ID: 1128889429

View in Genome Browser
Species Human (GRCh38)
Location 15:71317678-71317700
Sequence TTCACATGATTCCAAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128889426_1128889429 -3 Left 1128889426 15:71317658-71317680 CCCTTTGGGAAGTTCGTTTTTTC 0: 1
1: 0
2: 0
3: 13
4: 219
Right 1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 188
1128889422_1128889429 24 Left 1128889422 15:71317631-71317653 CCAAACCATATCAGATGGCAAAA 0: 1
1: 12
2: 97
3: 364
4: 1440
Right 1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 188
1128889427_1128889429 -4 Left 1128889427 15:71317659-71317681 CCTTTGGGAAGTTCGTTTTTTCA 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 188
1128889423_1128889429 19 Left 1128889423 15:71317636-71317658 CCATATCAGATGGCAAAATGTAC 0: 1
1: 0
2: 4
3: 14
4: 217
Right 1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128889429 Original CRISPR TTCACATGATTCCAAGGAAG AGG Intronic
902158907 1:14513144-14513166 TGGACATGATTCTAAGGAAAAGG - Intergenic
903626944 1:24737647-24737669 CTCACAGTATACCAAGGAAGAGG + Intergenic
903864646 1:26389393-26389415 TTAAAATGAGTGCAAGGAAGAGG + Intergenic
904777287 1:32918383-32918405 TTCACATTGCTCCAAGGCAGAGG - Intergenic
905830912 1:41066666-41066688 ATCACTTGATTCCAGGGATGGGG - Intronic
906833381 1:49058408-49058430 TTCACATGATGGCAAGAAGGAGG - Intronic
906874601 1:49523500-49523522 TTCACTTGATTCCAAAAAACTGG + Intronic
907652653 1:56310494-56310516 TGCAAATGTTTCCAGGGAAGGGG + Intergenic
909366407 1:74828488-74828510 TTCACATGGTGCAAAGAAAGAGG + Intergenic
912389343 1:109291320-109291342 GTCACATGATTCAAGGGAAGGGG + Intergenic
913010568 1:114679051-114679073 TTAAAATGATTACAAGGAAGTGG - Intronic
918924361 1:190762316-190762338 TTCATCTGATTCTAAGAAAGAGG + Intergenic
919338861 1:196277059-196277081 ATCACAAGATTTCAAGAAAGAGG - Intronic
919778551 1:201208928-201208950 TTTACAGGATTCCAGGGAAGCGG + Exonic
920876803 1:209843988-209844010 CTCAAATGAATACAAGGAAGGGG + Intronic
921327290 1:213998376-213998398 TTCCCATTATTCAAAGGAATAGG + Intronic
922441662 1:225660519-225660541 TTCACAATATTCCTATGAAGTGG + Intergenic
1063543105 10:6954568-6954590 TACTCATGATGCCATGGAAGGGG - Intergenic
1064995176 10:21290505-21290527 TTGATAAGATTCCTAGGAAGGGG - Intergenic
1068465774 10:57388834-57388856 TTCACATATTTACAGGGAAGTGG + Intergenic
1068691615 10:59921495-59921517 AACATATGCTTCCAAGGAAGGGG + Intergenic
1068997936 10:63229197-63229219 TTCACATAATTAAAAGCAAGGGG + Intronic
1069434017 10:68363891-68363913 TTTACATTATACCAAGGAAATGG - Intronic
1071196177 10:83162830-83162852 ATGATATGATTCCAAGTAAGTGG + Intergenic
1074040763 10:109786008-109786030 TTCATAACATTCCAAGAAAGTGG - Intergenic
1074495562 10:113977441-113977463 TTGACAAGATTCCAAGGAGTGGG - Intergenic
1076124083 10:127961085-127961107 TTCAGACGATGCCAAGGAACGGG + Intronic
1078862723 11:15266051-15266073 TTGACATGATTTCCAGGAATAGG + Intergenic
1080887457 11:36379699-36379721 TTCACATGGAGCCAAGGAGGGGG + Intronic
1081902419 11:46640215-46640237 TGCAAATGGTTACAAGGAAGTGG + Intronic
1082218552 11:49604267-49604289 TTCATATGATTCCATTAAAGAGG - Intergenic
1086615062 11:88806721-88806743 CCCACATGATTCCCAGGATGAGG - Intronic
1086631023 11:89019849-89019871 TTCATATGATTCAATGAAAGAGG + Intronic
1098306489 12:69107644-69107666 CTCTCATGATTCCATGGCAGGGG + Intergenic
1098509695 12:71297252-71297274 TTCACATAACTACAAAGAAGTGG + Intronic
1100380049 12:94053534-94053556 TTCACATGTTCCCATGAAAGAGG + Intergenic
1101008608 12:100427017-100427039 TGGACATGTTTCAAAGGAAGAGG + Intergenic
1102297451 12:111747957-111747979 TTCACCTGATTCCAAGGCCCGGG + Intronic
1102407155 12:112683503-112683525 GGCAGATGATTCCAAGGAGGAGG + Intronic
1105293104 13:19066020-19066042 ATCAAATGATGCTAAGGAAGTGG + Intergenic
1105513779 13:21073450-21073472 TTCATGTGTTTCCAAAGAAGAGG + Intergenic
1107467019 13:40660374-40660396 TTCCCATGATGCCAGGGAACTGG + Intronic
1108391651 13:49953109-49953131 TTCGAATGATTCCCAGGATGAGG + Intergenic
1109031971 13:57202486-57202508 TGCATATGAATGCAAGGAAGTGG - Intergenic
1109643014 13:65216636-65216658 TTCACAAAATTAGAAGGAAGGGG + Intergenic
1110727720 13:78844621-78844643 TTCATATTATTCAAAGGAAGTGG - Intergenic
1110848547 13:80218010-80218032 TTAAAATGACTCAAAGGAAGTGG + Intergenic
1111041414 13:82754104-82754126 CTCTCATGAATCCTAGGAAGGGG + Intergenic
1111319901 13:86613659-86613681 TTCACATGGCTCCCAGGAAAGGG - Intergenic
1111397647 13:87686217-87686239 TTCACATATTTCCAATGAATTGG - Exonic
1111668317 13:91297218-91297240 TTCAAATTATTTCAAGGAATTGG + Intergenic
1112807444 13:103178854-103178876 TGCACATGATTGCTAGTAAGAGG + Intergenic
1113025191 13:105933075-105933097 TACACAAGATTCAAAGAAAGAGG - Intergenic
1114684409 14:24514415-24514437 TTCTCAAGAGTCCTAGGAAGAGG + Intergenic
1114730448 14:24987399-24987421 TTCACAACAGTCCTAGGAAGTGG - Intronic
1115681342 14:35741925-35741947 TGCAAAAGATTCCAAGGAGGGGG + Intronic
1116320932 14:43461813-43461835 TTCACATGACACCAAGAATGAGG + Intergenic
1117034958 14:51718748-51718770 TTCACATTGTTCTAAGGAACTGG - Intronic
1119915214 14:78393137-78393159 TACAAAGAATTCCAAGGAAGAGG + Intronic
1120115654 14:80614374-80614396 GTCACATGAGCCAAAGGAAGGGG - Intronic
1120222035 14:81745307-81745329 TTCAAATGACTCCAGAGAAGTGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1125890351 15:43260943-43260965 TTAACTTGAGTCCAAGAAAGCGG - Intronic
1128606519 15:69040163-69040185 TTCAGGTGATTCCAAGGTAGGGG - Intronic
1128889429 15:71317678-71317700 TTCACATGATTCCAAGGAAGAGG + Intronic
1131612737 15:93982054-93982076 TTCAAATGCTTCCAGAGAAGGGG - Intergenic
1131926299 15:97387605-97387627 TTCACATGATCCCAGGGAGCAGG - Intergenic
1135505671 16:23033988-23034010 TTCACATATTTGCAATGAAGAGG + Intergenic
1137854656 16:51782115-51782137 TTTCCATGAGCCCAAGGAAGTGG - Intergenic
1138242080 16:55435466-55435488 CTCAAAGGAGTCCAAGGAAGTGG + Intronic
1141274159 16:82569973-82569995 TTCACATGATTAGAACGATGTGG - Intergenic
1142494207 17:297766-297788 TTCACCAGATTCTAGGGAAGGGG - Intronic
1145993884 17:29094757-29094779 TTCCCAAGAGTCCAAGGATGAGG - Exonic
1146631715 17:34474787-34474809 TCCACATTTTTCCAAGGAACTGG + Intergenic
1146739307 17:35267986-35268008 TTCACATGAATTCAATGAAGGGG + Exonic
1147196299 17:38769068-38769090 TTCACTTGAATCCAAGGGAAAGG + Exonic
1147534521 17:41310680-41310702 GTCACATGATTTCCAGGAACAGG - Intergenic
1149940437 17:60859382-60859404 TTCACATGGACACAAGGAAGGGG - Intronic
1151581032 17:74979048-74979070 GTCACCAGATTCCAAGGGAGAGG + Intergenic
1155648681 18:28113670-28113692 TATACAGTATTCCAAGGAAGAGG - Intronic
1157585197 18:48796602-48796624 TGGACATGATGACAAGGAAGTGG + Intronic
1167526095 19:49984715-49984737 ATCACTTGAGTCCAAGGAGGTGG - Intronic
925104337 2:1277717-1277739 TCCACGTGATGCCAGGGAAGAGG + Intronic
925211185 2:2048294-2048316 TTCACATAAATCTCAGGAAGAGG - Intronic
925591618 2:5515503-5515525 TTCTCACCACTCCAAGGAAGTGG - Intergenic
927082194 2:19641660-19641682 CTCACATGATACCAAGAAATAGG - Intergenic
927208907 2:20626915-20626937 CTCTCATGACTCCTAGGAAGTGG + Intronic
930676657 2:54208498-54208520 GTCACATGATTCCAAGCTAATGG - Intronic
937367409 2:121273692-121273714 AACACATCATTACAAGGAAGGGG + Intronic
940155634 2:150653181-150653203 TCCACACTTTTCCAAGGAAGAGG + Intergenic
945674202 2:212835274-212835296 AGCAAATGATTCCAAGGATGTGG - Intergenic
946767723 2:223055388-223055410 TTCAAGTGATTCCAGGCAAGAGG - Exonic
946771245 2:223091310-223091332 TTAACATTATTCTAAGGAATGGG - Intronic
948957401 2:241304360-241304382 ATCACATGAATTCAGGGAAGTGG + Intronic
1171432569 20:25092453-25092475 TTCAGATGGTTGCAAGGAAGTGG + Intergenic
1172075955 20:32297776-32297798 TTCCCATGTTTCCAGAGAAGTGG + Intronic
1172216630 20:33240178-33240200 TCCACCACATTCCAAGGAAGAGG - Intronic
1173064247 20:39694939-39694961 CTCAAATGATTCCAAGAAACTGG - Intergenic
1173671375 20:44801384-44801406 TTCAGATGTTTCTAAGAAAGGGG - Intronic
1174322930 20:49756367-49756389 TTCAAATGATTTCCAGGAAGGGG + Intergenic
1175145330 20:56891775-56891797 TACACATGATCCCATGCAAGGGG - Intergenic
1175349456 20:58308644-58308666 TTAACATGATTCCAAAAAAGAGG + Intergenic
1176419605 21:6503563-6503585 ATCACATGAAACCCAGGAAGCGG + Intergenic
1176940150 21:14913417-14913439 TTCACATCCTACTAAGGAAGAGG - Intergenic
1179252521 21:39684277-39684299 TTGACATAATTGGAAGGAAGTGG + Intergenic
1179695098 21:43111886-43111908 ATCACATGAAACCCAGGAAGCGG + Intergenic
1183424947 22:37734456-37734478 TTCTCAGGACTCCAAGGATGAGG - Exonic
1184874915 22:47268253-47268275 TTGAGATGCTTCCAAGGAACGGG + Intergenic
1185401196 22:50618497-50618519 TACTCATGATTCACAGGAAGAGG - Intergenic
949720485 3:6984027-6984049 TTCAAGTCATTCCACGGAAGTGG - Intronic
951636856 3:24788749-24788771 CTCACATGATTACAAGCAGGAGG + Intergenic
954253622 3:49387974-49387996 TACAGATGATGTCAAGGAAGGGG + Intronic
954305372 3:49722750-49722772 GTCACCTGAATGCAAGGAAGGGG + Exonic
954919453 3:54177102-54177124 TTAACATGATGCCAAGGAAAAGG + Intronic
955940505 3:64142871-64142893 TTCACAAAATTCCATGGATGAGG + Intronic
956048893 3:65226026-65226048 TTCTCCTGATTTCAAGGATGTGG - Intergenic
956107200 3:65832299-65832321 TACAAATGATGCCAAGGGAGGGG + Intronic
957172763 3:76760040-76760062 TGAATATGATTTCAAGGAAGTGG + Intronic
958640722 3:96801108-96801130 CTCTCCAGATTCCAAGGAAGTGG + Intergenic
959565404 3:107827639-107827661 TTCACAGGATTGTAAAGAAGGGG + Intergenic
960229608 3:115209609-115209631 TTAACATCATCCCATGGAAGAGG - Intergenic
960364783 3:116757896-116757918 TTCCCAAGTTTCCATGGAAGGGG + Intronic
961607572 3:128108220-128108242 TTCACAGAATTCAAAGGCAGAGG + Intronic
963037607 3:141046070-141046092 TGCAAATCATTCCAAGGAAATGG + Intergenic
964656223 3:159068734-159068756 TTCACAGCTTTTCAAGGAAGTGG - Intronic
965714371 3:171586905-171586927 TTCACATGATTCTTCTGAAGTGG + Intergenic
965834681 3:172838315-172838337 TTCACAAGATCTCAAGGACGTGG - Intergenic
966812914 3:183864317-183864339 ATCACACTGTTCCAAGGAAGGGG + Intronic
970147159 4:13048004-13048026 TTTCCATGAATCCATGGAAGCGG + Intergenic
971022167 4:22547908-22547930 TGCACAAGATTGCAAGCAAGAGG - Intergenic
972463222 4:39326112-39326134 ATCACTTGATTCCCAGGAGGTGG + Intronic
977320419 4:95507890-95507912 TTCACATTGATCCAGGGAAGTGG - Intronic
981752983 4:148110732-148110754 TTCTAATGATTCTAAAGAAGTGG + Intronic
982921305 4:161277511-161277533 CTCACAGGAGTCCAAGGAGGAGG - Intergenic
984769064 4:183422015-183422037 TTCAGATTATTTCAAGGAAAGGG - Intergenic
986127467 5:4896489-4896511 TGGACATGAGTCCAGGGAAGTGG + Intergenic
987456173 5:18149888-18149910 TTCACTTGCTCCCAAGGAAAGGG - Intergenic
987631347 5:20477358-20477380 TTAACATCATACCAAGGAAGGGG + Intronic
988954025 5:36295817-36295839 CTTACATAGTTCCAAGGAAGGGG + Intronic
992782738 5:80142984-80143006 TTCACATTATTACAAAGATGTGG + Exonic
993576157 5:89603161-89603183 TTCACTAAATCCCAAGGAAGGGG + Intergenic
995897423 5:117031105-117031127 TTCACATATTTCCAATTAAGAGG - Intergenic
996565444 5:124875246-124875268 TTCACATGGACACAAGGAAGTGG - Intergenic
997194354 5:131967992-131968014 TTGATATGATTGCAGGGAAGTGG + Exonic
997194879 5:131972620-131972642 TTCACATGATTACAGGGCACTGG + Intronic
998483173 5:142479822-142479844 TTAAAATGCTTCAAAGGAAGAGG + Intergenic
998506780 5:142678753-142678775 TTCAAATGATGCCAAAGAAGGGG + Intronic
999114976 5:149154883-149154905 TTCACAAGAGTCCTAGAAAGAGG + Intronic
1000257185 5:159551108-159551130 ATCAGATGTTGCCAAGGAAGTGG - Intergenic
1000758185 5:165186593-165186615 TTCATATTATGCCAAAGAAGAGG - Intergenic
1001341658 5:170852166-170852188 ATCACATCATTCAAAGGACGGGG - Intergenic
1003741856 6:8949682-8949704 CTAACAAGATGCCAAGGAAGCGG - Intergenic
1007187446 6:39984343-39984365 CTCATATGGTTCAAAGGAAGAGG - Intergenic
1008007214 6:46423497-46423519 TCCATATTATACCAAGGAAGAGG - Intronic
1008328769 6:50220169-50220191 ATCACATGATCCCAAGGGGGAGG + Intergenic
1009503422 6:64445693-64445715 TTCACATGATTCCAATGTGATGG + Intronic
1009609443 6:65921768-65921790 TTCAGTTGATTCTAAGGAATGGG - Intergenic
1012272480 6:97231432-97231454 TTGACTTGTTTCCAAGGATGAGG + Exonic
1014897364 6:126919227-126919249 TTCAATTTATCCCAAGGAAGTGG - Intergenic
1015330572 6:131974008-131974030 TTCAAGTGCTTCCAAGGTAGTGG + Intergenic
1016120623 6:140338199-140338221 TTCATATAGTGCCAAGGAAGGGG - Intergenic
1016449361 6:144165679-144165701 TGCACATGCTTCCAAAGGAGTGG + Intronic
1017491623 6:154950561-154950583 TTAACATCATATCAAGGAAGAGG - Intronic
1018932149 6:168247997-168248019 GCCACCTGATGCCAAGGAAGAGG + Intergenic
1022788622 7:33664227-33664249 TCTAAATGATTTCAAGGAAGAGG - Intergenic
1022860625 7:34362975-34362997 TTCACAAGATGCCTAGGATGAGG + Intergenic
1027348197 7:77283735-77283757 TTCACATGATTAAAAAAAAGGGG - Intronic
1029036567 7:97528619-97528641 GTCACATGATGCCAGGTAAGGGG - Intergenic
1030656347 7:112172489-112172511 TTCTCTTGATACAAAGGAAGTGG - Intronic
1030965022 7:115981070-115981092 AGAACATGATTCCAAGGTAGTGG - Intronic
1031560305 7:123230504-123230526 TTCACCAGATTCCCAGGAGGAGG - Intergenic
1034897201 7:154885236-154885258 TGCACATGATTCTGAGGGAGGGG - Intronic
1035450680 7:158974895-158974917 TTAACATGATTCCAAACAAAAGG - Intergenic
1036815847 8:11902451-11902473 GCCACCTCATTCCAAGGAAGCGG + Intergenic
1037476320 8:19261598-19261620 TTCACTTGACTTCCAGGAAGTGG + Intergenic
1041639246 8:60179009-60179031 ATTAATTGATTCCAAGGAAGGGG - Intergenic
1043186124 8:77152104-77152126 ATCACATTAGTCCAAGGAACAGG + Intergenic
1045186700 8:99845393-99845415 TTCTCAAGATTCTGAGGAAGTGG + Intronic
1050396721 9:5205632-5205654 TTCCCATGATGGCAATGAAGAGG - Intergenic
1051949095 9:22609105-22609127 TTCACCAGATTCCAAAGTAGAGG + Intergenic
1054754286 9:68941737-68941759 TTCAGTTGATTTCCAGGAAGAGG + Intronic
1054935286 9:70680861-70680883 TTCATATGGCTCCAAGGATGAGG + Intronic
1059450349 9:114367822-114367844 TTCACATCAGCCCCAGGAAGTGG + Intronic
1059568520 9:115408814-115408836 TTAACATGATTCCAGGGCAATGG + Intergenic
1186248534 X:7640761-7640783 TTCATGAGATTCCAAGGGAGGGG + Intergenic
1188393588 X:29652490-29652512 TCTAAATGATTCCAAGAAAGTGG + Intronic
1189403384 X:40693723-40693745 TTTACATGTTTCCAAGTATGAGG - Intronic
1189510943 X:41660544-41660566 CTCAGATGAATCCAAGGCAGTGG - Exonic
1192722116 X:73710079-73710101 TTCTCAATACTCCAAGGAAGGGG + Intergenic
1193077705 X:77373061-77373083 ATCACCAGCTTCCAAGGAAGAGG + Intergenic
1194600445 X:95913936-95913958 TTGACGTGATTCCTAGGGAGAGG - Intergenic
1195348536 X:103975684-103975706 TTGACATGATACCAAGCAACAGG + Intergenic
1195355881 X:104039789-104039811 CTGACATGATTCCAAGCAACAGG + Intergenic
1195358906 X:104063156-104063178 TTGACATGATACCAAGCAACAGG - Intergenic
1195496657 X:105543150-105543172 TATATATGTTTCCAAGGAAGTGG + Intronic
1195771079 X:108352082-108352104 TTCACCTGACTCCAAAGAAAAGG - Intronic
1198425613 X:136516776-136516798 TTCACATTCTTCTAAGAAAGTGG - Intergenic
1198849453 X:140950953-140950975 TTCACATAAATCCAAGAGAGAGG + Intergenic
1198962280 X:142195388-142195410 TGCACAGGATTCCACAGAAGAGG - Intergenic
1199185783 X:144913236-144913258 TTTTCATTATTCCAAGGAATGGG - Intergenic
1200772689 Y:7141693-7141715 TTCACATGAGTGAAAGAAAGTGG - Intergenic