGGTAGGGCTCTAATCTGAGAGG - Intergenic
1047419460 8:124694563-124694585 GGGCTGGGCTCTGTTCTGAGTGG + Intronic
1048140632 8:131790890-131790912 GGGTAGGCCCCTAATCTGATAGG - Intergenic
1049156668 8:141071428-141071450 GGGTAGGGCCCTGCTCTGATAGG - Intergenic
1049187724 8:141267046-141267068 GGGCAGGTCCCTGAACTGCGGGG + Intronic
1049345430 8:142136156-142136178 GGGCGGGGCCCTCCTCAGATGGG - Intergenic
1049551425 8:143261699-143261721 GGGCAGGGCTCTGGCCTGACGGG + Intronic
1050032865 9:1404791-1404813 GGGGTGGGCTCTAATCTGATTGG - Intergenic
1050617448 9:7416982-7417004 GGGTAGGGCCCTAATCTAATGGG - Intergenic
1051676152 9:19560404-19560426 GGGTGGGGCCCTGATCCAATAGG + Intronic
1052536611 9:29755776-29755798 CGGCAAAGCCCTGATCTGAGAGG - Intergenic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1053869944 9:42480441-42480463 GGTTGGGGCCCTAATCTGATAGG + Intergenic
1054710035 9:68502122-68502144 GGGGAGGGCCCTGATGAGATGGG + Intronic
1056666415 9:88584299-88584321 GGGTGGGGCCTTAATCTGATAGG + Intergenic
1056986892 9:91371712-91371734 GGGTGGGGCCCTCATCTGACAGG - Intergenic
1057300527 9:93878075-93878097 AGGTAGGGTCCTAATCTGATAGG + Intergenic
1057722092 9:97540413-97540435 GGGTGGAACCCTGATCTGATAGG - Intronic
1058611124 9:106776808-106776830 GGGTGGGGCCCTAATATGATGGG - Intergenic
1059358467 9:113719675-113719697 GGGTAGAGTCCTGATCTGATGGG + Intergenic
1059496983 9:114718081-114718103 GGGCAGAGCCCTGATCCAAAAGG + Intergenic
1060755067 9:126206587-126206609 GGGTGGGGCCCTGATCTGAAAGG + Intergenic
1061130729 9:128706387-128706409 GACCACAGCCCTGATCTGATGGG + Intronic
1061653125 9:132067218-132067240 GGGCATGGCGCTGATCTCACAGG - Intronic
1061882902 9:133576933-133576955 GGGCAGAGCCCTGGCCTGACTGG + Intergenic
1062328342 9:136023423-136023445 GGGCAGGGGCCAGGTTTGATGGG - Intronic
1062533158 9:137010509-137010531 GGGCAGGGCCCTGAGCTCTGGGG - Intronic
1062636112 9:137492652-137492674 GGGCAGGGCCATGGTCTGGGTGG + Intronic
1203562288 Un_KI270744v1:68855-68877 GGGTAAGGCCCTAATCTGTTAGG + Intergenic
1186253290 X:7692252-7692274 AGGCTGGGCCCTGATCTAATAGG + Intergenic
1186342798 X:8661436-8661458 AGGGAGGGCCCTGATCCTATAGG - Intronic
1186481708 X:9901201-9901223 GGGGAGGGCTCTGATCCAATAGG - Intronic
1186606437 X:11097799-11097821 GAGTGGGGCCCTAATCTGATAGG - Intergenic
1187124124 X:16437633-16437655 GGGTGGGGCCGTGATCTGATAGG - Intergenic
1187521874 X:20021187-20021209 GGGCTGGGCCCTGTTGTGTTTGG + Intronic
1188019566 X:25142689-25142711 GGGTGGGACCCTGATCTGATAGG - Intergenic
1189625737 X:42895084-42895106 GGGTGGAGCCCTGATCTAATAGG - Intergenic
1190434191 X:50407556-50407578 GGGTGGGGACCTAATCTGATAGG - Intronic
1192491496 X:71579843-71579865 GGGTAGGGTCCAGACCTGATAGG + Intronic
1192628622 X:72756783-72756805 GGGTAGGGCCCTAATTTAATGGG + Intergenic
1192653086 X:72964031-72964053 GGGTAGGGCCCTAATTTAATGGG - Intergenic
1194787038 X:98098872-98098894 GGGTGGGGACCTGATCTGATAGG + Intergenic
1195508872 X:105691022-105691044 GGGTGGGGCCCTGATCTGATAGG - Intronic
1196881097 X:120198843-120198865 GGGTAGGGTCCTAATCCGATAGG + Intergenic
1197197430 X:123717023-123717045 GGGCAGGTACCTGATCTTAGAGG - Intronic
1197265304 X:124362849-124362871 GGGTGGGGCTCTAATCTGATAGG + Intronic
1197512488 X:127387661-127387683 AAGCAGAGCCCTGATCTTATAGG + Intergenic
1198135056 X:133741014-133741036 GTGTGGGGCCCTGATCTAATAGG + Intronic
1198206061 X:134466087-134466109 GGGTTGGGCCCAGGTCTGATTGG + Intronic
1200083221 X:153589660-153589682 GCCCAAGGCCTTGATCTGATTGG - Intronic
1200096773 X:153668289-153668311 GGGCAGGCGCCTCTTCTGATAGG + Intergenic
1201148196 Y:11078077-11078099 GGGTGGGGTCCTGATCTCATAGG + Intergenic
1201160760 Y:11163875-11163897 GGGTAAGGCCCTAATCTGTTAGG - Intergenic
1201470085 Y:14323495-14323517 AGGCTGGGCCCTGATCTAATAGG + Intergenic