ID: 1128896220

View in Genome Browser
Species Human (GRCh38)
Location 15:71376471-71376493
Sequence CAGAACAAGGGTTGGTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128896220_1128896229 12 Left 1128896220 15:71376471-71376493 CCAGACCACCAACCCTTGTTCTG 0: 1
1: 0
2: 5
3: 13
4: 173
Right 1128896229 15:71376506-71376528 TTTCTGGCCATTCTGTGGTTGGG 0: 1
1: 0
2: 3
3: 27
4: 290
1128896220_1128896228 11 Left 1128896220 15:71376471-71376493 CCAGACCACCAACCCTTGTTCTG 0: 1
1: 0
2: 5
3: 13
4: 173
Right 1128896228 15:71376505-71376527 TTTTCTGGCCATTCTGTGGTTGG 0: 1
1: 0
2: 2
3: 15
4: 293
1128896220_1128896226 7 Left 1128896220 15:71376471-71376493 CCAGACCACCAACCCTTGTTCTG 0: 1
1: 0
2: 5
3: 13
4: 173
Right 1128896226 15:71376501-71376523 ACCTTTTTCTGGCCATTCTGTGG 0: 1
1: 0
2: 5
3: 24
4: 214
1128896220_1128896225 -4 Left 1128896220 15:71376471-71376493 CCAGACCACCAACCCTTGTTCTG 0: 1
1: 0
2: 5
3: 13
4: 173
Right 1128896225 15:71376490-71376512 TCTGACTTGCAACCTTTTTCTGG 0: 1
1: 0
2: 1
3: 14
4: 151
1128896220_1128896231 25 Left 1128896220 15:71376471-71376493 CCAGACCACCAACCCTTGTTCTG 0: 1
1: 0
2: 5
3: 13
4: 173
Right 1128896231 15:71376519-71376541 TGTGGTTGGGTCAGATCATTTGG 0: 1
1: 0
2: 0
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128896220 Original CRISPR CAGAACAAGGGTTGGTGGTC TGG (reversed) Intronic
900482292 1:2905121-2905143 CACACCAAGGGTGGGTGGGCGGG + Intergenic
904031802 1:27537693-27537715 CAGAACAGTGGTTGGTGTGCTGG - Intronic
905353066 1:37360730-37360752 GAGAACAAGTGCTGGTGGTGTGG - Intergenic
905460206 1:38117637-38117659 CTGACCAAGGGTTGGTGGGTGGG + Intergenic
906568604 1:46817935-46817957 CAGAACAGAGGTTGGTGACCAGG - Intronic
907468156 1:54653208-54653230 CAGAACAAGAACTGGTGATCTGG - Exonic
909800319 1:79797772-79797794 CATAACAATGCTTGCTGGTCTGG + Intergenic
912427546 1:109608079-109608101 CAAACCAAGGGAAGGTGGTCAGG - Exonic
912940345 1:114039315-114039337 CAGGATGAGGGTTGGTGGTTGGG + Intergenic
915160257 1:153914478-153914500 CAGAACAAGGGTTGGAGCCTTGG - Intronic
915204488 1:154260007-154260029 CAGAATAAGGGTTGCTGGCCAGG - Exonic
915571555 1:156747633-156747655 CAGAACCAGGGGTGGGGGTGGGG + Intronic
924110293 1:240692154-240692176 CAGAACAAGAGATGGAGGACGGG + Intergenic
924284451 1:242471236-242471258 CAGAACAAGGTTTGGGGCTGGGG - Intronic
1065852100 10:29799202-29799224 CTTAACAGGGGTTGATGGTCTGG + Intergenic
1066381506 10:34905796-34905818 CTGAACAAGCTTTGGTGGTGAGG - Intergenic
1067724669 10:48761067-48761089 TAGATAAAGGGTTGGAGGTCAGG + Intronic
1068682924 10:59839457-59839479 CAAAACAACGGTTGGGGGTGGGG + Intronic
1069282838 10:66677149-66677171 CAGAATAAGGGTTCCTGATCTGG - Intronic
1069675062 10:70240497-70240519 CAGAACAGGAGCTGGAGGTCAGG + Intergenic
1069952546 10:72029498-72029520 CAGAACATTGGTTGGTAGGCTGG - Intergenic
1070166001 10:73898521-73898543 AAGAAAAAGTGTTGGTGGTCGGG - Intergenic
1070794082 10:79206983-79207005 CAGAACATGACTTGGTGGTGGGG - Intronic
1072760520 10:98052509-98052531 AAGAACATGGCTTGGGGGTCGGG + Intergenic
1074266221 10:111906135-111906157 TAGAACAATGGTTGGTGATATGG - Intergenic
1079814151 11:25034077-25034099 AAAAACAAGGGATGGTGGTGAGG - Intronic
1082953841 11:58847537-58847559 GAGAACACTGGTTGGTAGTCTGG + Intronic
1084422131 11:69065750-69065772 AAGAACCAGGGTTGGTGTTGGGG + Intronic
1091008682 11:131978032-131978054 CAGAAGAAGGCTCTGTGGTCAGG + Intronic
1094289428 12:28830513-28830535 CATATCAATGGTTGCTGGTCTGG - Intergenic
1098450995 12:70617843-70617865 CGGAGCAAGGGTGGGTGGGCAGG + Intronic
1098462784 12:70751319-70751341 TAGAACAGGGGTGGGTGGTGGGG - Intronic
1103208441 12:119148976-119148998 CAGATCAAGGTTTGGGGCTCTGG + Intronic
1103257099 12:119550978-119551000 CAGAAGGAGGGTTGGAGGTGGGG + Intergenic
1103851954 12:123939115-123939137 CAGAACAAGAGGTGGTGGCTTGG - Intronic
1104947994 12:132425592-132425614 CAGCACCAGGGTGGGTGCTCAGG - Intergenic
1106272744 13:28170114-28170136 CAAAACAAGGGTAGGTGGCAAGG - Intronic
1106941779 13:34788024-34788046 AAGAATAAGGATTGTTGGTCTGG + Intergenic
1112738181 13:102444049-102444071 TATAACAAGGGTTGGTTTTCTGG - Intergenic
1113146315 13:107211973-107211995 CAGAACATGGGTTTGAAGTCTGG - Intronic
1114532519 14:23404664-23404686 CAGAACAGGGGTTGGGGGGCAGG - Intronic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1118750621 14:68805612-68805634 CAGAGCCAGGGTTGGTGTGCAGG - Intergenic
1119162603 14:72465523-72465545 CATAGCAAGGGTGGGTGGGCGGG + Intronic
1120849232 14:89154567-89154589 CAAAACCAGGGTTTGTGGGCTGG - Intronic
1122165219 14:99818098-99818120 CAGTACAAGAGTTGGGGGTGGGG + Intronic
1122693318 14:103541591-103541613 CAGAACAGGGCTTGGAGTTCTGG + Intergenic
1126817749 15:52470725-52470747 CAGAAAAAGGGTTCTTGGCCGGG + Intronic
1127830467 15:62745970-62745992 CAGACTAAGGGTTTGTGGTTGGG - Intronic
1128381416 15:67115855-67115877 TTGAGCAAGGGGTGGTGGTCTGG + Intronic
1128896220 15:71376471-71376493 CAGAACAAGGGTTGGTGGTCTGG - Intronic
1128897204 15:71385849-71385871 CAGATCAAGAGATGGGGGTCCGG + Intronic
1129151329 15:73689824-73689846 CACAGCATGGGATGGTGGTCAGG + Intronic
1129413905 15:75364278-75364300 GGGAAAAAGGGTTGGGGGTCAGG - Intronic
1130077745 15:80704362-80704384 CAGAACAAGGCTAGGTGGGGTGG - Intronic
1130299180 15:82667072-82667094 CAGAACAAGGGCAGGTGGGGAGG - Intronic
1132788373 16:1670836-1670858 TGGCACGAGGGTTGGTGGTCAGG - Intronic
1134013403 16:10871715-10871737 CAGAACAGGGGCTGGTTCTCAGG - Intergenic
1138548526 16:57734665-57734687 CAGAACAAGGGTTCGAATTCTGG + Intergenic
1139470862 16:67177494-67177516 CTGCAGAAGGGATGGTGGTCTGG - Intronic
1141433009 16:83980619-83980641 CAGAACAAGGGTGGGTGGTGTGG + Intronic
1144619688 17:16809545-16809567 CAGAACATGGGTTTGAGGTCAGG + Intergenic
1144892997 17:18506159-18506181 CAGAACATGGGTTTGAGGTCAGG - Intergenic
1145139220 17:20438133-20438155 CAGAACATGGGTTTGAGGTCAGG + Intergenic
1147511448 17:41072355-41072377 TTGAACCAGGGCTGGTGGTCAGG - Intergenic
1149368453 17:55968858-55968880 AAGAACCAGGTTTGGTGTTCAGG + Intergenic
1149784917 17:59426478-59426500 AAGAAAAAGGATTGGAGGTCAGG + Intergenic
1150645260 17:66973856-66973878 CAGAACAAGAATTGGGGGACGGG - Intronic
1151925504 17:77192955-77192977 AAGAACCAGGGATGGGGGTCAGG - Intronic
1154254155 18:12768204-12768226 TAGAACAAGGGGTGGTGGTCAGG - Intergenic
1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG + Intergenic
1157354555 18:46920410-46920432 CACAAGAAGGGTTGGTTCTCAGG - Intronic
1162018142 19:7856666-7856688 CAGAACAAGGCTTTGGGGTGAGG - Intronic
1162302148 19:9850130-9850152 CTGAACAGGGGATGGGGGTCAGG - Intergenic
1163289199 19:16368116-16368138 CAAAACAAGGGTTTGTGGTCAGG + Intronic
1163411377 19:17156977-17156999 GAGAGGAAGGGTTGGAGGTCGGG + Exonic
1163554270 19:17983516-17983538 CAGAACTAGGGTTAGGGGTATGG + Intronic
1163753193 19:19090900-19090922 GAGAACAAGGGATGGGGTTCGGG - Intronic
1164414390 19:28034340-28034362 AAGAACAAGGTTTCGTGGCCAGG + Intergenic
1164732583 19:30517454-30517476 AAGAGCAAGGGTTGATGGGCTGG - Intronic
1165466635 19:35978687-35978709 GAGAGGAAGGGTTGGTGGTGAGG - Intergenic
1165786260 19:38463652-38463674 CAGAACTAGGGTTGGAGGTCAGG + Intronic
1166127721 19:40725660-40725682 CAGAACTAGGGTTTGAGCTCAGG - Intronic
1166540028 19:43599069-43599091 CAGGACAAGGGAAGGTGGGCTGG - Exonic
1168152913 19:54458612-54458634 CAGGACAAGGGTTGGGGGCTGGG - Intronic
926249766 2:11147913-11147935 CAGAACAAGGGAGGGTGGATGGG + Intergenic
927504174 2:23602512-23602534 CACAACAGGGGTAGGGGGTCAGG + Intronic
927801400 2:26103165-26103187 CAGAACATGGGTTTGGGGTCAGG - Intronic
929810240 2:45183550-45183572 CAGAAAAAGAGTGGCTGGTCTGG - Intergenic
930022712 2:47011234-47011256 CAGAGCAAGGCTTGGTTGTTTGG + Intronic
932414202 2:71564035-71564057 CTGAACAGAGGGTGGTGGTCGGG - Intronic
932471405 2:71961882-71961904 CAGAGGCAGGGTTGGTGGGCAGG - Intergenic
932612938 2:73213198-73213220 CAAAACAAGGCTTGATAGTCAGG + Intergenic
934045817 2:88171662-88171684 CAGAACCAGGGTCGGGGGGCAGG - Exonic
934153336 2:89171273-89171295 CAGAACAGGGGGTTGTGCTCTGG + Intergenic
934213899 2:90010658-90010680 CAGAACAGGGGGTTGTGCTCTGG - Intergenic
938555610 2:132421050-132421072 CAGAACAGAGGTTGCTGGTCTGG + Intronic
940024047 2:149186295-149186317 CAGAAAAAGTGTGAGTGGTCTGG + Intronic
941377163 2:164746097-164746119 GAGAACAAGGATTTTTGGTCTGG - Intronic
942091437 2:172495406-172495428 CAGAACAAGGCTTGGAGCTCTGG + Intronic
942310094 2:174648248-174648270 CAGAAATAAGGTTGGTGCTCTGG + Intronic
948953249 2:241268923-241268945 CAGAAGAAGGGTTGTTGTGCTGG + Intronic
1170776316 20:19377773-19377795 CAGGAAAAGGCTGGGTGGTCAGG - Intronic
1171405384 20:24909368-24909390 CAGGACAAGGGTGGGTGGCAAGG + Intergenic
1172037148 20:32018645-32018667 CTGAACAGAGGGTGGTGGTCAGG - Intronic
1173331674 20:42080566-42080588 CAGAACAAAAGCAGGTGGTCTGG + Exonic
1174529703 20:51201200-51201222 CAGAAAATGGATTGGTGGTCAGG - Intergenic
1175158955 20:56993954-56993976 CAGAACATGGGATGGGGCTCTGG - Intergenic
1175160385 20:57003763-57003785 CAGAGCAAGGGCAGGAGGTCAGG - Intergenic
1175633204 20:60559392-60559414 CAGAAGAAGATCTGGTGGTCAGG - Intergenic
1175961962 20:62641996-62642018 CAGAACAGGGCCTGGGGGTCAGG + Exonic
1176193923 20:63828175-63828197 CAGACCCAGGCTTGGTGTTCTGG - Intronic
1178595763 21:33951098-33951120 AAGAACAAGGGCTGGTGAACAGG - Intergenic
1179410524 21:41159556-41159578 CAGAAGTGGGGTTGGGGGTCAGG - Intergenic
1183522852 22:38305879-38305901 CAGAAGCGGGGTTGCTGGTCAGG - Intronic
1184409110 22:44316396-44316418 CAGAACCAGGGTGGGGGGTGGGG + Intergenic
1184904341 22:47470181-47470203 CACAATAAGTGTTGGTGATCTGG + Intronic
949386615 3:3509723-3509745 TAGAATAAGGGATGGTGGTGGGG + Intergenic
949973659 3:9434330-9434352 CAGAACGAGGGATGATCGTCTGG - Exonic
955319274 3:57962550-57962572 AGGAACAACGGTTGCTGGTCAGG + Intergenic
956154356 3:66279352-66279374 CAGACCAGGGCTTTGTGGTCAGG + Intronic
956897640 3:73679676-73679698 TAGAACAAGGGTTGGTGGCTGGG - Intergenic
959567531 3:107847942-107847964 CAGAGCAAGGCCAGGTGGTCTGG + Intergenic
960740182 3:120824727-120824749 CAGAAGAAAGGCTGCTGGTCTGG - Intergenic
961717804 3:128870615-128870637 CAGGACAAGGGTTGGTAGCAGGG + Intergenic
961857305 3:129885324-129885346 CAGAACAAAGCTTTGGGGTCAGG + Intronic
963009882 3:140759171-140759193 CAGAACACGGGCTGGTTCTCAGG + Intergenic
963245578 3:143057164-143057186 CAGAACATGGGTTGGATGTATGG - Exonic
966261337 3:177982907-177982929 GAGGACAAGGATTGGTGGGCAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967770786 3:193331437-193331459 CAGGAAAGGGGTTGGTGGACTGG - Intronic
967941493 3:194769737-194769759 CAGAACAAGAGTAGATGGTTCGG + Intergenic
968267229 3:197371471-197371493 CAGAGGAAGGGTTGGTAGACAGG + Intergenic
969677036 4:8619946-8619968 CAGTTCAAGGCCTGGTGGTCTGG - Intergenic
971808361 4:31390888-31390910 TAGAACAAGGGCTTTTGGTCTGG - Intergenic
974455196 4:62121578-62121600 AAAAGCAAGGATTGGTGGTCAGG + Intergenic
980325089 4:131333183-131333205 CAGAACAAGGGCTGCTGCTGTGG - Intergenic
980875135 4:138654240-138654262 CAGAACAAGAGTTAGGGCTCAGG - Intergenic
981874295 4:149521962-149521984 CAGAATAAGGGGTGGTGTTTTGG - Intergenic
984731122 4:183069118-183069140 CAGTACAAGGGGTGGTGGCTGGG - Intergenic
986300162 5:6472124-6472146 CAGAACTTGGGCTGGTGGGCCGG + Intronic
994665723 5:102702973-102702995 CAGATAAAGTGTTGGTGGTTGGG + Intergenic
995440125 5:112182082-112182104 CAGAACAGTGGTTGGTTGTGGGG + Intronic
996873554 5:128217224-128217246 CAGGCCAAGGGTTTGTGGCCTGG + Intergenic
997428285 5:133819348-133819370 CAGACAGAGGCTTGGTGGTCCGG - Intergenic
997517908 5:134503932-134503954 CAGAACTGGGGTGGCTGGTCAGG - Intergenic
1004569021 6:16827146-16827168 CAGAAGAAGTGTCGGTGGTCAGG - Intergenic
1005593406 6:27352347-27352369 CAGAAAAAGTGTTGGTGGAAGGG + Intergenic
1007925053 6:45643670-45643692 CAGAACAAGGGTTGGAGGACTGG - Intronic
1010275496 6:73964081-73964103 CAGAATAAGTGATGGTGGTGGGG + Intergenic
1010977358 6:82330842-82330864 CAGAACAAGTGTTTGTGGATAGG - Intergenic
1014246274 6:119073176-119073198 CCCAACAAGGGTAGCTGGTCAGG + Intronic
1014816745 6:125943901-125943923 AAGAACAAGAGTTAGTGGTGTGG + Intergenic
1015893685 6:137995684-137995706 CAGAGCAATGGTTGGTAGGCAGG - Intergenic
1016558758 6:145370519-145370541 CAGAATCAGGCTTAGTGGTCTGG - Intergenic
1017378362 6:153797542-153797564 CAGAGCCAGGGGTGGTGGCCTGG + Intergenic
1022390616 7:29940774-29940796 CAGAGCCAAGGTTGGTGGACGGG - Exonic
1023852996 7:44160532-44160554 CAGGACAAGGGTGGGTGCCCAGG - Intronic
1024599663 7:50969630-50969652 CAGAAGAAGGTTTGGAGGTGGGG - Intergenic
1026174400 7:67983279-67983301 CAGAAAGAGGGTTGGTCTTCTGG + Intergenic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1029033072 7:97489200-97489222 CAAAACAGGAGTTGGTGGTGGGG - Intergenic
1037567317 8:20128721-20128743 CAGAAGAAGGTTTGGTAGCCAGG - Intergenic
1038249565 8:25890485-25890507 CAGAACATGGGTTTGGAGTCAGG + Intronic
1042146347 8:65734149-65734171 CAGAACAAGTTTTGGGGGTAAGG - Intronic
1042243940 8:66692285-66692307 AAGAACAGAGGTTGGTGGTAGGG + Intronic
1045855780 8:106763809-106763831 CAGAACTACAGTTGGTGCTCAGG - Intronic
1047492839 8:125388621-125388643 CAGAACAAGGCTTTGGGGGCTGG + Intergenic
1047507815 8:125493878-125493900 CAGAAGAAGTGTTTCTGGTCCGG + Intergenic
1047753315 8:127898969-127898991 AAGAACAGCTGTTGGTGGTCAGG + Intergenic
1049445898 8:142631336-142631358 CAGAACAAGGGTGGAGGGCCTGG + Intergenic
1052768456 9:32665715-32665737 CAGAACCAGAGTTGGTGGGGAGG + Intergenic
1053045782 9:34915924-34915946 CAGCACCAGGGTTGGTGGTGGGG - Intergenic
1053268386 9:36732688-36732710 GAGAACAGGGGTTGTGGGTCTGG + Intergenic
1054770525 9:69079110-69079132 CAGAAGAATGGTTGGAGGTGGGG + Intronic
1057303784 9:93901146-93901168 CAGAACAAGGTTGGTGGGTCAGG - Intergenic
1057834355 9:98432300-98432322 GAGAAAAAGGGGTGGTGGTTGGG + Intronic
1060194805 9:121616759-121616781 CAGACCAAAGGTTGATGGTGAGG - Intronic
1060817142 9:126640939-126640961 CAGAACAATTGCTGGTAGTCTGG - Intronic
1061170292 9:128948584-128948606 CAGAAGGAGGCGTGGTGGTCTGG - Intronic
1061236342 9:129344770-129344792 AAGAACAAGGGCTGGTGGGGAGG + Intergenic
1061580863 9:131535108-131535130 CTAAACAAGGTTTGGTGGTGTGG + Intergenic
1061770703 9:132918621-132918643 GTGAGGAAGGGTTGGTGGTCTGG - Intronic
1062630445 9:137460891-137460913 CAGAACCAGGGGTGGTGTGCAGG - Intronic
1186406256 X:9306268-9306290 AAGGACTAGGGTTGGTGGTTTGG + Intergenic
1186600338 X:11030066-11030088 CAGAACAAAGTTTGGGGATCTGG + Intergenic
1186709711 X:12180829-12180851 CAGAACAGAAGATGGTGGTCTGG + Intronic
1186822820 X:13308711-13308733 AAGAACAAGGGTTGCTGTGCAGG - Intergenic
1189893317 X:45628286-45628308 CAGAACATAGAATGGTGGTCAGG + Intergenic
1195161084 X:102172511-102172533 CAGAACTAGGGTTAGAAGTCGGG + Intergenic
1199965907 X:152820783-152820805 CATAACAAGGGATAATGGTCAGG + Intergenic
1201017476 Y:9620945-9620967 CAGATGAAGGGTTTGTGGTAAGG - Intergenic