ID: 1128888276

View in Genome Browser
Species Human (GRCh38)
Location 15:71308103-71308125
Sequence CAGGCATTCACCCTGAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 199}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128888267_1128888276 9 Left 1128888267 15:71308071-71308093 CCAACCCAACCTCCTCTACCCTC 0: 1
1: 0
2: 4
3: 62
4: 692
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199
1128888270_1128888276 0 Left 1128888270 15:71308080-71308102 CCTCCTCTACCCTCCAGCAAAAA 0: 1
1: 0
2: 3
3: 28
4: 415
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199
1128888273_1128888276 -9 Left 1128888273 15:71308089-71308111 CCCTCCAGCAAAAACAGGCATTC 0: 1
1: 0
2: 1
3: 24
4: 218
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199
1128888271_1128888276 -3 Left 1128888271 15:71308083-71308105 CCTCTACCCTCCAGCAAAAACAG 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199
1128888268_1128888276 5 Left 1128888268 15:71308075-71308097 CCCAACCTCCTCTACCCTCCAGC 0: 1
1: 0
2: 3
3: 46
4: 478
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199
1128888269_1128888276 4 Left 1128888269 15:71308076-71308098 CCAACCTCCTCTACCCTCCAGCA 0: 1
1: 0
2: 4
3: 58
4: 597
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199
1128888266_1128888276 10 Left 1128888266 15:71308070-71308092 CCCAACCCAACCTCCTCTACCCT 0: 1
1: 0
2: 4
3: 39
4: 476
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199
1128888274_1128888276 -10 Left 1128888274 15:71308090-71308112 CCTCCAGCAAAAACAGGCATTCA 0: 1
1: 0
2: 3
3: 22
4: 233
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199
1128888265_1128888276 22 Left 1128888265 15:71308058-71308080 CCTCTAGTTTCTCCCAACCCAAC 0: 1
1: 0
2: 2
3: 19
4: 265
Right 1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128888276 Original CRISPR CAGGCATTCACCCTGAATAC TGG Intronic
901246136 1:7732702-7732724 CAGGCCTTCTGCCTGAATACAGG - Intronic
907057942 1:51389383-51389405 CAAGCATTCCCCTTGAAAACTGG + Intronic
907289682 1:53405611-53405633 CAGCCATTCACGGTGATTACGGG + Intergenic
909382457 1:75014753-75014775 AAGGCATTCCCCTTGAAAACTGG - Intergenic
909750887 1:79159194-79159216 GAAGCATTCCCCCTGAAAACTGG - Intergenic
909801406 1:79813396-79813418 TGGGCATTCACACTGATTACAGG - Intergenic
910736345 1:90462081-90462103 GAAGCATTCTCCCTGAAAACTGG + Intergenic
911157972 1:94655215-94655237 CTGGCAACCACACTGAATACAGG - Intergenic
911675230 1:100651190-100651212 GAGGCATTCCCCTTGAAAACTGG + Intergenic
911794851 1:102062617-102062639 GATGCATTCACCTTGAAAACCGG + Intergenic
916377364 1:164170004-164170026 GAGGCATTCCCTCTGAAAACTGG + Intergenic
917066348 1:171098867-171098889 GAGGCATTCCCTCTGAAAACTGG - Intronic
917641358 1:176985943-176985965 CAGGGTTTCAGCCTGAATGCTGG - Intronic
917682405 1:177380972-177380994 CAGGCATTCTCCTTGAAAATTGG - Intergenic
921104638 1:211963907-211963929 GAAGCATTCCCCCTGAAAACCGG + Intronic
923157554 1:231291893-231291915 CAGGCATTCAGCCAGACTCCTGG + Intergenic
1063771715 10:9211078-9211100 CAGGCCTTGAGCCTGCATACTGG + Intergenic
1065490990 10:26281229-26281251 CAGACCTTCACCCTGCAGACAGG - Intronic
1066170679 10:32841063-32841085 AAAGCATTCCCCCTGAAAACTGG + Intronic
1068145246 10:53061251-53061273 TAAGCATTCACCCTGAGAACAGG - Intergenic
1068247350 10:54390141-54390163 AATGCATTCACCCTGAATTCAGG - Intronic
1068682771 10:59838156-59838178 GAGGCATTGACCCAGAATACTGG - Intronic
1071028268 10:81141123-81141145 GAAGCATTCACCCTGAAAAATGG + Intergenic
1078051190 11:7966045-7966067 CAGGCATGCACCATGATTCCCGG - Intergenic
1079344842 11:19642860-19642882 CAGGCAGCCACTGTGAATACAGG - Intronic
1082690967 11:56304150-56304172 GAAGCATTCACCCTGAGAACTGG - Intergenic
1084331373 11:68432519-68432541 CAGGCCTTCCCCATGACTACTGG - Intronic
1085915267 11:80879782-80879804 GAAGCATTCCCCCTGAAAACCGG + Intergenic
1087337217 11:96859765-96859787 AAAGCATTGACCCTGAAAACTGG - Intergenic
1087631199 11:100652551-100652573 AAGGCATTCCCCCTGATAACGGG + Intergenic
1087719498 11:101646102-101646124 GAAGCATTCACCTTGAAAACCGG + Intronic
1089182983 11:116595670-116595692 CAGGCTGACACCCTGTATACGGG + Intergenic
1091788208 12:3255919-3255941 CAAGCATACATCCTGATTACTGG - Intronic
1091926775 12:4357762-4357784 CAGGCCTTGAACCTGAATCCAGG - Intergenic
1093655483 12:21689156-21689178 CAGGCATGAACCATGAAGACTGG + Intronic
1093846155 12:23973619-23973641 CAGGCATCCACCATGAGTATTGG - Intergenic
1093877882 12:24371551-24371573 TAGTCTTTCACCCTGAAAACAGG + Intergenic
1094701757 12:32877201-32877223 CAGGCATTAAACTTGAATAAGGG + Intronic
1095087486 12:38073531-38073553 CAAGCATTCCCCTTGAAAACTGG + Intergenic
1095453356 12:42355201-42355223 CAAGCAGGCAACCTGAATACAGG + Exonic
1097761144 12:63465804-63465826 GATGCATTCACCATGAAAACTGG - Intergenic
1099343400 12:81467826-81467848 CAGGCTTTAACCCTGGATTCTGG - Intronic
1099480043 12:83154487-83154509 GAAGCATTCCCCCTGAAAACAGG - Intergenic
1100610691 12:96189985-96190007 CATGCATTCAGCCTGCAGACTGG + Intergenic
1104824600 12:131699995-131700017 CAAGCTTTCACTCTGAACACCGG + Intergenic
1105396293 13:20039348-20039370 CATGCATTCCCCTTGAAAACTGG - Intronic
1106166814 13:27254664-27254686 CAGGCATGCACCATGATTCCTGG + Intronic
1106371212 13:29135224-29135246 CAGGCATTCACTGGGAATATAGG + Intronic
1108134708 13:47343132-47343154 AAAGCATTCCCCCTGAGTACTGG + Intergenic
1110812305 13:79824259-79824281 CAAGCATTCCCCTTGAAAACTGG - Intergenic
1112578890 13:100661510-100661532 CAGCCATTGATCCTGAATAAGGG - Intronic
1113036686 13:106057490-106057512 CAGGCATTCACCATGATGCCTGG - Intergenic
1113169865 13:107488688-107488710 CAAGCATTCCCCTTGAAAACTGG + Intronic
1113534588 13:111055152-111055174 AAGGCATTCCCCCTGAGAACTGG - Intergenic
1115937797 14:38574325-38574347 AAGGCATTCCCCCTGAGAACTGG - Intergenic
1115947721 14:38681602-38681624 AAAGCATTCTCCCTGAAAACTGG - Intergenic
1116976969 14:51127291-51127313 AAAGCATTCCCCCTGAAAACTGG - Intergenic
1117820976 14:59648851-59648873 GAAGCATTCCCCCTGAAAACTGG + Intronic
1118223628 14:63878473-63878495 CAGGCATTCTCCCTAGATTCTGG + Intronic
1120312729 14:82851368-82851390 CAGACATGCACCGTGAAGACTGG + Intergenic
1120785321 14:88529053-88529075 AAAGCATTCCCCCTGAAAACTGG - Intronic
1121043201 14:90767308-90767330 CAGGCAGTAACCTTGAAGACAGG + Intronic
1123984019 15:25628708-25628730 GAGGCATTCCCCTTGAAAACTGG - Intergenic
1125066639 15:35494901-35494923 CAGGCTTTCACCCTAAAATCAGG + Intronic
1125272696 15:37957155-37957177 GAGGCATTCCCTTTGAATACCGG + Intronic
1128888276 15:71308103-71308125 CAGGCATTCACCCTGAATACTGG + Intronic
1131162941 15:90120311-90120333 CAGGCATGCACCATGACTCCTGG - Intergenic
1134183734 16:12067040-12067062 CAGGCATGCACCCTCATGACTGG - Intronic
1138103963 16:54277124-54277146 AAGCCATTCACCCTAAAGACAGG + Intergenic
1139274498 16:65714829-65714851 CATGCAATCACCCTGAGTAGTGG + Intergenic
1144209439 17:13002312-13002334 GAGGCATTCACCCTGAACCATGG + Exonic
1145725211 17:27114519-27114541 AATGCATTCACCCTGAATTCAGG + Intergenic
1146659367 17:34654106-34654128 CAGGCCCTCACCCTGAAGACAGG - Intergenic
1148469634 17:47885118-47885140 CAGGCAAGCACCCTGAGAACAGG + Intergenic
1148733140 17:49850107-49850129 CCTGCACTCACCCTGAATCCAGG + Intergenic
1149090047 17:52767170-52767192 AAGGCATTCCCCCTGAGAACAGG + Intergenic
1153175989 18:2373844-2373866 AAAGCATTCCCCCTGAAAACTGG - Intergenic
1153807051 18:8717777-8717799 CAGGAATGCACCCTGAATACAGG - Intronic
1155641216 18:28017829-28017851 AAAGCATTCCCCCTGAACACTGG + Intronic
1158728691 18:59999475-59999497 AAAGCATTCACTCTGAAAACTGG - Intergenic
1161230199 19:3171184-3171206 TAGAAATTCACCCTGAAGACAGG - Intergenic
1162314471 19:9929677-9929699 CAGGCACTAACACTGAATCCTGG + Intronic
1163389047 19:17018764-17018786 CAGGCATGCACCATCAAGACTGG - Intronic
928850381 2:35738317-35738339 GAAGCATTCCCCCTGAAAACTGG + Intergenic
928958191 2:36893745-36893767 CACACATTCACCCTGGATAAAGG + Intronic
930457250 2:51620797-51620819 TAGGAATTCACTCTGAATTCAGG - Intergenic
931537593 2:63296359-63296381 CAAGCATTCCCCCTTAAAACAGG + Intronic
935475142 2:103510485-103510507 GAAGCATTCCCCCTGAAAACTGG - Intergenic
936965903 2:118127483-118127505 CAGGCATGCGCCATGAATCCTGG + Intergenic
938693683 2:133815715-133815737 CTTGCATGCACCCTGAAGACAGG + Intergenic
939022530 2:136976245-136976267 AAAGCATTCACCTTGAAAACTGG - Intronic
941100543 2:161290247-161290269 CAAGCATTCCCTCTGAAAACTGG + Intergenic
943158284 2:184213326-184213348 AAAGCATTCCCCCTGAAAACAGG - Intergenic
945521152 2:210829047-210829069 AAAGCATTCCCCCTGAGTACTGG - Intergenic
945847531 2:214964292-214964314 GAAGCATTCCCCCTGAAAACTGG + Intronic
947864418 2:233386407-233386429 CAGTCCTTCACACTGAAGACTGG + Intronic
948898366 2:240940761-240940783 AAAGCATTCACCCTGAGAACTGG + Intronic
1169582397 20:7038293-7038315 CAGACTTTCACATTGAATACAGG + Intergenic
1172593001 20:36130717-36130739 CTGCCATTCACCCTGGATGCTGG - Intronic
1174004235 20:47397608-47397630 CAGGCATGCACCTGGGATACAGG - Intergenic
1175506042 20:59485057-59485079 CAGGCATTCGCCCTGCACTCGGG + Intergenic
1175506256 20:59486727-59486749 CAGGCATTCGCCCTGCACTCGGG + Intergenic
1176885555 21:14250928-14250950 CAGGCATGCACCATGAAGACTGG + Intergenic
1178383610 21:32132050-32132072 CAACAATTCACCTTGAATACAGG - Intergenic
1180040202 21:45273879-45273901 AAAGCATTCACCCTGAGAACTGG + Intronic
1180900310 22:19366902-19366924 CAGGCATGCACCGTGACAACCGG + Intronic
1182227442 22:28809947-28809969 CAGGCATGCACCATGACTCCCGG - Intergenic
1183089108 22:35509266-35509288 CAGGCATTCATGTTGATTACAGG - Intergenic
951470255 3:23048492-23048514 GAAGCATTCCCCTTGAATACTGG + Intergenic
953675785 3:45001000-45001022 CAGTCCTTCACCCTAATTACAGG - Intronic
960679739 3:120235101-120235123 GAAGCATTCCCCCTGAAAACTGG - Intronic
962530122 3:136271937-136271959 AAAGCATTCCCCCTGAAAACTGG - Intronic
963831003 3:150009223-150009245 GAAGCATTCCCCCTGAAAACTGG + Intronic
963925755 3:150949272-150949294 GAAGCATTCTCCCTGAAAACTGG + Intronic
964049051 3:152369087-152369109 GAAGCATTCCCTCTGAATACTGG - Intronic
964779997 3:160326734-160326756 GAAGCATTCACCTTGAAAACAGG + Intronic
965343212 3:167515552-167515574 GAGGCATTCCCCTTGAAAACCGG + Intronic
966270073 3:178094343-178094365 GAAGCATTCCCCCTGAAAACTGG + Intergenic
967203618 3:187098930-187098952 AAAGCATTCCCCCTGAGTACTGG + Intergenic
970856570 4:20655826-20655848 AAGGCATTCTCCCTGAGAACTGG + Intergenic
971593967 4:28503907-28503929 CAGGCATTCACACTGTGTATGGG - Intergenic
973567921 4:52207061-52207083 CAAGCATTCCCCTTGAAAACTGG - Intergenic
974303664 4:60103454-60103476 AAGACATACACCCTGAAGACAGG - Intergenic
974979305 4:68934719-68934741 CAGGCATACACCATCAAGACTGG - Intronic
977072503 4:92409046-92409068 CAGGCATTCCCCTTGAGAACTGG - Intronic
977484261 4:97622191-97622213 GAAGCATTCCCCTTGAATACTGG + Intronic
977520012 4:98070431-98070453 GAGGCATTCCCCTTGAAAACTGG + Intronic
977606663 4:98991895-98991917 CAGGCATGCAGCCTGCATGCAGG - Intergenic
979195071 4:117911434-117911456 AAAGCATTCCCCCTGAAAACAGG - Intergenic
980034326 4:127866231-127866253 AAAGCATTCCCCCTGAAAACTGG + Intergenic
980595933 4:134953880-134953902 AAAGCATTCCCCCTGAAAACTGG - Intergenic
980926834 4:139145940-139145962 CAAGCATTCCCCCTGAGAACTGG + Intronic
982176312 4:152708589-152708611 CAGACATTCACCGAGAAAACTGG - Intronic
982528027 4:156504333-156504355 AAAGCATTCTCCCTGAAAACTGG + Intergenic
982852584 4:160338558-160338580 GAAGCATTCACTCTGAAAACGGG - Intergenic
985367799 4:189251451-189251473 GAAGCATTCCCCCTGAAAACTGG + Intergenic
987392020 5:17385532-17385554 CAGGTATTCATCCTGAATCGAGG - Intergenic
988294347 5:29335653-29335675 GAAGCATTCCCCCTGAAAACTGG + Intergenic
988608939 5:32707081-32707103 CAGTGATTTAACCTGAATACTGG - Intronic
988851714 5:35187256-35187278 CAGGCATGCACCATGAAGCCTGG - Intronic
989098277 5:37800963-37800985 GAGAGATTCACCCTGAATAAGGG - Intergenic
990453251 5:55957460-55957482 CAGGCTATCACCCTGACTAAAGG - Intronic
992403758 5:76436293-76436315 AAAGCATTCCCCCTGAGTACTGG - Intronic
994346420 5:98692809-98692831 GAAGCATTCTCCCTGAAAACTGG - Intergenic
994592979 5:101795158-101795180 CAAGCATTCCCCTTGAAAACTGG - Intergenic
995216838 5:109605066-109605088 CAGGCATGCACCCTGCACCCAGG - Intergenic
995587888 5:113667935-113667957 AAAGCATTCACCCTGAGAACTGG + Intergenic
998921624 5:147074371-147074393 CAGCCCTTCACCCTGTATTCAGG + Intronic
999055874 5:148575798-148575820 CAAGCATTCTCCTTGAAAACCGG + Intronic
999556413 5:152747457-152747479 GAGGCATTCTCCTTGAAAACTGG - Intergenic
1000319256 5:160120575-160120597 CAGGCATTCTCCCAGAAAAAAGG - Intergenic
1005235466 6:23757064-23757086 GAAGCATTCCCCCTGAAAACTGG - Intergenic
1005908644 6:30288561-30288583 CAGGCATTCCCCTTGAAAAGTGG - Intergenic
1005932549 6:30494335-30494357 CAGGGATTCACCAGGAAAACGGG - Intergenic
1006816771 6:36856502-36856524 CAGGCATTCACCTTGAATCATGG + Intronic
1007963290 6:45980924-45980946 CATGCATTGACCCTTATTACAGG + Intronic
1007975720 6:46099186-46099208 CAGGCACTCCCCCAGAATAGGGG + Intergenic
1009033154 6:58084745-58084767 GAAGCATTCCCCCTGAAAACCGG + Intergenic
1009056963 6:58347828-58347850 CAGGGATTTACCCTCAATACTGG - Intergenic
1009208763 6:60836516-60836538 GAAGCATTCCCCCTGAAAACTGG + Intergenic
1009234281 6:61103741-61103763 CAGGGATTTACCCTCAATACTGG + Intergenic
1009815281 6:68725352-68725374 CAGGCAATAACCCTGAAAATTGG + Intronic
1011320809 6:86091066-86091088 AAGGCATTCCCCCTGAGAACTGG - Intergenic
1013669616 6:112385698-112385720 GAGGCATTCCCCTTGAAAACTGG + Intergenic
1013812890 6:114064703-114064725 CAGGCATTAAGCCTACATACAGG + Intronic
1013896839 6:115099263-115099285 GACGCATTCCCCCTGAAAACTGG - Intergenic
1018183817 6:161247621-161247643 GAAGCATTCCCCCTGAAAACTGG + Intronic
1021976557 7:26016940-26016962 CAAGCATTCCCCTTGAAAACTGG - Intergenic
1028402275 7:90436828-90436850 AAAGCATTCCCCCTGAAAACTGG + Intronic
1028515654 7:91675424-91675446 CAGGCATTCACACTGAAAAATGG + Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031882935 7:127217453-127217475 CATGCTATCACCCTGAATTCAGG + Intronic
1032537559 7:132677626-132677648 CTGGGAATCACCCTGAATATGGG - Intronic
1033435250 7:141327968-141327990 CAGGCACAGACCCTGAGTACTGG + Intronic
1035585445 8:769420-769442 TAGCCATTAACCCCGAATACAGG + Intergenic
1038704346 8:29880020-29880042 AAAGCATTCACCCTGAAGCCAGG + Intergenic
1040781617 8:51116320-51116342 CAGCCATTCAGCCAGAATTCAGG + Intergenic
1041643346 8:60226342-60226364 CAGGAGTTCACCATAAATACAGG - Intronic
1042733978 8:71967257-71967279 AAGGCATTAACTCTGCATACAGG - Intronic
1043001360 8:74764030-74764052 CAAGCATTCCCCTTGAAAACAGG + Intronic
1043214034 8:77562777-77562799 GAAGCATTCCCCCTGAAAACTGG - Intergenic
1044447197 8:92292892-92292914 CAAGCATTCCCCTTGAAAACAGG - Intergenic
1045957155 8:107922015-107922037 GAAGCATTCCCCCTGAAAACTGG + Intronic
1046429137 8:114100018-114100040 CAGGCAAGCACCCTGTTTACTGG + Intergenic
1046784027 8:118246724-118246746 GAGGCATTGACCCTCAATTCTGG + Intronic
1046945321 8:119968949-119968971 CAGGCATCCACCATGACTCCCGG - Intronic
1047531764 8:125683241-125683263 CATGCATACACACTGAAGACAGG - Intergenic
1051115882 9:13693888-13693910 GAGGCATTCCCCTTGAAAACCGG - Intergenic
1055919844 9:81448379-81448401 GAAGCATTCACCCTGAGAACTGG - Intergenic
1057285089 9:93746274-93746296 AAAGCATTCCCCCTGAAAACTGG - Intergenic
1058676632 9:107405709-107405731 CAGGCATTCATCCTCATTCCAGG - Intergenic
1060414877 9:123423208-123423230 CAGCCATTCACCCTGAAGGCAGG - Intronic
1060580513 9:124741959-124741981 CAGGCATTCACCAGGCAAACAGG + Intronic
1186040473 X:5472175-5472197 GAAGCATTCCCCCTGAAAACCGG + Intergenic
1188645048 X:32555355-32555377 GAAGCATTCCCCCTGAAAACTGG + Intronic
1191064485 X:56333133-56333155 GAAGCATTCTCCTTGAATACTGG - Intergenic
1191078504 X:56483577-56483599 GAAGCATTCACCTTGAAAACTGG - Intergenic
1191766222 X:64701271-64701293 GAGGCATTCTCCTTGAAAACTGG - Intergenic
1191812590 X:65205591-65205613 AAAGCATTCCCCCTGAAAACTGG + Intergenic
1191959316 X:66682539-66682561 GAGGCATTCCCCTTGAAAACTGG - Intergenic
1193517622 X:82488933-82488955 AAAGCATTCCCCCTGAAAACTGG + Intergenic
1193528418 X:82622674-82622696 GAGGCATTCCCCTTGAAAACTGG + Intergenic
1193789876 X:85804493-85804515 GAAGCATTCTCCCTGAAAACTGG - Intergenic
1193799303 X:85915367-85915389 GAAGCATTCCCCTTGAATACTGG + Intronic
1194168405 X:90551580-90551602 AAGGCATTCCCCCTGAGAACTGG + Intergenic
1194404087 X:93472615-93472637 GAGGCATTCTCCTTGAAAACTGG + Intergenic
1195024163 X:100859008-100859030 GAGGCATTCCCCTTGAAAACTGG - Intronic
1195489998 X:105456396-105456418 GAGGCATTCCCCTTGAAAACCGG - Intronic
1196385116 X:115140609-115140631 CTGGGACTCACCCTGAATTCTGG - Intronic
1197564279 X:128062456-128062478 CAAGCATTCCCCTTGAAAACTGG + Intergenic
1199707742 X:150445366-150445388 CAGACTTTCACTCTGAAGACAGG - Intronic
1200514649 Y:4129367-4129389 AAGGCATTCCCCCTGAGAACTGG + Intergenic