ID: 1128889143

View in Genome Browser
Species Human (GRCh38)
Location 15:71315342-71315364
Sequence GTGTCATAATAAAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128889143_1128889148 19 Left 1128889143 15:71315342-71315364 CCTTCACACTTTTATTATGACAC 0: 1
1: 0
2: 3
3: 20
4: 193
Right 1128889148 15:71315384-71315406 TTCACCTCTCTCTAGGCTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 246
1128889143_1128889147 18 Left 1128889143 15:71315342-71315364 CCTTCACACTTTTATTATGACAC 0: 1
1: 0
2: 3
3: 20
4: 193
Right 1128889147 15:71315383-71315405 GTTCACCTCTCTCTAGGCTGTGG 0: 1
1: 0
2: 0
3: 9
4: 169
1128889143_1128889151 28 Left 1128889143 15:71315342-71315364 CCTTCACACTTTTATTATGACAC 0: 1
1: 0
2: 3
3: 20
4: 193
Right 1128889151 15:71315393-71315415 CTCTAGGCTGTGGGAAACCAGGG 0: 1
1: 0
2: 0
3: 17
4: 258
1128889143_1128889144 -4 Left 1128889143 15:71315342-71315364 CCTTCACACTTTTATTATGACAC 0: 1
1: 0
2: 3
3: 20
4: 193
Right 1128889144 15:71315361-71315383 ACACTGAGCCTTGCATGAACTGG 0: 1
1: 0
2: 1
3: 11
4: 120
1128889143_1128889146 12 Left 1128889143 15:71315342-71315364 CCTTCACACTTTTATTATGACAC 0: 1
1: 0
2: 3
3: 20
4: 193
Right 1128889146 15:71315377-71315399 GAACTGGTTCACCTCTCTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 116
1128889143_1128889150 27 Left 1128889143 15:71315342-71315364 CCTTCACACTTTTATTATGACAC 0: 1
1: 0
2: 3
3: 20
4: 193
Right 1128889150 15:71315392-71315414 TCTCTAGGCTGTGGGAAACCAGG 0: 1
1: 0
2: 1
3: 13
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128889143 Original CRISPR GTGTCATAATAAAAGTGTGA AGG (reversed) Intronic
902064957 1:13677337-13677359 ATCTCAAAAAAAAAGTGTGATGG - Intergenic
902258463 1:15206307-15206329 GTTTCAGGACAAAAGTGTGAGGG - Intronic
902258484 1:15206395-15206417 GTTTCAGGACAAAAGTGTGAGGG - Intronic
906911381 1:49955053-49955075 ATGTAATAATAAAATTTTGAAGG - Intronic
907190912 1:52647921-52647943 GTATCATATTAAAAGTGAGAAGG + Intronic
907997425 1:59647073-59647095 GTGGCATGATAAAAGACTGAGGG + Intronic
910743450 1:90547429-90547451 GTGTCATTAAAAAAGAGTTAAGG - Intergenic
910789602 1:91037415-91037437 GTCTTATAAAAAAACTGTGAGGG - Intergenic
911056658 1:93714281-93714303 GTTCCATAATAAAAGTATGATGG - Intronic
911418826 1:97612996-97613018 GGGTAGTAATAAAAATGTGATGG - Intronic
911468962 1:98292214-98292236 AAGGCATAATAAAAGTATGAGGG - Intergenic
913974383 1:143442930-143442952 GTGTCAAAGCAAAAGTCTGATGG + Intergenic
914068773 1:144268544-144268566 GTGTCAAAGCAAAAGTCTGATGG + Intergenic
914110382 1:144697810-144697832 GTGTCAAAGCAAAAGTCTGATGG - Intergenic
915639947 1:157216999-157217021 GTTACATAATAAAAGTAAGATGG + Intergenic
917095600 1:171396186-171396208 GGGTCACAATAAAATTGTAAAGG + Intergenic
917400541 1:174644360-174644382 GTATCCTAGTAAGAGTGTGATGG - Intronic
919014655 1:192017247-192017269 GAGTGTTAATAAAAGTATGATGG + Intergenic
921446328 1:215251034-215251056 AGGTCAAAATAAAAGTGGGAGGG - Intergenic
924437122 1:244051246-244051268 GTGTTAGAATAAAAGGCTGAGGG - Intronic
1063923642 10:10956292-10956314 GTGCCATAATCAAAATGTTAGGG + Intergenic
1066318580 10:34275825-34275847 GGGTCACAATAAAAGAGTAAAGG - Intronic
1068231654 10:54175160-54175182 ATGTCATGATTAAAGTTTGAGGG - Intronic
1068415614 10:56717631-56717653 TTGGAATGATAAAAGTGTGATGG - Intergenic
1069787773 10:71000242-71000264 GTGCCCTAATAAAAGCTTGAGGG - Intergenic
1070958423 10:80481100-80481122 GTTTCAAAAAAAAAGAGTGAAGG + Intronic
1072442794 10:95471716-95471738 GTGTCAAAAAGAAAGGGTGAAGG + Intronic
1073679277 10:105684741-105684763 GTGTCATAAGAACAGTGTGATGG - Intergenic
1074030034 10:109677828-109677850 CGGTCATAAAAAAAGTGAGATGG + Intergenic
1074075201 10:110116811-110116833 GTGGCAAAATAAAAATATGATGG - Intronic
1077903504 11:6510383-6510405 GTGTTTTAATAAAAATTTGAAGG - Intronic
1079925973 11:26491634-26491656 GAGTAATAATAAAATGGTGAGGG - Intronic
1082136956 11:48560189-48560211 TTTTCATAATACAGGTGTGATGG + Intergenic
1085255147 11:75168440-75168462 TTGGGATAATAATAGTGTGAGGG + Intronic
1087418304 11:97887024-97887046 ATTTCATAATAAAAGTTTTAAGG + Intergenic
1087516631 11:99171755-99171777 GAGTAATAATAAAAGTGTCATGG - Intronic
1088032090 11:105263646-105263668 GTGTCATAAGAAGAGTCTGGTGG - Intergenic
1088119509 11:106351537-106351559 ATGTAATCACAAAAGTGTGATGG - Intergenic
1088298783 11:108331908-108331930 GTATAATAAACAAAGTGTGATGG - Exonic
1089032934 11:115352215-115352237 GTTTCATAACAAAATTGTGACGG + Intronic
1090985063 11:131759103-131759125 GTGGAATCATAAAGGTGTGAAGG - Intronic
1091478904 12:806527-806549 GTGTCATAAAAATAGTGTCTGGG + Intronic
1093606199 12:21091936-21091958 GTGTCATATAAAAAATCTGATGG + Intronic
1093783321 12:23162689-23162711 GTGTCATAATAACAGAATAAAGG - Intergenic
1093818939 12:23587591-23587613 GTGTCATAAAAATTTTGTGAGGG - Intronic
1095208811 12:39469226-39469248 ATCTCATAATAAAAATTTGATGG + Intergenic
1095398649 12:41789941-41789963 GTGTCACCATAAAGGTGTCAGGG - Intergenic
1099696429 12:86027162-86027184 GTGTCATAATAGAAGAGGAAAGG + Intronic
1099873612 12:88377725-88377747 CTGTCATAATAAAGATTTGATGG - Intergenic
1100328652 12:93565839-93565861 ATGTCAGAATAAAAGGGAGAAGG - Intergenic
1101671933 12:106883697-106883719 GGGTCATCATAATAGTGTGTGGG - Intronic
1102429172 12:112868294-112868316 TAGTAATAATAAAAGTGTGCTGG + Intronic
1103539401 12:121655378-121655400 GGGTCAAAATAAGAGTGGGAGGG - Intronic
1108748109 13:53416411-53416433 GAGTTAAAATAAAGGTGTGATGG - Intergenic
1109561968 13:64061451-64061473 ATGTTACAATAAAAGTCTGATGG + Intergenic
1111112786 13:83736019-83736041 GTGTAATAATAAAAGAGGGAAGG + Intergenic
1111249075 13:85579939-85579961 GTTTCAAAATAAAACTTTGAAGG - Intergenic
1113142012 13:107163748-107163770 GTGGCATATTAAAAGTAGGAAGG - Exonic
1114401077 14:22411177-22411199 CTGTCATAAAAACAGTGTGGAGG - Intergenic
1115606926 14:35012338-35012360 GTGTCTCTTTAAAAGTGTGATGG + Intronic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1116520588 14:45842491-45842513 GTGTCATTATATAAATTTGAGGG - Intergenic
1117163675 14:53013281-53013303 TTGTCAAAATAAAAATATGAAGG - Intergenic
1117409487 14:55438420-55438442 GTGGCCTAAGAAAAGTGAGATGG + Intronic
1127168241 15:56270509-56270531 GTGTCAAAATAAAAGGATGGAGG - Intronic
1127737688 15:61859629-61859651 GTGTCATGGGAAAAGTGTCAGGG - Intronic
1127938909 15:63673046-63673068 GCATCAAAATGAAAGTGTGAAGG - Intronic
1128889143 15:71315342-71315364 GTGTCATAATAAAAGTGTGAAGG - Intronic
1130006614 15:80105274-80105296 GTTTTTTATTAAAAGTGTGATGG - Intronic
1130409495 15:83632689-83632711 CTGTCATAAGAAAAGCATGAGGG + Intergenic
1135793325 16:25418658-25418680 GAGTCATGATAAAAGTATGTTGG - Intergenic
1138777153 16:59736725-59736747 CTGTAATAATGAAGGTGTGATGG - Intronic
1140338880 16:74138052-74138074 GTGTTATAGGAAAAGTGAGATGG - Intergenic
1142674756 17:1506888-1506910 GTCTCAGAATAGAAGTGTTAGGG - Intronic
1143877964 17:10007095-10007117 GTGTAATAATAAAATGGTGGAGG - Intronic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1153994400 18:10427345-10427367 ATGTCATCATAAACGTCTGAGGG - Intergenic
1156624179 18:38888618-38888640 GTCTTATATTAAAAGTGAGAAGG + Intergenic
1156712221 18:39960702-39960724 GAGTCAGAATCAAAGTGAGATGG - Intergenic
1159550003 18:69885040-69885062 CAGTAATAATAAAAGTGTGCCGG - Intronic
1163922010 19:20298371-20298393 GTGTCATAATAAAAATAGAATGG - Intergenic
1167534474 19:50041027-50041049 GTAACATAATAAAAGTGTGCTGG - Intronic
927281697 2:21314071-21314093 GTCTCATTATAAAAATGAGAGGG - Intergenic
928620277 2:33081791-33081813 GTATCATAAGAAAAGCATGAGGG - Intronic
928879764 2:36084875-36084897 GTGTCAAAATAAAAGTGGGAGGG - Intergenic
932078284 2:68687187-68687209 GTTTCACTATAGAAGTGTGACGG + Intronic
932463378 2:71897583-71897605 GTGTGATAAGAAAAGTCTGTGGG + Intergenic
933912349 2:86953324-86953346 GTGTTAAAATAAAAGTGTCTTGG - Intronic
934010646 2:87816573-87816595 GTGTTAAAATAAAAGTGTCTTGG + Intronic
934057187 2:88261328-88261350 GGGTCATAAGCAAAGTGTGACGG + Intergenic
934179088 2:89603905-89603927 GTGTCAAAGCAAAAGTCTGATGG + Intergenic
934289373 2:91678175-91678197 GTGTCAAAGCAAAAGTCTGATGG + Intergenic
935905849 2:107838638-107838660 GTGTTAAAATAAAAGTGTCTTGG - Intronic
935992328 2:108731155-108731177 GTGTTAAAATAAAAGTGTCTTGG - Intronic
936127648 2:109803813-109803835 GTGTTAAAATAAAAGTGTCTTGG - Intronic
936217049 2:110567672-110567694 GTGTTAAAATAAAAGTGTCTTGG + Intronic
936426188 2:112422256-112422278 GTGTTAAAATAAAAGTGTCTTGG + Intronic
937153956 2:119705229-119705251 GTGAGATAATAAATGTGTGCTGG - Intergenic
937769867 2:125707862-125707884 GAGTAATTATAAATGTGTGAGGG + Intergenic
937944894 2:127323760-127323782 GTGTTATAACAAAAGTATAATGG - Intronic
939703148 2:145419643-145419665 CTGTCATGAGAACAGTGTGAGGG + Intergenic
940894258 2:159064986-159065008 GTGCATTAATAAAGGTGTGATGG + Intronic
943867623 2:192948148-192948170 GTTTTATGATAAAAGTTTGAGGG + Intergenic
944450724 2:199839404-199839426 GTGTTATAAAAATAGAGTGATGG + Intronic
946151537 2:217776082-217776104 GTGTAATAAGAAAAATGTCACGG + Intergenic
947468194 2:230373087-230373109 GCTTCATAAGAAAAGTCTGAAGG + Intronic
948719114 2:239885726-239885748 GTTTCTTAATAAAACTGAGAGGG - Intergenic
1170504970 20:17015757-17015779 TTGTCATAAAAAAAAGGTGAGGG - Intergenic
1173262204 20:41446595-41446617 GTGTCACAGTAAGAGTCTGACGG - Intronic
1173564372 20:44028524-44028546 GGGGCTTAATAAAAGTGTGAGGG - Intronic
1177304064 21:19289667-19289689 GTTTCAATATAAAAGTGAGATGG - Intergenic
1177676092 21:24301027-24301049 ATGTCATAATAAAAATGTACAGG - Intergenic
1179328198 21:40371506-40371528 GTGGCAAAATACAAGTGGGAAGG + Intronic
1182237864 22:28890558-28890580 CTGGCATAAGAAAAGTCTGAAGG + Intronic
1182685431 22:32119502-32119524 GTGTCATTATTAAAGTTTGAGGG - Intergenic
1183552205 22:38496159-38496181 GTGTCATAGTAAAAGTGACGAGG - Intronic
950692824 3:14673896-14673918 GTGTCACAGTAAGACTGTGATGG - Intergenic
952600929 3:35082053-35082075 CTGTAATAATAAAACTGTCATGG - Intergenic
955497722 3:59552890-59552912 GTTCCATAATAAAACTGTTAAGG + Intergenic
957220016 3:77370110-77370132 TTGTTATAACAAAAGTGTGATGG + Intronic
957928945 3:86852351-86852373 ATGGCATAATAAAAATGTAATGG + Intergenic
959731867 3:109613343-109613365 GTGTCATAAAGAAAGATTGAAGG + Intergenic
959743229 3:109745804-109745826 GTGTTATAACAAAAGAGAGACGG + Intergenic
961319088 3:126060415-126060437 GTCTCAAAAAAAAAGTGAGAAGG + Intronic
964155264 3:153577261-153577283 ATGTCATAAACAAGGTGTGAGGG + Intergenic
964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG + Intronic
964592938 3:158386561-158386583 GTTTCATAATAATAGTGTGTTGG - Intronic
964830518 3:160879108-160879130 TTTTCATATTAAAAGTTTGAAGG + Intronic
966556290 3:181264264-181264286 GTGTCATATTTAAAATGTGAGGG + Intergenic
969830196 4:9789711-9789733 GTGTCAAAGCAAAAGTCTGATGG - Intronic
969946857 4:10792119-10792141 GTGACATAAGAAAAGAGTAAAGG - Intergenic
970959854 4:21858958-21858980 ATGTTATAATAAAACTGTGTGGG + Intronic
971468886 4:26997769-26997791 GTGTCATGTTAAAGGTGTAAGGG + Intronic
972048648 4:34701137-34701159 ATGGCATAATCAAAATGTGAAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
974177781 4:58345781-58345803 GTATCATAAGAAAAGCATGAGGG - Intergenic
974412487 4:61560129-61560151 GTGCCATAATAGAAGTATGGAGG - Intronic
974542303 4:63252790-63252812 GTGTCAAAATAAACTTGAGATGG + Intergenic
974873114 4:67668285-67668307 GTGTCTTGATTAAAATGTGAAGG - Intronic
976958203 4:90931923-90931945 GTTTCAAAATAAAACTGTAAAGG + Intronic
977098487 4:92776544-92776566 GTTGCATAATAAAACTGTTACGG + Intronic
977211779 4:94226797-94226819 GTGTCAAAAGATAAGTGTTATGG + Intronic
977258856 4:94772901-94772923 GTTTCATAATACAATTATGAAGG - Intronic
977275408 4:94971451-94971473 ATATTACAATAAAAGTGTGATGG + Intronic
978785366 4:112603180-112603202 GTGTCATATTTAAAGAGAGAAGG + Intronic
979116566 4:116831537-116831559 GTCTCAAAATAAAAGGATGAAGG + Intergenic
979160796 4:117458685-117458707 GGGTCATAAAACAATTGTGAAGG + Intergenic
979944313 4:126807556-126807578 TTCTCACAATAAAAGTATGAGGG - Intergenic
982061565 4:151609279-151609301 GTTACATAATAAAGATGTGATGG + Intronic
987186384 5:15424462-15424484 GGGTATTAATAAAAGTTTGAAGG - Intergenic
987668662 5:20980188-20980210 ATCTCATAATAAAATTTTGATGG - Intergenic
988925538 5:35987662-35987684 GAGTCATTATAAAATTCTGAAGG - Intronic
989705461 5:44325058-44325080 GTGTCATAATAAGTGGGCGAAGG + Intronic
989976173 5:50589555-50589577 TGGTCATAACAAAAGTGAGAGGG - Intergenic
992710139 5:79444698-79444720 GGATTTTAATAAAAGTGTGATGG - Intronic
993441823 5:87966177-87966199 GTGTACTAATAAAAGTCTTAAGG + Intergenic
993605439 5:89985168-89985190 GTGTCAAAAAAAAAGTCTTAAGG + Intergenic
993956163 5:94235430-94235452 GTGTCAAAAGAAAAGTCTGAAGG + Intronic
994887970 5:105591185-105591207 ATGGCATAATAAAAATATGATGG + Intergenic
996353100 5:122567457-122567479 GTGTCAGAAAAGAAGTGTGGTGG - Intergenic
996793415 5:127317896-127317918 GTGTAATAAAAAAAAAGTGAGGG + Intronic
997959604 5:138309553-138309575 GTCTCAAAATAAAAGGGCGATGG + Intronic
1000828511 5:166075268-166075290 ATGTCACACTAATAGTGTGAGGG + Intergenic
1001668308 5:173452148-173452170 GTGACATAATAAAAGTTCTAGGG + Intergenic
1005528156 6:26672978-26673000 GTGTGTTTATAAAAGTGGGATGG - Intergenic
1005530916 6:26704978-26705000 GTGTGTTTATAAAAGTGGGATGG - Intergenic
1005539880 6:26796668-26796690 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1005542639 6:26828661-26828683 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1007848784 6:44783274-44783296 GTGTCATAATAAATGTTTTGGGG + Intergenic
1009010697 6:57838796-57838818 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1009013456 6:57870774-57870796 GTGTGTTTATAAAAGTGGGATGG + Intergenic
1009786387 6:68345319-68345341 GTGGCATAAGAAAAGCCTGAAGG + Intergenic
1010353356 6:74902237-74902259 GTCTTAAAATAAAAGTTTGAGGG + Intergenic
1012314735 6:97772410-97772432 GTTTCATACTAAAAGAGTTAAGG + Intergenic
1014015757 6:116528190-116528212 CAGTCATAATAAAAGTTTAAGGG + Intronic
1020444346 7:8253854-8253876 GGTTAATAATAACAGTGTGAAGG + Intronic
1020608397 7:10365595-10365617 GGCTCAAAATAAAGGTGTGAAGG - Intergenic
1021114382 7:16731483-16731505 GTGACATAACTACAGTGTGAAGG - Intergenic
1021316792 7:19157594-19157616 GTGGTGTAATAAAAGTGTGGAGG + Intergenic
1022426484 7:30273392-30273414 GTGTCTGAATTACAGTGTGAAGG + Intergenic
1023599540 7:41867758-41867780 TTGTCATAATGAAAATGTGAGGG - Intergenic
1023672382 7:42591380-42591402 GTGTCATAAAGAATGTGTGTAGG - Intergenic
1026176647 7:68003423-68003445 ATGTAATAGTAATAGTGTGATGG - Intergenic
1028293331 7:89095588-89095610 GTTTAATAATAAATTTGTGAAGG + Intronic
1032350234 7:131155931-131155953 GTGACATAATCAAATTTTGAAGG - Intronic
1033880488 7:145876215-145876237 GACTCATAATAAAATAGTGAAGG - Intergenic
1039895758 8:41715408-41715430 GTGCCATGATAAATGTATGAAGG + Intronic
1041129265 8:54680311-54680333 GTGTCATAATAAATGTACAAAGG + Intergenic
1042836299 8:73081589-73081611 TTGTTATAATAAAAATGTTATGG - Intronic
1043970446 8:86522863-86522885 GTGTCCTAAAACAATTGTGAAGG - Intronic
1044290336 8:90461310-90461332 GTGTGGTATTAAGAGTGTGATGG - Intergenic
1044670384 8:94674376-94674398 GTGTCATAAAAAAAACATGAAGG + Exonic
1046283963 8:112071834-112071856 CTGTCATAAGAACAGTGTGAGGG - Intergenic
1046827058 8:118703014-118703036 GAGTCATAAAAAAAGTATTAAGG - Intergenic
1047993869 8:130315023-130315045 TTGTCATAGTAAAATTGTGACGG - Intronic
1048813052 8:138306046-138306068 TTTTCTTAGTAAAAGTGTGATGG - Intronic
1050294348 9:4189858-4189880 GGCTCATAATAAAAGGATGAAGG - Intronic
1052571063 9:30224659-30224681 GTATCATAAAAAAAATGTTAAGG + Intergenic
1052937417 9:34104590-34104612 TTTTCATAATAAAACTTTGATGG - Intronic
1055279530 9:74658246-74658268 GAGGCAGAATCAAAGTGTGATGG + Intronic
1057504791 9:95625377-95625399 ATGTCATCTTAAAACTGTGAGGG + Intergenic
1058248911 9:102667692-102667714 ATGACATAATAAAAGTGTGAAGG - Intergenic
1058625752 9:106931273-106931295 GTGGCCTAATAAAAGTCAGAGGG - Intronic
1060053978 9:120397588-120397610 GTGTCATAATGATACTGTGTTGG - Intronic
1060243629 9:121925946-121925968 GTGGCACAAGAAAAGTGGGAAGG - Intronic
1061369593 9:130191018-130191040 GTGTCTGAATAAAAGTCAGAGGG - Intronic
1061593155 9:131611803-131611825 GGGTCAAAAGAAAAGTGTGTAGG - Intronic
1187067819 X:15857489-15857511 GTTTCCTATTAAATGTGTGATGG + Intergenic
1187284224 X:17887355-17887377 GTATCATAATATAAGTGTCCAGG + Intergenic
1187995379 X:24920566-24920588 GTGGCATAATAAAAGGATCAAGG + Intronic
1190131344 X:47751634-47751656 GTTACAGAATAATAGTGTGATGG + Intergenic
1192884935 X:75326820-75326842 GTGTCATATTAAAAGACAGATGG - Intergenic
1195565715 X:106336865-106336887 GGGACATAATAAAAGTTTGGTGG - Intergenic
1195611916 X:106877255-106877277 GTGAGATAATAAATGTGTGATGG - Intronic
1195618208 X:106929439-106929461 GAGTCATAACAAGAGTGGGATGG - Exonic
1195967668 X:110443431-110443453 TTCTCAAAATAAAAGTGTGGTGG - Intronic
1197656695 X:129124485-129124507 GTGACATAAAAAAAATTTGAAGG + Intergenic