ID: 1128896774

View in Genome Browser
Species Human (GRCh38)
Location 15:71381029-71381051
Sequence CTTGTCAAGCCCATAATCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 12, 3: 35, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128896774 Original CRISPR CTTGTCAAGCCCATAATCCT AGG (reversed) Intronic
902333023 1:15739881-15739903 CTTGTCAAGCGCATAGGTCTAGG - Exonic
908732712 1:67242949-67242971 CTTGTCAAACCCATATTCCTGGG - Intronic
909575969 1:77176967-77176989 TTTGTCAAACCCATATTCATGGG + Intronic
919167388 1:193912720-193912742 CTAGTCAAGCCCATAATGGCTGG - Intergenic
920157380 1:203965269-203965291 TTTGTCAAACCCAAATTCCTGGG - Intergenic
920321661 1:205128322-205128344 TTTGTTAAACCCATAATCCTGGG + Intergenic
922405492 1:225308627-225308649 CTTGAGAAACCCACAATCCTAGG + Intronic
923281789 1:232449928-232449950 CTTGTCAAATCCATAGTACTTGG + Intronic
923511231 1:234655591-234655613 CTTGCCCAGCCCAGAATGCTGGG - Intergenic
1063045574 10:2388660-2388682 CTTGTAAAATCCAAAATCCTGGG + Intergenic
1064834669 10:19512747-19512769 TTTGTCAAATCCATAATTCTGGG - Intronic
1064903922 10:20323885-20323907 TTTGTCAAATCCATAATCTTGGG - Intergenic
1067443055 10:46322526-46322548 TTTATCAAACTCATAATCCTGGG - Intronic
1069643750 10:69975614-69975636 CTGTTCAAGCTCAGAATCCTTGG - Intergenic
1069757182 10:70780460-70780482 CTTCTCAACCTCTTAATCCTGGG + Intronic
1073677875 10:105669743-105669765 TTTATCAAACCCATATTCCTGGG - Intergenic
1076602125 10:131664071-131664093 CTTGTCAAACCCATTGTCCTTGG - Intergenic
1077312960 11:1899951-1899973 TCTGCCAAACCCATAATCCTGGG - Intergenic
1082689244 11:56279680-56279702 TTTGTCAAACCCATATTCCTAGG + Intergenic
1083011766 11:59408152-59408174 TTTGTCAAACCCATATTCCTGGG + Intergenic
1083895468 11:65617726-65617748 CTGGTCTAGCCCACAAGCCTCGG - Intronic
1086193530 11:84109327-84109349 CCAGGAAAGCCCATAATCCTAGG - Intronic
1087155691 11:94900002-94900024 CTTGTCTTGTCCATAATCTTAGG - Intergenic
1087539513 11:99497651-99497673 ATTTTCAAGCTCATAATCTTAGG - Intronic
1089326503 11:117661133-117661155 CTTGGAAAACCCAGAATCCTAGG + Intronic
1091780778 12:3213397-3213419 CTTGTCAGGCCGATAAGCCTGGG + Intronic
1094273232 12:28640525-28640547 CTTGTTAAACACATACTCCTAGG + Intergenic
1094351121 12:29526107-29526129 GTGGTCAAACTCATAATCCTGGG - Intronic
1096847235 12:54414027-54414049 CTTGTAAAGCCCACAAGCCAGGG + Intronic
1098004984 12:65986677-65986699 TTTGTCAAACCCATATTCCTGGG - Intergenic
1098294337 12:68989188-68989210 TTTGTTAAACCCATATTCCTGGG + Intergenic
1100159268 12:91838788-91838810 TTTGTCAAACCCATAATCCTGGG - Intergenic
1105961823 13:25348833-25348855 CATGTCAAGCCGATACTCATTGG + Intronic
1107255566 13:38422207-38422229 TTTGTCAAACCCATATTCCTGGG - Intergenic
1116310260 14:43316645-43316667 TTTGTCAAACTCATATTCCTGGG + Intergenic
1116483848 14:45423250-45423272 TTTGTCAAACTCATATTCCTGGG + Intergenic
1117490901 14:56246631-56246653 CATGTCAAGCCCATACTTCCTGG - Intronic
1120141948 14:80939492-80939514 CTAGTCAAGCCGATGATCTTTGG + Exonic
1120587507 14:86331653-86331675 CTTACCAAGCTAATAATCCTTGG - Intergenic
1125296690 15:38211098-38211120 CGTGCCAAGCACATAAGCCTTGG + Intergenic
1126208221 15:46070518-46070540 TTTGCTAAACCCATAATCCTGGG - Intergenic
1128896774 15:71381029-71381051 CTTGTCAAGCCCATAATCCTAGG - Intronic
1129603719 15:77014631-77014653 CTTTTCACGCCCATAACTCTTGG - Intronic
1132085252 15:98903290-98903312 CTTTTCAAGGCAACAATCCTTGG - Intronic
1142850937 17:2704467-2704489 CTCGTCAAGCCCATTTTCCCTGG + Exonic
1144239664 17:13297878-13297900 CTTGCCAAGCAAATAATTCTGGG - Intergenic
1144426603 17:15148684-15148706 TTTGTCGATCCCATATTCCTGGG + Intergenic
1146444725 17:32924266-32924288 TTTGTCAAATCCATATTCCTGGG + Intergenic
1147463671 17:40593286-40593308 TTTGTCAAACCCATAATTCTTGG + Intergenic
1149001170 17:51759118-51759140 CTTGTCAAGCCCCTCATTGTTGG + Intronic
1151285093 17:73105066-73105088 CTTGTCCAGCCAACATTCCTTGG - Intergenic
1151858780 17:76742900-76742922 CTTGTCAAGGCCAAAATTTTAGG - Intronic
1153118255 18:1687318-1687340 TTTGTCAAACCCATATTCCTGGG - Intergenic
1154510345 18:15093592-15093614 CTTGTCAGTTACATAATCCTGGG + Intergenic
1155464753 18:26121925-26121947 CTTTACAAGCCCATATTTCTTGG - Intergenic
1163490036 19:17612009-17612031 CTTGGGAAGCCAAGAATCCTGGG + Intronic
1165585466 19:36911477-36911499 CTGGTCATGCCTATAATCCCAGG - Intronic
925082470 2:1081147-1081169 ATTGTCAAGCCCACACGCCTGGG + Intronic
925396508 2:3537046-3537068 CATGTCAAACCCCTAATCCCTGG - Intronic
926743386 2:16130519-16130541 CTTTTCAACACTATAATCCTTGG - Intergenic
926981482 2:18576229-18576251 TTTGTCGAGCCCATGCTCCTTGG + Exonic
927772917 2:25878984-25879006 CTTGCCAAGCTCATAAGTCTGGG + Intergenic
928792000 2:34968626-34968648 TTTGTCATTCCCAAAATCCTAGG - Intergenic
931492328 2:62762011-62762033 CTTCTCAAACTCATACTCCTGGG + Intronic
932405713 2:71511695-71511717 CTTGTCAGAGCCATATTCCTTGG + Intronic
932877162 2:75464866-75464888 ATTATCATGCCAATAATCCTTGG - Intergenic
932936449 2:76108912-76108934 CTTGTAAAGCCTACAATCCAAGG - Intergenic
933736094 2:85495624-85495646 TTTGTCAAATCCATAATCCTGGG + Intergenic
935850988 2:107218503-107218525 TTTGTCAAACCCATAATCCTGGG + Intergenic
937071262 2:119065491-119065513 GTTCTCAAGCCAAAAATCCTGGG + Intergenic
938505562 2:131878041-131878063 CTTGTCAGTTACATAATCCTGGG + Intergenic
943372867 2:187037399-187037421 TTTGTCAAACCCATAATCCAGGG - Intergenic
945503019 2:210601483-210601505 CTTGTCAATCAAATAATCCCAGG + Intronic
946296933 2:218791999-218792021 TTTGTCAAACCCATATTCCTGGG - Intronic
948015659 2:234688569-234688591 CTTGTGAAGCCCACAGTCCAAGG - Intergenic
1170032967 20:11961452-11961474 CTTGTCAAACCCAGACACCTGGG + Intergenic
1170464534 20:16610736-16610758 TTTCTCAAGCCCCTATTCCTGGG + Intergenic
1170633184 20:18082612-18082634 CTTGTAAAGCCCAGATTTCTGGG - Intergenic
1173491013 20:43481636-43481658 TTTGTTAAACCTATAATCCTGGG - Intergenic
1177574838 21:22939213-22939235 ATTATCTAGCCCACAATCCTAGG + Intergenic
1177843152 21:26256950-26256972 CTTGTTAAACCCAGATTCCTGGG - Intergenic
1177986690 21:27984311-27984333 CTTGTCAGTTACATAATCCTGGG - Intergenic
1178847459 21:36185596-36185618 CTTGTGAAGCCCACACTCCAGGG + Intronic
1180377099 22:12103974-12103996 TTTGTCAAACCTATATTCCTAGG - Intergenic
951077240 3:18410110-18410132 CATATCAAGCCCCTAATCATGGG - Intronic
951448560 3:22811007-22811029 TTTGCCAAACCCATAAGCCTTGG - Intergenic
952578539 3:34803933-34803955 CTTGTCAAACTCATAATCCTGGG + Intergenic
953557053 3:43954197-43954219 GTGGTCAAGCCCATATTCCAGGG + Intergenic
954980906 3:54744580-54744602 ACTGTCAACCCCATTATCCTTGG + Intronic
957095801 3:75776300-75776322 TTTGTCAAACCTATATTCCTAGG + Intronic
958898716 3:99860629-99860651 CTTTTCTAGCCCAGAATCATGGG - Intronic
961337471 3:126190291-126190313 TTTGTCAAACCCATAATCCTGGG - Intronic
961344435 3:126254141-126254163 TTTGTCAAATCCATATTCCTGGG + Intergenic
961819786 3:129570137-129570159 CTTGTCAAGCCCTTGGTCCTGGG + Intronic
962848877 3:139293161-139293183 CTTGTCAAAACAATCATCCTGGG + Intronic
963914664 3:150847301-150847323 TTTGTCAAACTCATATTCCTGGG - Intergenic
963979064 3:151515805-151515827 TTTGTCAAGCCCAAAATCCTGGG + Intergenic
965096149 3:164228540-164228562 TTTGTCAAACCCATATTCCATGG - Intergenic
965705015 3:171497604-171497626 CGGCTCAAGCCCATAATCCATGG - Intergenic
970349516 4:15187920-15187942 TTCATCAAGCCAATAATCCTAGG + Intergenic
972063620 4:34911486-34911508 CTAATCAAGCCCTTAATCTTGGG + Intergenic
973557398 4:52098444-52098466 TTTATTAAGCCTATAATCCTAGG + Intergenic
973830273 4:54752426-54752448 CTTCTCATGCCCATAAAACTAGG + Intergenic
975539328 4:75489208-75489230 TTTGTCGAAACCATAATCCTGGG + Intronic
976807899 4:89068848-89068870 GTTGTCAAACTCATAATCCAGGG + Intronic
977838754 4:101675901-101675923 TTTGTCAAACCCATATTCCTGGG + Intronic
979170192 4:117592013-117592035 TTTGTCAAATCCATATTCCTGGG - Intergenic
979217939 4:118188192-118188214 TTTGTTAAACCCATATTCCTAGG - Intronic
979620507 4:122793824-122793846 TTTGTTGAACCCATAATCCTGGG + Intergenic
980565003 4:134528144-134528166 TTTATCAAACTCATAATCCTAGG - Intergenic
982499196 4:156131716-156131738 CTTGACCAGTCCATAATCCTGGG - Intergenic
985198968 4:187464139-187464161 CTTGTCACGCAGAAAATCCTTGG + Intergenic
1202758704 4_GL000008v2_random:89441-89463 TTTGTCAAACCTATATTCCTAGG - Intergenic
987394494 5:17409502-17409524 CTTGACATGCCCATAATTGTGGG + Intergenic
987659207 5:20850628-20850650 TTTGTCAAACCCATAATCCTGGG + Intergenic
988764461 5:34355353-34355375 TTTGTCAAACACATAATCCTGGG - Intergenic
989093744 5:37761133-37761155 ATTGTCAAACCCATATTCCTAGG - Intergenic
989093749 5:37761192-37761214 TTTGTCAAACCCACATTCCTGGG - Intergenic
990081940 5:51927701-51927723 TTTGTCAAACCCATATTCCTGGG + Intergenic
991202908 5:64014905-64014927 CTTGCAAATACCATAATCCTGGG + Intergenic
993807164 5:92425195-92425217 TTTGTCAAACCAATATTCCTGGG - Intergenic
994467732 5:100159844-100159866 TTTGTCAAGCACATATTCCTGGG - Intergenic
996113689 5:119595106-119595128 TTTGTCAAACTTATAATCCTGGG + Intronic
996645608 5:125812188-125812210 TTTCTCAAGCCCTTTATCCTTGG + Intergenic
997409281 5:133678810-133678832 CTTCTCCAGGCCTTAATCCTGGG - Intergenic
999714443 5:154348734-154348756 CTTGTCAAGCTTTAAATCCTAGG + Intronic
1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG + Intronic
1002023065 5:176377637-176377659 TTTGTCAAACCCATAATCCAGGG - Exonic
1002791896 6:443118-443140 CTTGTTAAGAACATATTCCTTGG - Intergenic
1006290753 6:33134473-33134495 TTTGCCAAACCCATATTCCTGGG - Intergenic
1006924114 6:37644759-37644781 CTTTTGAAGCCCGGAATCCTGGG - Intronic
1006972103 6:38056570-38056592 CTTCACAAGCCCATTAACCTGGG - Intronic
1007339924 6:41184919-41184941 CCAGTCAAGTCCATCATCCTGGG - Intergenic
1009405136 6:63303155-63303177 TTTGTCAAATCCATAATCCTAGG + Intronic
1011123655 6:83983071-83983093 TTTGTGAAACCCATATTCCTTGG + Intergenic
1011341790 6:86324036-86324058 TTTGTCAAACCCATATTCCTGGG + Intergenic
1011357194 6:86483889-86483911 TTTTTCAAACCCATAATCCTGGG + Intergenic
1013318964 6:108967939-108967961 CTTCTCAAGCCCACAGTCGTAGG + Intronic
1014835134 6:126152480-126152502 CTTGTAATGCTAATAATCCTTGG - Intergenic
1017386337 6:153889104-153889126 TTTGTCAAACCCATAACACTGGG + Intergenic
1019270884 7:148069-148091 TTTGTCAAACCCATACTCCTGGG - Intergenic
1020647150 7:10828714-10828736 TTTGTCAAACCCATATTCCTGGG + Intergenic
1022862290 7:34380032-34380054 TTTGTCAAACCCATAATCCTAGG - Intergenic
1023773872 7:43584439-43584461 CTTGTCAAGCGCATACCACTGGG + Intronic
1026465522 7:70650280-70650302 CTTGGCAATCCCATTATTCTTGG - Intronic
1027978568 7:85187451-85187473 CTTGTCAAGGCCATTAACCGTGG - Intergenic
1028696337 7:93717527-93717549 CTTGCAAAGCCCTTAAACCTAGG + Intronic
1029016630 7:97321461-97321483 TTTGTCAAACTCATAATCCTGGG - Intergenic
1029900406 7:104033348-104033370 TTTGTCAAACCTATAATCCTGGG - Intergenic
1033250714 7:139756191-139756213 ATTGTCAATCTCAAAATCCTTGG + Intronic
1038301229 8:26351170-26351192 CTTTTCAACCCCAAAATCCAGGG + Intronic
1042159431 8:65877495-65877517 CTTGTCAAACCCATATTCCTGGG + Intergenic
1042720148 8:71818867-71818889 CTTGTCAACCCAAAAATCCTGGG + Intergenic
1043827010 8:84941487-84941509 TTTGTCAAACCCATATTCCTGGG + Intergenic
1046202661 8:110947654-110947676 TTTGTCAAACCCATATTCCTAGG - Intergenic
1046910030 8:119615866-119615888 ATTGTCACCACCATAATCCTAGG + Intronic
1060492236 9:124093414-124093436 TTTGTAAAGCCCATACTCCTTGG - Intergenic
1061817535 9:133205871-133205893 CTGGACAAGCCCAGAGTCCTGGG - Intronic
1062242870 9:135549355-135549377 CTGGACAAGCCCAGAGTCCTGGG + Intronic
1203752301 Un_GL000218v1:91278-91300 TTTGTCAAACCTATATTCCTAGG + Intergenic
1203539496 Un_KI270743v1:74349-74371 TTTGTCAAACCTATATTCCTAGG - Intergenic
1188802992 X:34554744-34554766 TTTGTCAAACCCATATTCCTGGG + Intergenic
1189001556 X:36953205-36953227 TTTGTCAAACCCATATTCTTGGG + Intergenic
1189416051 X:40814469-40814491 TTTGTCAAATCCATATTCCTGGG - Intergenic
1189664415 X:43338466-43338488 TTTGTCAAACCCATAATCCTGGG + Intergenic
1191191094 X:57668034-57668056 CTTGTCAAATCCATATTTCTGGG - Intergenic
1191637965 X:63398321-63398343 TTTGTCAAACCCATATTGCTGGG - Intergenic
1191789572 X:64955161-64955183 TTTGTCACACCCATATTCCTGGG + Intronic
1192117665 X:68426915-68426937 CTTATAAAGCACATTATCCTTGG + Intronic
1192281673 X:69693998-69694020 TTTGTCAAACCCATAATCCTTGG - Intronic
1194051584 X:89075752-89075774 TTTGTCAAACCCATATTCCCGGG - Intergenic
1194241372 X:91453685-91453707 TTTGTCAAACCCATAATCCTGGG - Intergenic
1194807970 X:98353445-98353467 TTCTTCAAGCCCATAATTCTAGG + Intergenic
1195471926 X:105240032-105240054 TTTGTCAAACCCGTATTCCTGGG - Intronic
1197554058 X:127932951-127932973 TTTGTCAAACCCATATTCCTGGG + Intergenic
1197929407 X:131679263-131679285 CTTGATAAGCACATAATCATTGG - Intergenic
1199105728 X:143865285-143865307 TTTTTCAAACCCATATTCCTAGG + Intergenic
1200484061 Y:3745282-3745304 TTTGTCAAACCCATATTCCTGGG - Intergenic
1201210589 Y:11676910-11676932 CCTTTCAAGCCCATAATCTTTGG - Intergenic