ID: 1128894234

View in Genome Browser
Species Human (GRCh38)
Location 15:71357870-71357892
Sequence CTTTGAATAAGTAAGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128894234_1128894240 1 Left 1128894234 15:71357870-71357892 CCAACTGCCTTACTTATTCAAAG 0: 1
1: 1
2: 1
3: 13
4: 173
Right 1128894240 15:71357894-71357916 GGGGGAAAAAGCATTCATGCTGG 0: 1
1: 0
2: 2
3: 22
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128894234 Original CRISPR CTTTGAATAAGTAAGGCAGT TGG (reversed) Intronic
903433055 1:23323792-23323814 CTTTAAAAAAAAAAGGCAGTAGG - Intronic
904280044 1:29412766-29412788 CTTTGGAGAGGTCAGGCAGTGGG + Intergenic
906785306 1:48610433-48610455 CATTGAGGAAGTAGGGCAGTGGG + Intronic
908511584 1:64853958-64853980 CTGTGAATAAATAGGGCTGTTGG + Intronic
908548175 1:65182481-65182503 TTTTCAATAAGTAACGCAGGTGG - Intronic
910235327 1:85029834-85029856 CCTTGCATAAGGAAGACAGTAGG - Intronic
911754793 1:101541039-101541061 CTTTGAATAAGCAATGGAGGAGG - Intergenic
912311809 1:108630275-108630297 GTTTTAATATGTATGGCAGTGGG - Intronic
915021455 1:152783717-152783739 CTCTGAAAAAGCAAAGCAGTTGG + Intronic
915139702 1:153759661-153759683 CTATCACTAAGGAAGGCAGTGGG - Intronic
916962051 1:169898372-169898394 CTATGCATAAGAAAGGCAGAAGG - Intergenic
921446071 1:215248850-215248872 CTTAGAAGAAGTAGGGTAGTAGG + Intergenic
922349091 1:224721281-224721303 CTCAGAATAAGGAGGGCAGTGGG - Intronic
922974876 1:229776013-229776035 CTTAGAATAAGGAAAGGAGTTGG + Intergenic
923269387 1:232341348-232341370 ATTTGAAGGAGTAAGGCAGCTGG - Intergenic
1064644319 10:17445523-17445545 CTTTGGAAAAGAAAGGCAGACGG - Intronic
1065282549 10:24154467-24154489 CTTCCAATAAGTCAGGAAGTAGG - Intronic
1065413307 10:25454942-25454964 CATTTATTTAGTAAGGCAGTTGG + Intronic
1066763670 10:38783390-38783412 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1066958140 10:42192278-42192300 CTTTAATTCAGTGAGGCAGTAGG - Intergenic
1068717912 10:60208597-60208619 CTTTGAAAAGCTAAGGCAGGAGG - Intronic
1068983908 10:63089498-63089520 CTTTGCATAACTAAGGCTGAAGG - Intergenic
1069298283 10:66874449-66874471 CTTTGCATAGGTACTGCAGTAGG - Intronic
1072556203 10:96515591-96515613 CTTCTAATAAGGAAGCCAGTTGG - Intergenic
1072930464 10:99658283-99658305 CTTTGAATAAATAAAGCATTTGG + Intergenic
1074297319 10:112202439-112202461 CTTTTAATAAGTAAGACAGCAGG + Intronic
1079989074 11:27228286-27228308 CTTTGAACATGTAATGCATTCGG + Intergenic
1081721703 11:45294248-45294270 GTTTGAAAAAGTAAGGCGATGGG - Intergenic
1081722350 11:45299551-45299573 GTTTGAAAAAGTAAGGCGATGGG - Intergenic
1084767200 11:71320339-71320361 CCTTGAATAAGTCAGGAGGTGGG - Intergenic
1085143690 11:74172491-74172513 CTTTGAATTAGTGAAGCATTGGG + Intronic
1086130044 11:83392033-83392055 CATTGGGTTAGTAAGGCAGTGGG - Intergenic
1087120208 11:94566464-94566486 CTGTGAATAAATAAATCAGTTGG + Intronic
1088326524 11:108606456-108606478 TTTTGGAAAAGTAAGGCAGGTGG - Intergenic
1091495674 12:970649-970671 CATTGATTTAGAAAGGCAGTTGG + Intronic
1094094267 12:26686429-26686451 CTTTGAATAATTATACCAGTAGG - Intronic
1095116750 12:38363291-38363313 AATTGATTAAGTAAGGCAGGTGG - Intergenic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1096667426 12:53175297-53175319 ATTTGAATAAGTGATGGAGTGGG + Intronic
1098829829 12:75348645-75348667 CTTTGAATAAGTCAGGTTTTGGG + Intronic
1102608667 12:114091322-114091344 CTTTGATTAGGTGAGGCAGCAGG + Intergenic
1104101728 12:125618958-125618980 CTATAAGGAAGTAAGGCAGTTGG + Intronic
1104777319 12:131398061-131398083 CTTAGAATCACTAAGGCAATGGG - Intergenic
1106472981 13:30074399-30074421 CTGGGAAATAGTAAGGCAGTGGG - Intergenic
1108075838 13:46678946-46678968 CTCTGAATAAATAAGGAAGGAGG - Intronic
1110054134 13:70943025-70943047 CTGTAAATATGTAAGACAGTGGG + Intergenic
1110080290 13:71301281-71301303 CTATGAATAAGTAAATCAGTGGG + Intergenic
1110795944 13:79638514-79638536 CCTTGAACAAGTAAGACATTAGG + Intergenic
1111324439 13:86674679-86674701 TTTTTAAAAAGGAAGGCAGTTGG + Intergenic
1111803498 13:93008770-93008792 CTTGGAATTAGTAAAGCAGAAGG + Intergenic
1111834062 13:93365379-93365401 CATTGAAAAAGTAAGAAAGTGGG - Intronic
1113887687 13:113669634-113669656 CTTTGAATAGGAAAGGGACTAGG - Intronic
1115099573 14:29682561-29682583 TTTTGAATGAATAATGCAGTGGG - Intronic
1116377887 14:44227020-44227042 CTTTGAAAAACCAAGGCAGGAGG - Intergenic
1116798116 14:49413418-49413440 CTTAGAAAGAGGAAGGCAGTGGG + Intergenic
1118751387 14:68810201-68810223 GTTTGATTAAGTAAGGAAATTGG - Intergenic
1119348903 14:73948223-73948245 TTTTGAATAAGTATTGCCGTTGG - Intronic
1120511899 14:85425424-85425446 CTTTGAAGAGATAAGGCAGAGGG - Intergenic
1121711529 14:96042322-96042344 CATCTAATCAGTAAGGCAGTGGG + Intronic
1202934983 14_KI270725v1_random:79622-79644 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1124103449 15:26716699-26716721 CTGTGAAAGAGAAAGGCAGTTGG - Intronic
1125714200 15:41810037-41810059 TGTTGAATAAGGAAGGAAGTGGG - Intronic
1126661892 15:51040483-51040505 CTTCTGATAAGAAAGGCAGTTGG + Intergenic
1127658379 15:61076913-61076935 CTTTGAACAAGCAAGGGAGAGGG - Intronic
1128487782 15:68112213-68112235 CCTTGAATAAGCAAGTGAGTAGG - Intronic
1128605102 15:69031201-69031223 CTTTGGATAACTGAGGCTGTGGG + Intronic
1128894234 15:71357870-71357892 CTTTGAATAAGTAAGGCAGTTGG - Intronic
1130107865 15:80942604-80942626 CTTTGCAAAAGAAAGGCAGGAGG - Intronic
1137924080 16:52523024-52523046 CAATGAATAAATAAGGCAGAGGG + Intronic
1139324231 16:66139587-66139609 TTTTCATTAAGTAAGGCAGGTGG + Intergenic
1141498672 16:84428327-84428349 CGTTGAAAAAATAAGGCATTTGG - Intronic
1144130962 17:12247376-12247398 CTTTGAACAAGTTAGCTAGTGGG - Intergenic
1144365813 17:14543187-14543209 CTTTGAGTAATTAAGACAATTGG + Intergenic
1146489107 17:33267319-33267341 CTTTGAATAAGTCAGCCCTTTGG + Intronic
1148664757 17:49366031-49366053 CTTTTATTCATTAAGGCAGTGGG + Intergenic
1151676175 17:75599254-75599276 CTTTCAAAAAGTAACTCAGTTGG - Intergenic
1152276559 17:79361380-79361402 CTTTCCACAAGGAAGGCAGTGGG - Intronic
1156099098 18:33572449-33572471 CTATTAATGAGTAAAGCAGTAGG - Intergenic
1156948522 18:42864930-42864952 CATTTAGTAAGTAAGGCAGGTGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159211971 18:65335397-65335419 TTTTTAATTAGCAAGGCAGTAGG - Intergenic
1159709359 18:71735643-71735665 TTTTGAATAAGTTTTGCAGTAGG + Intronic
1163230626 19:15999241-15999263 CTTTGGATAAGTATGCCACTGGG + Intergenic
1167733759 19:51278642-51278664 CTTTGAAGAGGTAATGGAGTGGG + Intergenic
928454031 2:31403283-31403305 CTCTGAATAAGGAGGCCAGTGGG - Intronic
928477854 2:31649389-31649411 ATTTGAATATACAAGGCAGTGGG - Intergenic
928945123 2:36765197-36765219 CTTTGTAAAAGGAAGGCAGAGGG + Intronic
931564351 2:63599198-63599220 CTTGGAAGCAGTCAGGCAGTTGG - Exonic
932532226 2:72548046-72548068 CTTTGATAAAATAATGCAGTGGG - Intronic
932603280 2:73145075-73145097 AGTTGAATAAGAAAGGGAGTTGG - Intronic
933799466 2:85949220-85949242 CCTTGAAATAGGAAGGCAGTTGG - Intergenic
934306255 2:91824677-91824699 CTTTAATTCAGTGAGGCAGTAGG - Intergenic
934327001 2:92028065-92028087 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
934465377 2:94258636-94258658 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
937484112 2:122295927-122295949 CTTTGAATAAGTAAGGCAGGTGG - Intergenic
939580808 2:143943384-143943406 CACTGAAAAAGAAAGGCAGTTGG + Exonic
940567529 2:155386755-155386777 CTTTGCATTTGTAAGGCAGTTGG + Intergenic
942418591 2:175784115-175784137 CTTAAAATTAGTAAGGCAGCCGG + Intergenic
943801926 2:192071049-192071071 CTTTGAATAAGTAAGGGAGGAGG + Intronic
948297310 2:236871218-236871240 CATTGAATAAGTAAAGGACTTGG - Intergenic
1168737596 20:156138-156160 CATTAAATAAATAAGCCAGTTGG - Intergenic
1169285144 20:4301558-4301580 CTTTGAATCAGTACTGCAGGAGG - Intergenic
1169513525 20:6291972-6291994 CTTTGTCTAAGTATGGCAGTTGG + Intergenic
1171993811 20:31717077-31717099 CTCTGCTTAATTAAGGCAGTAGG + Intronic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1173223708 20:41149337-41149359 TTTTGAATAATAAAGCCAGTGGG + Intronic
1173445747 20:43116528-43116550 ATGTGAATAAGTAAGGCAGGTGG - Intronic
1177488811 21:21794327-21794349 CTTGGAAAAAGTTAGGCACTCGG - Intergenic
1177527296 21:22311030-22311052 CTTGGATTAAGCAAGACAGTAGG + Intergenic
1178764528 21:35437278-35437300 CTTTCAATAAAAAAGGCATTTGG + Intronic
1180279312 22:10679292-10679314 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1180586526 22:16897828-16897850 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1183659453 22:39210150-39210172 CCTTGAATTAGGAAGGCACTGGG - Intergenic
1183764171 22:39855331-39855353 ATTTGAATATGTAAAACAGTAGG - Intronic
950070747 3:10150255-10150277 GTTTGTATAAGTAATTCAGTGGG + Exonic
953465739 3:43117870-43117892 CTATTAATTAGTAAGGCAGTAGG + Intergenic
953567384 3:44044552-44044574 CTTTAAAAAAGTAAGGAAGGAGG + Intergenic
953905060 3:46864535-46864557 CCTTGAATATGTCAGGCAGAGGG - Intronic
957573384 3:81977856-81977878 CATTTAATTAGTAAGGAAGTAGG - Intergenic
959536102 3:107486715-107486737 GTTTCAATAAGACAGGCAGTAGG - Intergenic
961008620 3:123421691-123421713 CTCTCAAAAAGGAAGGCAGTGGG - Intronic
962503262 3:136017869-136017891 CTTAGAGTAGGAAAGGCAGTTGG - Intronic
962723011 3:138193812-138193834 TTTTTAATAAGTAATGCATTTGG - Intronic
963796888 3:149639691-149639713 CTTTGAAAAAGTACAGAAGTTGG + Intronic
963982520 3:151555589-151555611 CTTTGATTAGGTCAGGCAGCTGG - Intergenic
964465713 3:156989297-156989319 ATTTGTATAAGTAAGGCACTTGG + Intronic
964473461 3:157077776-157077798 CTGTGAATTAGTAAGCCACTGGG - Intergenic
965467349 3:169046635-169046657 CTTTGAATGATTAGGTCAGTTGG - Intergenic
970844938 4:20525845-20525867 CCTTGAATAATTTAGGCAGATGG + Intronic
971430956 4:26566837-26566859 AATTCTATAAGTAAGGCAGTAGG + Intergenic
972727464 4:41757808-41757830 TTATGAATAAGCAAGGGAGTTGG - Intergenic
976245861 4:83005392-83005414 CTTTGGAGAACTAAGGCAGGCGG + Intronic
979368566 4:119855396-119855418 CTTTTAATAATTAAGGAAATGGG - Intergenic
979831665 4:125313454-125313476 CTCTAAATAAGAAAGGCACTAGG + Intergenic
980830769 4:138127519-138127541 GTTGGAATAAGTAAGGCCTTGGG + Intergenic
983491677 4:168397412-168397434 CTTTGAATCATTAAAGCATTTGG - Intronic
983573355 4:169233973-169233995 CTGTGAATCAGAATGGCAGTTGG - Intronic
983786581 4:171738820-171738842 CTTTTAATATGAAAGGCAGAAGG - Intergenic
984403261 4:179294557-179294579 CTTTAAACAAATAAGGCAGATGG + Intergenic
984495310 4:180489308-180489330 CTTTGAGAAAATAAGACAGTGGG + Intergenic
985420469 4:189780414-189780436 TTTTGAAAAAAGAAGGCAGTGGG + Intergenic
986991010 5:13553236-13553258 ATTTAAATATCTAAGGCAGTAGG - Intergenic
988440275 5:31225789-31225811 ATTTGAATATGTAACACAGTTGG - Intronic
988773380 5:34453446-34453468 CTCTGAATAAGTAAGGGATTGGG + Intergenic
988816354 5:34838860-34838882 CTTTAAATAAGTAGGGCCGTGGG + Intronic
990131854 5:52595814-52595836 CTTTGAGTAATTAAGTCACTGGG - Intergenic
990920442 5:60959925-60959947 ATTTGTATAAGTAAGGGAGAAGG - Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
995731126 5:115243625-115243647 CTTACAAACAGTAAGGCAGTAGG - Intronic
996067256 5:119092721-119092743 CATAGAGTCAGTAAGGCAGTTGG - Intronic
997460514 5:134048656-134048678 CTTTGAATAATGAGGGCATTGGG - Intergenic
998895312 5:146792668-146792690 CCTTGAAGAAGTAAGGAAATTGG + Intronic
1000888302 5:166773605-166773627 CTTTAAGTTAGTGAGGCAGTAGG - Intergenic
1005355601 6:24980564-24980586 TTGTGAATTAGGAAGGCAGTTGG + Intronic
1005507915 6:26485808-26485830 CCTAGAATAACTAAGGCTGTAGG + Intergenic
1005604912 6:27467104-27467126 ATTTGAACAAGTAAGGTGGTGGG - Intronic
1010666094 6:78631075-78631097 CTTGGTACAAGTAAGGCAGAGGG + Intergenic
1016464387 6:144311005-144311027 CTTAGAAGAGGAAAGGCAGTTGG - Intronic
1020387584 7:7624873-7624895 CTTTGAAAGGCTAAGGCAGTTGG - Intergenic
1021457504 7:20845556-20845578 CTTTGAAGAAGAAAGGGAGCAGG - Intergenic
1023376018 7:39556095-39556117 CTGTTAATAAGTAAGCCAATTGG + Intergenic
1024477952 7:49833847-49833869 CTATCTATAAGTCAGGCAGTGGG + Intronic
1028687687 7:93610865-93610887 ATTTGAATGAACAAGGCAGTAGG + Intronic
1028980130 7:96958683-96958705 GTTTGAATAAAGAAGGCAGGTGG + Intergenic
1035055902 7:156036305-156036327 CTTTGATTTAATAAGGGAGTGGG - Intergenic
1036022793 8:4866098-4866120 CTTTGAATTAGTAGTGCAGTTGG - Intronic
1037437190 8:18875431-18875453 CTTTCAGTAAAGAAGGCAGTAGG + Intronic
1039191377 8:34979981-34980003 CTTTGAATTTGTGAAGCAGTGGG + Intergenic
1040453613 8:47573982-47574004 CTTTGAATTCTTAAAGCAGTAGG - Intronic
1043136418 8:76531948-76531970 CTTTAAATAATTAAAGCAGCTGG + Intergenic
1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG + Intergenic
1045795940 8:106044195-106044217 CTCTGAAAGAGTAAGGAAGTGGG - Intergenic
1047821837 8:128529790-128529812 CTTTGAATAAGTAGAACATTGGG + Intergenic
1048787148 8:138062737-138062759 CTTTGAATGAGCGGGGCAGTTGG + Intergenic
1050190827 9:3024067-3024089 TTTTGAATATGAAAGGCAGTAGG - Intergenic
1052659414 9:31408952-31408974 TTTTGAAGAAGGAAGGCAGCAGG - Intergenic
1052838280 9:33267745-33267767 CTTTGAAGAAGAGAGGAAGTAGG + Intronic
1053695440 9:40635419-40635441 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1053942434 9:43266461-43266483 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1054306686 9:63434642-63434664 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1054405425 9:64758634-64758656 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1054439049 9:65244123-65244145 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1054491357 9:65777819-65777841 CTTTAATTCAGTGAGGCAGTAGG - Intergenic
1055276521 9:74623479-74623501 CTTTGGATTATAAAGGCAGTAGG - Intronic
1055409513 9:76013961-76013983 CTTTGAAGAAAAAAGGAAGTGGG + Intronic
1056233164 9:84567393-84567415 CTTTAAATTAGGAAGGCAGAGGG - Intergenic
1202777884 9_KI270717v1_random:9035-9057 CTTTAATTCAGTGAGGCAGTAGG + Intergenic
1189600594 X:42620942-42620964 CTTTAAATAAATAAGTCAGCAGG - Intergenic
1194759321 X:97775781-97775803 CTGTTAATAAGAAAGGCAGCTGG - Intergenic