ID: 1128887444

View in Genome Browser
Species Human (GRCh38)
Location 15:71302023-71302045
Sequence AACCCTAAGCTTGCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128887444_1128887447 -10 Left 1128887444 15:71302023-71302045 CCTGTGGGAGCAAGCTTAGGGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1128887447 15:71302036-71302058 GCTTAGGGTTGGTTTATTTTGGG 0: 1
1: 0
2: 1
3: 12
4: 185
1128887444_1128887448 11 Left 1128887444 15:71302023-71302045 CCTGTGGGAGCAAGCTTAGGGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1128887448 15:71302057-71302079 GGATCTATTTCTAGAGACTGAGG 0: 1
1: 0
2: 3
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128887444 Original CRISPR AACCCTAAGCTTGCTCCCAC AGG (reversed) Intronic
900665733 1:3814342-3814364 AACCCCCAGCTCACTCCCACAGG + Exonic
905233729 1:36530984-36531006 AACCCAAAGCTTCCTCCTAATGG - Intergenic
905619711 1:39433416-39433438 AACTCAAAGCTTGCTCCCTGTGG - Intronic
911320520 1:96408602-96408624 ATCCCTAAGCTGGCTTGCACTGG + Intergenic
915468396 1:156111646-156111668 AATACTATGCTTGCTCCCAAGGG - Intronic
917032907 1:170714607-170714629 ATCTCTAAGGTTCCTCCCACAGG + Intronic
921404659 1:214765406-214765428 AAGGCTCAGCTTGCTCCCATAGG - Intergenic
923555185 1:234994717-234994739 AACCCTGAACCTTCTCCCACCGG + Intergenic
1070169814 10:73924523-73924545 CACCCTAAGCTTTCTCCCTTAGG + Intergenic
1084705035 11:70811109-70811131 AAGCCTCACCTTGCTCCCCCTGG - Intronic
1085154699 11:74282829-74282851 AACTCTAAGCTTTTTCTCACTGG - Intronic
1088933722 11:114377982-114378004 AACCCCAAGCTTGAGTCCACAGG + Intergenic
1090809984 11:130229616-130229638 AAAACTAAGCATACTCCCACAGG - Exonic
1091027806 11:132157771-132157793 AACCCTAAACCTGCTCCTCCTGG + Intronic
1093411563 12:18874579-18874601 AACACTAACCTTGCTCACAAGGG - Intergenic
1094271009 12:28614594-28614616 AAGCCTTAAATTGCTCCCACAGG + Intergenic
1095142142 12:38677262-38677284 ATCCCTTAGCTTGATCCCCCTGG + Intronic
1105245967 13:18650550-18650572 CACACAAAGCTTGCTCCCGCCGG - Intergenic
1108828569 13:54448540-54448562 AACCCTAAATATTCTCCCACTGG + Intergenic
1111043116 13:82777783-82777805 CACCCCAAGTTTGCTCCCTCAGG + Intergenic
1111857723 13:93660940-93660962 AACCCAACCCTTGCTCCCATAGG - Intronic
1113017200 13:105840906-105840928 TACCCTAAGCTTCCACCTACAGG - Intergenic
1116965899 14:51014963-51014985 AAGCCTAAACCAGCTCCCACAGG + Intronic
1119053027 14:71389251-71389273 ACCCCTAAGCTTTGACCCACTGG - Intronic
1121740958 14:96252137-96252159 AGCCCCATGCTTGCTCCCCCAGG - Intronic
1127719125 15:61682547-61682569 AACCCTCAGCTTGGAACCACAGG - Intergenic
1128887444 15:71302023-71302045 AACCCTAAGCTTGCTCCCACAGG - Intronic
1133479537 16:6156612-6156634 AACCCTCAGCATTGTCCCACAGG - Intronic
1134081092 16:11325503-11325525 AACCGTAGGCTTGCTCTCCCTGG - Intronic
1134895579 16:17883867-17883889 AACCTTAAGCTGTATCCCACAGG - Intergenic
1138398812 16:56729543-56729565 AACACTAAGCTGGCTTCCCCTGG + Intronic
1140839364 16:78824903-78824925 AACCCAAAAATTGCTCCCAAAGG - Intronic
1143358907 17:6351648-6351670 CACCCTTAGCTTGCTGCCATGGG + Intergenic
1144445387 17:15322621-15322643 AACCCAGACCCTGCTCCCACAGG + Intronic
1146782362 17:35686210-35686232 AAAGTTAAGCTTGCTCCTACTGG + Intronic
1152747563 17:82048455-82048477 AGCCCCAAGGTTGATCCCACGGG - Exonic
1153281123 18:3415278-3415300 AACCCTCAGCTTTCTGCCTCTGG - Intronic
1153701627 18:7700344-7700366 TACCCAAATCTTGCTCACACTGG - Intronic
1154442952 18:14409114-14409136 CACACAAAGCTTGCTCCCGCCGG + Intergenic
1155652970 18:28162665-28162687 TAGACTAATCTTGCTCCCACTGG + Intronic
1157939713 18:51914365-51914387 TACCCTAATCCTGCTCCCAGAGG - Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
925007155 2:452460-452482 AGCCATAAGCTTGCTACCAGAGG - Intergenic
925293922 2:2765624-2765646 AACAATGAGCTTGCTCCCATGGG + Intergenic
936181993 2:110275078-110275100 ACCCCCAACCCTGCTCCCACTGG - Intergenic
936230576 2:110696595-110696617 ACCCCCAACCCTGCTCCCACTGG + Intergenic
941843658 2:170112972-170112994 ATCCCTCAGCCTGCTACCACCGG + Intergenic
945553527 2:211251015-211251037 AACCCTGTGCTTGCTACCCCTGG - Intergenic
945784237 2:214213487-214213509 AAACCTATGCTTGCTCCCTTGGG - Intronic
1171084590 20:22225762-22225784 CAGCCCAAGCTTTCTCCCACTGG + Intergenic
1173869020 20:46330334-46330356 AACCCTGGGCTGGCGCCCACGGG - Intergenic
1173924714 20:46772001-46772023 CACCCTGAGCTTCCACCCACTGG - Intergenic
1176216805 20:63951880-63951902 AGCCCTAAGCTCTCTCCCAGGGG + Intronic
1176453133 21:6882090-6882112 CACACAAAGCTTGCTCCCGCCGG - Intergenic
1176831306 21:13747138-13747160 CACACAAAGCTTGCTCCCGCCGG - Intergenic
1178297673 21:31424311-31424333 AATCTTAAGCTTCCTCACACTGG - Intronic
1182126647 22:27820946-27820968 AACCCAATGCCTGGTCCCACAGG + Intergenic
951231801 3:20187663-20187685 AACCCTCAGTTTACTGCCACTGG + Intergenic
951491844 3:23279618-23279640 GACCCTAAGCTGGTTCCAACTGG - Intronic
962160377 3:132992907-132992929 ACCCCAAACCTTGCTGCCACAGG - Intergenic
966585412 3:181618536-181618558 AACCCCAAGCTTTGTTCCACAGG + Intergenic
986304465 5:6505122-6505144 AACCCCAAGCTGGCTCCTTCAGG + Intergenic
986892028 5:12320651-12320673 TAGCCTCAACTTGCTCCCACAGG - Intergenic
990416614 5:55593207-55593229 AAGCCTAAGCCATCTCCCACTGG + Intergenic
994168972 5:96638563-96638585 AACCCTAACCTTGCATGCACTGG - Intronic
1001370926 5:171200314-171200336 AATCCTAATATGGCTCCCACAGG - Intronic
1008888177 6:56454250-56454272 AACACTATGCTTGCACACACAGG - Intergenic
1015175716 6:130305956-130305978 AACCAAAAGCTGGCTCTCACTGG - Intronic
1022769806 7:33457089-33457111 AACCCTAATCTCTCTCCCAAAGG - Intronic
1031036792 7:116796299-116796321 AACCAGAGGCTTGGTCCCACAGG + Exonic
1037148256 8:15601112-15601134 AACCTTAAGCTTGCTACCTATGG - Intronic
1042671396 8:71267257-71267279 ATCACTAAGCTTGGTCTCACTGG + Intronic
1049646728 8:143738946-143738968 AACCCTGCCCTAGCTCCCACCGG - Intergenic
1053530750 9:38878850-38878872 AAGGCTCAGCTTGCTCCCATAGG + Intergenic
1055552529 9:77444810-77444832 AACCCTAAGCTACCTCCCCCTGG - Intronic
1057158860 9:92870585-92870607 AGCCCTGAGGTGGCTCCCACTGG - Intronic
1059285450 9:113168316-113168338 AGCCCCAAGCCTGCTCCCACAGG + Intronic
1059775490 9:117470581-117470603 ATTCCTAACCTTGCTCACACTGG + Intergenic
1061368490 9:130185055-130185077 AGCCCTCTGCTTCCTCCCACTGG + Intronic
1061403483 9:130381304-130381326 AACCCTAACCAGGCCCCCACTGG + Intronic
1062358388 9:136175889-136175911 AACCCTGAGCTTCCTCAGACAGG - Intergenic
1203516048 Un_GL000213v1:2425-2447 CACACAAAGCTTGCTCCCGCCGG + Intergenic
1192262650 X:69516183-69516205 AACCCTAGGTTTGCTCATACTGG - Intronic
1194198079 X:90920662-90920684 AACCCTGAACTTCCTGCCACTGG + Intergenic
1194346661 X:92773638-92773660 AACCCTATGCATGCACACACTGG - Intergenic
1200543662 Y:4492169-4492191 AACCCTGAACTTCCTGCCACTGG - Intergenic
1200654995 Y:5890282-5890304 AACCCTATGCATGCACACACTGG - Intergenic