ID: 1128896415

View in Genome Browser
Species Human (GRCh38)
Location 15:71377599-71377621
Sequence GAGGATAAGGAGAAAGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2484
Summary {0: 1, 1: 0, 2: 14, 3: 320, 4: 2149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128896415 Original CRISPR GAGGATAAGGAGAAAGAGGG CGG Intronic
Too many off-targets to display for this crispr