ID: 1128894971

View in Genome Browser
Species Human (GRCh38)
Location 15:71364573-71364595
Sequence AGCCCTCTTGAACCCCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128894971_1128894977 15 Left 1128894971 15:71364573-71364595 CCCCTTAGGGGTTCAAGAGGGCT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1128894977 15:71364611-71364633 CCTGTGTGTCAATTCCTAATGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1128894971_1128894975 14 Left 1128894971 15:71364573-71364595 CCCCTTAGGGGTTCAAGAGGGCT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1128894975 15:71364610-71364632 ACCTGTGTGTCAATTCCTAATGG 0: 1
1: 0
2: 0
3: 17
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128894971 Original CRISPR AGCCCTCTTGAACCCCTAAG GGG (reversed) Intronic
900468985 1:2841942-2841964 AGCCGTCTGCAACCCCGAAGAGG + Intergenic
901532769 1:9863864-9863886 AACCCCCTTGACCCCCTCAGCGG - Intronic
902579868 1:17401606-17401628 CGCCAGCTTGAACCCCTATGGGG + Exonic
902834577 1:19038319-19038341 AGCCCTCTTGACCCCCTCCTTGG - Intergenic
903775911 1:25793695-25793717 AGCCCTCTTGTACCCATTTGTGG + Intergenic
908089108 1:60667975-60667997 TGCCCTCTTGAAGACTTAAGGGG - Intergenic
909088094 1:71191750-71191772 AGCTCTCTTGTAACCATAAGAGG + Intergenic
915564899 1:156707742-156707764 AGCCCTCTTGAGCCCCCAGCTGG + Intergenic
917646051 1:177029712-177029734 CGCCTTCTTGAACCCTGAAGGGG - Exonic
1063960331 10:11301323-11301345 AGCCCACTGGAGCCCCTATGCGG + Intronic
1069822266 10:71235303-71235325 AGCCCTTCTGAACCCCTCTGGGG + Intronic
1071873020 10:89815764-89815786 AGCTCTCTTGATCCCTGAAGTGG + Intergenic
1072707044 10:97688059-97688081 AGCCCTCCTGAACCTCCCAGAGG - Intergenic
1075843251 10:125522673-125522695 AGGCCTCTTGAGCCCCTAGATGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1082228856 11:49740695-49740717 ATACCTCTTGAAACCCTAATTGG - Intergenic
1086621211 11:88888427-88888449 ATACCTCTTGAAACCCTAATGGG + Intronic
1090344622 11:126059618-126059640 AGATCTCTTGATCCCCGAAGCGG - Intronic
1091705223 12:2688911-2688933 AGCCCTCCTGCAGCCCTGAGAGG - Intronic
1091781442 12:3216716-3216738 AGCCATGTGGATCCCCTAAGGGG + Intronic
1104993255 12:132638661-132638683 AGCCCTCTTGCAGGCCTCAGAGG - Intronic
1112371233 13:98795447-98795469 AGCCCCCGTGAACCCCTGAAGGG - Intronic
1121279214 14:92687459-92687481 AGGGCTCTTGCAGCCCTAAGGGG + Intronic
1121925287 14:97921679-97921701 AGTCCTCATGATCACCTAAGAGG - Intergenic
1127431117 15:58909560-58909582 ATCCCTCTGCAACCCCTAATTGG + Intronic
1128894971 15:71364573-71364595 AGCCCTCTTGAACCCCTAAGGGG - Intronic
1128944498 15:71811640-71811662 ACCCCTCCAGAACCCCTCAGGGG - Intronic
1129491810 15:75934242-75934264 AGCCATCTTGGACCCTGAAGAGG + Exonic
1133628606 16:7596012-7596034 ATCCCTCTTCAACCCTGAAGTGG - Intronic
1140094403 16:71862518-71862540 AGCCCTCTTCAGAGCCTAAGAGG + Intronic
1141092325 16:81138698-81138720 ATCCCTGGGGAACCCCTAAGGGG - Intergenic
1144791149 17:17860114-17860136 AGCCCTGTTGTGCCCCTATGAGG - Intronic
1147041427 17:37722359-37722381 AGCCTCATTGCACCCCTAAGGGG + Intronic
1148873028 17:50669535-50669557 AGTCCTCTTCCATCCCTAAGAGG + Intronic
1149324905 17:55520037-55520059 CTCCCTCTTGATCCCCTGAGGGG - Intergenic
1153814711 18:8782587-8782609 AACCCTCTGGAAGCCCTATGAGG + Intronic
1161734072 19:5979580-5979602 AGCCCTCTGGAAGCACTGAGTGG - Intergenic
1167812596 19:51847670-51847692 AGCCCTCAACAACCCCGAAGCGG + Intergenic
925254501 2:2471457-2471479 AGACCTCTTGTACTCTTAAGTGG + Intergenic
936461035 2:112713929-112713951 ACTCCTCTTTAACCCCTGAGGGG - Intergenic
937345312 2:121121789-121121811 AGCCCTCATGACCCCCTACAGGG + Intergenic
937678992 2:124624038-124624060 AGCCTTCTGGAAGCCCTATGTGG - Intronic
938382268 2:130843372-130843394 TGCCCTCTTGAACCCTACAGAGG + Intronic
939822566 2:146975882-146975904 AGGCCTCTTGAAATCTTAAGAGG - Intergenic
941554276 2:166956690-166956712 AGCCATCTTGAAACCATGAGAGG - Intronic
943665810 2:190607106-190607128 AGCCCTCGTGAACCCCTTCTTGG - Intergenic
944593320 2:201238688-201238710 AGCACTTTTGAAGCCCAAAGCGG - Intronic
946461032 2:219869178-219869200 AGCCATCTTGAAACCATGAGGGG - Intergenic
948124336 2:235553954-235553976 AGCCCTCCTGGACCCCTTACTGG + Intronic
1172215195 20:33230692-33230714 AGCCCTCCTGCAGCCCTAGGAGG + Intergenic
1172854384 20:37990655-37990677 ATCCCTCTCGAACACCTCAGAGG - Intronic
1173564250 20:44027879-44027901 AGCCTCCATGATCCCCTAAGTGG - Intronic
1177844133 21:26268779-26268801 AGCCACCTAGAACACCTAAGAGG - Intergenic
1178104829 21:29306282-29306304 AGCCATCTTGCAACCATAAGAGG - Intronic
1179300028 21:40099843-40099865 AGCCCTCTTCCACCCATAAGAGG - Intronic
1181966820 22:26662283-26662305 AGGCCTCTTGGACCCCAAAGGGG - Intergenic
951051969 3:18104023-18104045 AGCCCTAATGAACTCATAAGGGG + Intronic
951788519 3:26452461-26452483 CACCCTCCTGAACACCTAAGGGG - Intergenic
953769286 3:45766273-45766295 ATCCCTTTTGAGCCCCTTAGGGG - Intronic
954070850 3:48141817-48141839 AGTCCTCGTGAAACCCTATGAGG - Intergenic
965242738 3:166224770-166224792 TGCCCTTTGGAACCCCTAAGGGG + Intergenic
967459785 3:189732288-189732310 AGCCCCCTTGAAGCCCTGAGAGG + Intronic
972161057 4:36227974-36227996 AGACCTCTGGGACCCCAAAGAGG - Intronic
980004478 4:127525825-127525847 AGCCCTCTTGATTCCCTGAAGGG + Intergenic
980479576 4:133370249-133370271 AGCACTTTGGAAGCCCTAAGTGG - Intergenic
983220585 4:165040087-165040109 AGCCCTGGTGAACCTCCAAGAGG + Exonic
983382244 4:167011138-167011160 AGCTCTCAAGAACCCTTAAGAGG - Intronic
987606625 5:20144166-20144188 TGCCCTCTGGAACCTCAAAGAGG - Intronic
990982863 5:61617256-61617278 TGCCCTCTCAAACCCCTGAGTGG + Intergenic
996390031 5:122950494-122950516 AGCCCTTTTGTACCACTATGGGG - Intronic
997213182 5:132089785-132089807 AGCCCTCTTATACCCCTGAAGGG - Intergenic
998913735 5:146992557-146992579 AGGCCTCTTATACCCCTAATAGG + Intronic
1001204322 5:169747843-169747865 AGCCCTCTTTAATCCCAAAAGGG - Intronic
1006936987 6:37725450-37725472 AGCCCTCTTCAGCCCCTCTGAGG - Intergenic
1042316835 8:67434869-67434891 ACCCCTCCTGACCCCCCAAGTGG + Intronic
1042909345 8:73809430-73809452 ACCCCTCTTAAATCCCTATGAGG - Intronic
1048993495 8:139775015-139775037 AGCCCCTTTGGACCCCTTAGTGG - Intronic
1196574694 X:117304475-117304497 AGCCATCTTGAAGCCATAACTGG - Intergenic
1199533914 X:148880452-148880474 AGCCCTCTTGACTCCTTAAAGGG - Intronic
1199645365 X:149904470-149904492 AGCCTTCTTGTATCTCTAAGGGG + Intergenic