ID: 1128898574

View in Genome Browser
Species Human (GRCh38)
Location 15:71398356-71398378
Sequence GAGGGTGACCTGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1145
Summary {0: 1, 1: 0, 2: 21, 3: 246, 4: 877}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128898574 Original CRISPR GAGGGTGACCTGAAGAAGGA AGG Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900415903 1:2534548-2534570 CAGGCTGACCTGGGGAAGGAGGG + Intergenic
900531745 1:3157159-3157181 GGGCGGGACCTGGAGAAGGAGGG + Intronic
901051064 1:6426126-6426148 CTGGGTGACCTGGAGATGGAAGG + Intronic
902411244 1:16212661-16212683 GAGGGGGAGGTGAAGGAGGAGGG + Intergenic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904896112 1:33819688-33819710 GAGGGTGCCCTGGGGAAGGGAGG - Intronic
905477779 1:38240989-38241011 GATGGTAAGTTGAAGAAGGATGG + Intergenic
906107355 1:43302775-43302797 GAGGATGAGTTGCAGAAGGAGGG + Intronic
906212076 1:44017558-44017580 GATGGTGACCGGCAGGAGGATGG + Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906829949 1:49020593-49020615 GGGGGTGTCCTGGAGGAGGAGGG + Intronic
906843177 1:49161347-49161369 GAGGGTGACCCAAAGCAGGGCGG - Intronic
906859441 1:49343143-49343165 GAGGGTGACAAGAAGATAGACGG - Intronic
907600040 1:55760235-55760257 GAGGGTGAGCCGAAGCAGGTGGG + Intergenic
907897955 1:58710411-58710433 GAGGGCCACCTGAAAAAAGAAGG + Intergenic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908813579 1:68009057-68009079 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909261311 1:73492131-73492153 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909448971 1:75777735-75777757 GAGGGTGAGCTGAAGCAAGGTGG + Intronic
909707777 1:78607839-78607861 GAGGGTGAGCTGAAGAAGAGGGG + Intergenic
910383558 1:86657589-86657611 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910930295 1:92436730-92436752 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
910989032 1:93035915-93035937 GAGTGGGAACTGAGGAAGGATGG + Intergenic
911270572 1:95797057-95797079 GAGGGTGAGGTGAAGCAGGGTGG + Intergenic
911339308 1:96617828-96617850 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
911342039 1:96651403-96651425 GAGGGTGAGCTGAAGAAGGGCGG + Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912146149 1:106796776-106796798 GACAGAGACCTGAAGAAGAATGG - Intergenic
912396782 1:109351402-109351424 GATGGTGTCCTGAAGAAGACAGG + Intronic
912634855 1:111282546-111282568 GAGGGAGACCCAAAGAAGGCAGG - Intergenic
912637859 1:111315245-111315267 GAGGGAGACCCAAAGAAGGCAGG - Intronic
912711586 1:111953889-111953911 GAGAGTGATCTGGAGCAGGAGGG - Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913108742 1:115639768-115639790 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
913291317 1:117274795-117274817 GTGGGTCACCTGAAGAAAGGGGG + Intergenic
915020951 1:152777902-152777924 GAGGGTATCAGGAAGAAGGAGGG - Intronic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915077398 1:153320399-153320421 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
915651520 1:157315405-157315427 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
915654570 1:157348567-157348589 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915680858 1:157580994-157581016 GAGGCTGACCTGAGGAGAGAGGG + Intronic
915895250 1:159807007-159807029 GAAGGGGATCTGAGGAAGGAAGG - Intronic
916038426 1:160941874-160941896 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
916171991 1:162008433-162008455 GCAGGTGAGCTGAAGAAGCAAGG - Intronic
916251816 1:162746145-162746167 GAGTGTGAGCTGAAGCAGGGTGG + Intronic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
916815014 1:168343252-168343274 GAAGGTTTCCTGAAGAAGGAGGG + Intergenic
916815158 1:168344507-168344529 GAAGGTTTCCTGAAGAAGGAGGG - Intergenic
917163231 1:172080921-172080943 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
917450508 1:175143935-175143957 GTGAGTGACCTGCAGAGGGAGGG + Intronic
917764187 1:178199275-178199297 GAGGGCGAGCTGAAGGAGGGTGG - Intronic
917893786 1:179466086-179466108 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918353760 1:183684884-183684906 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
918639206 1:186818306-186818328 GAGGCTGACTTGAATCAGGATGG + Intergenic
918968268 1:191378780-191378802 GAGGGTGAGCCAAAGCAGGACGG - Intergenic
919055565 1:192565733-192565755 GAGGGAGAGCGGCAGAAGGAAGG + Intergenic
919063967 1:192668932-192668954 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
920078695 1:203356021-203356043 GAGAGATACCTGAATAAGGAAGG + Intergenic
920295676 1:204954710-204954732 AAGGGGCACCTGGAGAAGGAGGG - Intronic
920503652 1:206501298-206501320 GAGGGGGAGATGAAGAGGGATGG + Intergenic
920588770 1:207196107-207196129 GAGGGCGAGCTGAAGCAGGATGG + Intergenic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
920993192 1:210959879-210959901 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921184097 1:212655517-212655539 GAGGATGGCCTGCAGAGGGAGGG + Intergenic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
921976253 1:221206728-221206750 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922406298 1:225316647-225316669 GAGGGAGAACTGAAGCAGGGTGG - Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922723195 1:227909566-227909588 GAGGGAGAAGGGAAGAAGGAAGG + Intergenic
923067062 1:230527567-230527589 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
923472445 1:234304090-234304112 GAGGGAGAGAGGAAGAAGGAAGG - Intronic
923690997 1:236192635-236192657 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924253486 1:242158610-242158632 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
924814211 1:247428098-247428120 GAGTCTGTCCTGAGGAAGGAAGG - Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1064492925 10:15878513-15878535 GAGGGGGAGCTGAAGCAGGGCGG - Intergenic
1065076082 10:22080592-22080614 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
1065076874 10:22089421-22089443 GAAGGTGAGCTGAAGCAGGGTGG + Intergenic
1065799081 10:29334796-29334818 GAGGGTGAACTGAAATAGGGCGG + Intergenic
1065907566 10:30271962-30271984 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1066140866 10:32502354-32502376 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1066162959 10:32754794-32754816 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
1066257728 10:33696580-33696602 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1066751218 10:38659332-38659354 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1066965826 10:42263759-42263781 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067128520 10:43540837-43540859 AAGAGAGACCTGAGGAAGGAGGG - Intergenic
1067214821 10:44293139-44293161 GAGGGGGGCCTGGGGAAGGATGG + Intronic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1067538696 10:47136081-47136103 AAGGGTGTCCTGCAGAAGCAGGG - Intergenic
1067559989 10:47298478-47298500 GAGGGGCACATGGAGAAGGAGGG + Intergenic
1067787358 10:49260255-49260277 GAGGGTGCCGAGAAGAAAGAGGG + Intergenic
1067968496 10:50942045-50942067 TGGGAGGACCTGAAGAAGGAGGG - Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068470046 10:57448782-57448804 GAGGGTGACCTGAAGCATGGTGG - Intergenic
1068759324 10:60690255-60690277 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1069264372 10:66438988-66439010 GAGGGTGACCCGAAGCAGGGTGG - Intronic
1069355944 10:67585031-67585053 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070747230 10:78941479-78941501 GAGGGATACCTGAACTAGGAAGG + Intergenic
1070839635 10:79475189-79475211 GGGTGTGATCTGAAGAGGGAAGG + Intergenic
1071647338 10:87367069-87367091 GAGGGTGGCCTGAATGGGGAGGG + Exonic
1071698530 10:87903819-87903841 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1071764118 10:88642687-88642709 GATAGTGACCTGGAAAAGGATGG - Intergenic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072374527 10:94800991-94801013 GAGGGTGAGCTGAAGAAGGGTGG - Intronic
1072480600 10:95807481-95807503 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072775107 10:98183011-98183033 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1073101470 10:101008876-101008898 CAGGGTGACATGAGGAGGGAGGG - Intronic
1073694457 10:105849502-105849524 GAGGGTGAGCTGAAAGAGGGTGG + Intergenic
1073978863 10:109131555-109131577 GAGGGTGAGCCGAAGCAGAATGG + Intergenic
1074008147 10:109449174-109449196 GCTGGTGACCTGAAGATGAAGGG - Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074117852 10:110471009-110471031 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1074997595 10:118771190-118771212 GAAGAAGACCTGAAAAAGGAAGG - Intergenic
1075805396 10:125184955-125184977 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1076799699 10:132814893-132814915 GAAGGTGGCGTGAAAAAGGAGGG - Exonic
1077177147 11:1196145-1196167 GGGGGGGACCTGGAGGAGGAGGG + Intronic
1078912836 11:15749364-15749386 GAAGGTGAGCTCAAGAAGGAAGG + Intergenic
1078981133 11:16536474-16536496 GAGGGTGAGCTGAAGAAGGGCGG + Intronic
1079577783 11:22025130-22025152 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080334464 11:31180546-31180568 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1080446921 11:32345969-32345991 GAAGGTGGCCTGAAGAAGGCAGG - Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080818231 11:35779410-35779432 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1080917350 11:36673564-36673586 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081221505 11:40469226-40469248 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1081408157 11:42722274-42722296 GAGGCAGATGTGAAGAAGGAAGG - Intergenic
1081958972 11:47119427-47119449 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083003716 11:59321429-59321451 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1083385607 11:62306956-62306978 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1083497023 11:63064401-63064423 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083516310 11:63262107-63262129 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1084125386 11:67095730-67095752 GAGGGTGGCCTGCTGCAGGAAGG - Intergenic
1084215603 11:67645474-67645496 GAGGGAGACCTGGCCAAGGAGGG - Intronic
1084932924 11:72571251-72571273 GGGGGTGTGCTGAGGAAGGATGG - Intergenic
1085034492 11:73291970-73291992 GAGGGCGACCTGGAGGAGGTGGG - Intronic
1085420480 11:76354084-76354106 AAGGGGGACATGAACAAGGAGGG + Intronic
1085910723 11:80822280-80822302 GTTGGTGATCTGAAGGAGGACGG + Intergenic
1086086116 11:82956681-82956703 GAGGGTGAGCTGAAGCAGCGTGG - Intronic
1086117279 11:83266277-83266299 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086298187 11:85395426-85395448 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086456913 11:86968064-86968086 GAGGGTGAGCCGAAGTAGGGTGG - Intergenic
1086494325 11:87386668-87386690 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1086506334 11:87508221-87508243 GAGGGTGAGTTGAAGCAGGGTGG - Intergenic
1086608371 11:88724752-88724774 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086812073 11:91322271-91322293 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1087311111 11:96545152-96545174 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1087364241 11:97198693-97198715 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1087925058 11:103910443-103910465 GAAGGTGAGCTGAAGCAGGGTGG + Intronic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088381102 11:109193320-109193342 GAGGGTGAGTTGAAGCAGGATGG - Intergenic
1089190107 11:116647583-116647605 GTGAGTGAGTTGAAGAAGGAAGG + Intergenic
1089638308 11:119830943-119830965 GAGGGTGACATGGAGGAAGAAGG - Intergenic
1090216347 11:124968628-124968650 GAGGGTGAACCGAAGCAGGGTGG - Intronic
1090405958 11:126475887-126475909 GAGGCTGCCTTGAAGAAAGAAGG - Intronic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1090934969 11:131333183-131333205 GAGTGTGCCCTGAAGAGGAATGG - Intergenic
1091292486 11:134449415-134449437 TAGGGTTTCTTGAAGAAGGAGGG + Intergenic
1091694957 12:2622239-2622261 GAGGGTGACATGAAAAGGGCCGG + Intronic
1092084924 12:5748847-5748869 GAGGGTGAAGGGAAAAAGGAAGG - Intronic
1092094585 12:5831142-5831164 GAGGATGCACTGATGAAGGAAGG + Intronic
1092205763 12:6613549-6613571 GACGGTGACCTTAGAAAGGATGG + Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092661963 12:10748206-10748228 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1092711313 12:11340388-11340410 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1092818471 12:12331485-12331507 GAGGGTGACCTGAGCAGGAAAGG + Intronic
1093004334 12:14035620-14035642 GAGGGTGAGCCAAAGCAGGATGG + Intergenic
1093372086 12:18377514-18377536 GAGGGTGAACTTCAGAAAGATGG - Intronic
1093545137 12:20336924-20336946 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1094641648 12:32281793-32281815 GGTGGTGACCTGAAGAAAGCTGG - Intronic
1094757774 12:33492412-33492434 GAGGGTGAGCTGAAGAAGGGTGG + Intergenic
1095140504 12:38657048-38657070 GAGGGTGAGCTGAAGCAGTGCGG + Intronic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096443750 12:51669480-51669502 GAGGGAGACCAGAAGAAGGTGGG - Intronic
1096950069 12:55459456-55459478 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1097030147 12:56083961-56083983 AAGGTAGCCCTGAAGAAGGAAGG - Intronic
1097548458 12:61035406-61035428 GAGGAGCACCTGAAGATGGAGGG - Intergenic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1098635535 12:72780040-72780062 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099216608 12:79861482-79861504 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1099236185 12:80084562-80084584 GAGGGCGAACTGAAGCAGGGTGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099436970 12:82657207-82657229 GAGGGCGACCTGGAGCAGGCTGG + Intergenic
1099486331 12:83233109-83233131 GAGGGTGAGCGGAAGCAGGGTGG - Intergenic
1099491947 12:83299592-83299614 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099697548 12:86040975-86040997 GAGGGTGAGTTGAAGCAGGGTGG - Intronic
1099820319 12:87700731-87700753 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1100417104 12:94389641-94389663 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1100723143 12:97380039-97380061 GAGAGGGACAAGAAGAAGGATGG - Intergenic
1100900758 12:99238069-99238091 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1100965698 12:100010900-100010922 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1101301754 12:103489922-103489944 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1101601335 12:106212697-106212719 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1102345658 12:112159484-112159506 GAGGGTGATCTGAAGCAGGGTGG - Intergenic
1102932416 12:116872812-116872834 GAGAGAGACAGGAAGAAGGAGGG + Intronic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1104175417 12:126326621-126326643 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1104450797 12:128866914-128866936 GAAGGTGACCTGAAGGTGGCTGG - Intronic
1104893793 12:132152288-132152310 GAGCGGGACCTGAAGAAGAAGGG + Exonic
1105201328 13:18182309-18182331 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1105726224 13:23164907-23164929 CAGGCTGCCCTGAAGAGGGAAGG - Intergenic
1105769324 13:23593947-23593969 GAGGGTGAGCCAAAGCAGGATGG + Intronic
1105855865 13:24371346-24371368 GAGGGTGAGCTGATGAAGGAGGG + Intergenic
1106153103 13:27125627-27125649 GAGGGTGAGCGGAAGCAGGGTGG + Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106650785 13:31688075-31688097 GAGGGTGAGCAGAAGAGGGTGGG + Intergenic
1106786906 13:33116305-33116327 GAGGGAGAGATGAAGAATGAGGG - Intronic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1106983946 13:35322393-35322415 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107646107 13:42495915-42495937 GAGGGTGACCAGACCATGGAAGG - Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1107994687 13:45848551-45848573 GAAGGTGACCTATAGAAGCATGG + Intronic
1108217645 13:48200901-48200923 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108304519 13:49118200-49118222 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109048998 13:57453606-57453628 CAGGATGACCTGAAGAAATATGG - Intergenic
1109213650 13:59563465-59563487 GAGGGTGACCAGAGGAGTGAGGG - Intergenic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109806598 13:67452421-67452443 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1110071511 13:71184434-71184456 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111634994 13:90892541-90892563 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1112412091 13:99173291-99173313 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1113300974 13:109018792-109018814 GAGGGTGAGCTGAAGCAGAGCGG - Intronic
1113383871 13:109829344-109829366 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1113649580 13:112026439-112026461 GGGGGCTGCCTGAAGAAGGAGGG + Intergenic
1113659432 13:112095541-112095563 GAGGGGGCCCTGATGATGGAGGG - Intergenic
1113895926 13:113764455-113764477 GAGGGTGGCTTTCAGAAGGAGGG + Intronic
1114677563 14:24453874-24453896 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1114981252 14:28168139-28168161 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
1115123174 14:29961335-29961357 GAGCGTGAGCTGAAGCAGGGTGG - Intronic
1115135820 14:30107103-30107125 GAGCGTGAACTGAAGCAGGGTGG + Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115843435 14:37498445-37498467 GAGGGTGAGCTGAAGAAAATTGG + Intronic
1116165590 14:41330335-41330357 GAAGGTGAGCTGAAGCAGGACGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116401813 14:44516134-44516156 GAGGGTCAGCTGAAGCAGGGCGG - Intergenic
1116433680 14:44873929-44873951 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1116537153 14:46046974-46046996 GAGGGTGAAATGAAGAAGGAGGG - Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1117005724 14:51419151-51419173 GAGGGTGATCTGAAGCAGGGCGG - Intergenic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117237893 14:53798052-53798074 GAAGGTGAACTGAAGCAGGGTGG + Intergenic
1117362969 14:54996508-54996530 GAGGGTCACCTGAACCTGGAAGG + Intronic
1117536721 14:56709641-56709663 GAGTGGGACCACAAGAAGGAAGG + Intronic
1117617170 14:57545357-57545379 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117887608 14:60381772-60381794 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1117900674 14:60529262-60529284 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1117930628 14:60837515-60837537 GAGGGTGAGCCAAAGCAGGATGG - Intronic
1117950639 14:61079822-61079844 GAGTGTGCCCTGAACAACGAAGG + Intronic
1118450015 14:65892217-65892239 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1118811308 14:69276272-69276294 GTGAGTGTCCTGGAGAAGGATGG + Intronic
1118830002 14:69421977-69421999 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1119198017 14:72731907-72731929 GAGCTTCCCCTGAAGAAGGATGG - Exonic
1119526981 14:75330658-75330680 AATGGTGCCCTGAACAAGGAAGG + Intergenic
1119707335 14:76791288-76791310 GAAGGTTACCTGGAGAAGGCAGG + Exonic
1119888018 14:78160510-78160532 GAGATTGACATGAAGGAGGATGG + Intergenic
1120041816 14:79762366-79762388 GATGTTGAACTGAAGAAAGAAGG + Intronic
1121470676 14:94151835-94151857 GAGGGTGAGCTGAAGCAGGTTGG - Intronic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1122443403 14:101750223-101750245 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1122626669 14:103088548-103088570 GAGGGTGCACTGGATAAGGAGGG - Intergenic
1123787555 15:23688073-23688095 GAAGGTGAATTGAAGAATGAGGG - Intergenic
1123964862 15:25444783-25444805 GAGGGGGCCCTGAAGCAGAAAGG + Intergenic
1125219478 15:37317223-37317245 AAGGGTGAACTGAAGCAGGGTGG + Intergenic
1125310727 15:38375674-38375696 GAGGGTGACCAGAAAAATCACGG + Intergenic
1125354632 15:38803768-38803790 GAGGGTGAGCTGAAACAGGGTGG - Intergenic
1125984678 15:44038699-44038721 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1126087092 15:45021058-45021080 GAGGGTGAGCCGAAGCAGGGAGG - Intergenic
1126720044 15:51568953-51568975 GAGGTTGAGCTGAAGCAGGGTGG + Intronic
1126742030 15:51786998-51787020 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1127179395 15:56399130-56399152 GAGGGTGAACTGAAGCAGAGTGG + Intronic
1127193686 15:56561560-56561582 GAGAGTGAGCTGAAGAAGGGCGG + Intergenic
1127253920 15:57271561-57271583 GAGGGTGAGCTGAATCAGGGTGG - Intronic
1127646743 15:60966135-60966157 GAAGGTGATATGAAGAAAGAGGG - Intronic
1127961850 15:63896009-63896031 GAGGCTGGCCTGGAGCAGGAGGG - Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1128883590 15:71265299-71265321 GAGGCTGAGCTGAAGCAGGGTGG + Intronic
1128896697 15:71380219-71380241 GAGGCTGACCAAAAGAAGAAGGG - Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129495680 15:75977609-75977631 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1129606108 15:77025749-77025771 GAGGGTGATCTGAAGTGGGTAGG + Intronic
1130058378 15:80550227-80550249 GAGGGTGAATGGAACAAGGATGG + Intronic
1130345802 15:83043572-83043594 GATGGTGGCCTGGACAAGGAGGG + Intronic
1130680939 15:85996207-85996229 GAGGGTGAAGTGAATAAGGATGG - Intergenic
1131133658 15:89916237-89916259 GTGGGTGACATGAAGGAGCAGGG + Intergenic
1131530718 15:93189640-93189662 GGGGCTGACCTGAAGAATTACGG + Intergenic
1132096325 15:98987830-98987852 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1135512026 16:23094017-23094039 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
1135526620 16:23217950-23217972 AAGGGTGAAGTGGAGAAGGAGGG - Intergenic
1135864978 16:26092761-26092783 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1136517612 16:30777413-30777435 GAAAGTGACCTGAAGGATGAGGG - Intergenic
1136541215 16:30928482-30928504 GAGAGGCACCTGAAGAAGGTGGG + Exonic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1136731506 16:32417773-32417795 GAGGGTGAGCTGAAGCAAGGTGG - Intergenic
1137012403 16:35335846-35335868 GAGGTTCACCTGAAGATGCATGG - Intergenic
1137046098 16:35663892-35663914 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138209208 16:55148936-55148958 GAGAGTGACCCGAACAAGGAGGG - Intergenic
1138350622 16:56344520-56344542 GAGGATGACCCAGAGAAGGAAGG - Exonic
1138843739 16:60539567-60539589 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139016765 16:62698786-62698808 GAGTATGACCTGAAGAAGACTGG + Intergenic
1139028268 16:62846576-62846598 GAGGGTGAGTTGAAGAATGGTGG + Intergenic
1139222146 16:65194541-65194563 GAGGGCGAGCAGAAGAAGGGTGG - Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139810880 16:69616185-69616207 GAGCCTGAGCTGAATAAGGAGGG - Intronic
1140978257 16:80081753-80081775 GAGTGTGACCGGTGGAAGGAGGG + Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1141932224 16:87213521-87213543 GATGGTGAGGAGAAGAAGGATGG + Intronic
1142220389 16:88851530-88851552 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1202994886 16_KI270728v1_random:99497-99519 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1203021573 16_KI270728v1_random:411839-411861 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1143898654 17:10156776-10156798 GAGGGAGGCCTGCAGCAGGAGGG - Intronic
1144282629 17:13741952-13741974 GAAGGTTTCCTGAAGAAAGAGGG + Intergenic
1144293984 17:13855635-13855657 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1144371699 17:14597627-14597649 GAGGGTGACCAGAAGTAGAGTGG + Intergenic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1145392656 17:22467835-22467857 GAGAGAGAACTGAAGAAGGGTGG - Intergenic
1146839597 17:36141394-36141416 GAGGGTGGCCTGGAGGAGTAGGG + Intergenic
1147739914 17:42665611-42665633 GAGGGTCATCTGGGGAAGGAAGG + Intronic
1147967932 17:44203903-44203925 GATGGTGGCCTGAAATAGGATGG + Intergenic
1149093914 17:52817520-52817542 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1149149547 17:53543873-53543895 TAGGGTGAGCTTAAGAATGAGGG - Intergenic
1149192926 17:54085790-54085812 GAAGATGAGCTGAAGCAGGATGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149298871 17:55285965-55285987 AAGGGTGGCCCGAGGAAGGAAGG - Intronic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149681605 17:58511503-58511525 GAGGGGGACCTGTAGAGGAAGGG + Exonic
1150436661 17:65159468-65159490 GAGCGAGACCTGGAGAGGGAGGG + Intronic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1151064277 17:71132289-71132311 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151541727 17:74768082-74768104 GAGGGGGTCCTGAGGAGGGAGGG - Intronic
1151763717 17:76121730-76121752 GAGGGGGCGCTGAAGAGGGAGGG + Intergenic
1151927586 17:77210325-77210347 ACGAGTGACCTGAAGCAGGAGGG + Intronic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152544828 17:80995226-80995248 GAAGCTGACCTGAAGAGGGGCGG + Intronic
1152704307 17:81834814-81834836 CAGGGTGACCTGGAGCAGGTGGG - Exonic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153313495 18:3700418-3700440 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1153573217 18:6494650-6494672 GTGGGTGACTTGAAGAACAAGGG + Intergenic
1153941605 18:9983109-9983131 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1154101629 18:11479728-11479750 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1154288623 18:13084596-13084618 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1154288817 18:13086479-13086501 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1154401622 18:14043552-14043574 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1155570202 18:27184849-27184871 GAGGGGGCGCTGGAGAAGGACGG - Intronic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1155760456 18:29558874-29558896 GAGGGAGACGGGAAGAGGGAGGG - Intergenic
1155884241 18:31187872-31187894 GATTGTGCCCTGAATAAGGAAGG + Intergenic
1156649483 18:39207876-39207898 GAGGTTGACCGAAAGAAGGAAGG - Intergenic
1157025274 18:43835640-43835662 GAGGGTGAGCTGAAGCGGGGTGG + Intergenic
1157067380 18:44367246-44367268 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1157258252 18:46157260-46157282 GAGAGTGACCCAAGGAAGGAGGG + Intergenic
1157368482 18:47088387-47088409 GAGGGTGAACTAGAGAAGAATGG + Intronic
1157780615 18:50435399-50435421 GAGGGTGAGGTGAAGCAGGGTGG + Intergenic
1158568917 18:58580024-58580046 GATGGTGACCTGAACAATGATGG - Exonic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159575713 18:70173983-70174005 GAGTGTGGCTTGGAGAAGGAGGG + Intronic
1159661305 18:71098416-71098438 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1160159680 18:76461702-76461724 GATGGAGACCTGAAGAGGAAGGG - Intronic
1160443250 18:78908580-78908602 GAGTGCGACCTGGAGAGGGAAGG + Intergenic
1160446348 18:78929972-78929994 GAGGGAGACATGGGGAAGGAAGG + Intergenic
1160679530 19:406464-406486 GAGGGTGCCCTGACGAGGGTGGG - Exonic
1160978939 19:1807590-1807612 CAGGGTGACCTGGGGAAGCAGGG - Intronic
1161210574 19:3063174-3063196 TAAAGCGACCTGAAGAAGGAGGG + Intergenic
1161614224 19:5261044-5261066 GAGGGTTTCCTGTAGAAGGCGGG + Intronic
1161628532 19:5340081-5340103 GAGGGAGACCCGGAGAGGGAAGG + Intronic
1163488249 19:17602212-17602234 GAGGGTGTCCTGAAGAAAGAAGG - Exonic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1164526134 19:29014936-29014958 GAGGCTGCCCTGAGCAAGGAGGG - Intergenic
1164556319 19:29255462-29255484 GAGGGTGAGCTGAAGCATGCTGG - Intergenic
1165003800 19:32787909-32787931 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166163725 19:40971440-40971462 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1166547552 19:43642376-43642398 CAGGGTACCCTGAAGTAGGATGG - Intergenic
1167168264 19:47813910-47813932 GAGGGAGACCAGAAGACAGAGGG + Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167507463 19:49878339-49878361 CAGTGGGACCTGAAGAAGGCTGG + Intronic
1168170582 19:54585765-54585787 AAGGGCGAGCTGAAGCAGGATGG - Intronic
1168431074 19:56281220-56281242 TAGGCTGACCAGAAGAAGGAAGG + Intronic
1168457607 19:56526211-56526233 GAGGGTGAGCTGAAGCAGGGTGG + Exonic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
926074777 2:9933131-9933153 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
926234234 2:11027418-11027440 GAAGGGGACGTGAAGAAGGAGGG - Intergenic
927021407 2:19020787-19020809 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927713642 2:25340380-25340402 GAGGGTGCCCCCAAGAAGGGAGG + Intronic
928689644 2:33786259-33786281 GAAGGTGGCTTGAAGAAGCAGGG - Intergenic
929025782 2:37600164-37600186 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929679315 2:43973823-43973845 GAGGGTGAACTGCAGAGGAAAGG + Exonic
929830016 2:45339594-45339616 GAGGGTGAGCTGCAAAATGAAGG + Intergenic
930323253 2:49882036-49882058 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
930872839 2:56184985-56185007 GAGGGTCACCTGTTGAGGGAGGG - Intronic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
930941679 2:57021846-57021868 GAGGGTGAGCCAAAGAAGGGCGG + Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931594462 2:63926657-63926679 GAGGGTGCGCTGAAGCAGGGCGG + Intronic
932051613 2:68403847-68403869 GAGGGTGAGCTGAAGCTGGGTGG - Intergenic
932317279 2:70793549-70793571 GAGTGGGAGCTGAAGAAGGGTGG - Intergenic
932327972 2:70876046-70876068 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
932539925 2:72641235-72641257 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
932583245 2:73006225-73006247 GAGGGTGACCTGACCTGGGATGG - Intronic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933413290 2:81951500-81951522 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933880387 2:86663829-86663851 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
933881400 2:86673570-86673592 GAGGAGGGCCTGAAGAAGCAGGG - Intronic
934314210 2:91901501-91901523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934504490 2:94880040-94880062 GAGGGTGACCCCAACACGGAGGG - Intergenic
934617034 2:95778617-95778639 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
934643859 2:96045942-96045964 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
934702656 2:96454572-96454594 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934837276 2:97602036-97602058 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
935325750 2:101935514-101935536 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
935331305 2:101979721-101979743 GAGGAGGTCCTGAAGAAGGTCGG + Intergenic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
936005386 2:108882657-108882679 GAGGATGACCTGAAAAGGAAAGG - Intronic
936859578 2:117001291-117001313 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937058930 2:118967208-118967230 GAAGGTGTCCTGAAGCAGGACGG + Intronic
937060285 2:118975574-118975596 TAGGCAGACCAGAAGAAGGAAGG + Intronic
937135006 2:119544652-119544674 GAGGGTGACCTGAGGATGGTGGG + Intronic
937143047 2:119618432-119618454 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
937191678 2:120107579-120107601 GAGGCTGGCATGGAGAAGGAAGG - Intronic
937462119 2:122098556-122098578 GATGGTGACCTATAAAAGGAAGG + Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938053858 2:128198839-128198861 GAGCTTGAGCTGAAGAAGGGAGG - Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938383959 2:130851642-130851664 GTGGGTCACATGAAGAAGAAGGG + Intronic
939055510 2:137360385-137360407 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
939744512 2:145952173-145952195 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
939865313 2:147465981-147466003 CAGGGTGACTTTAAGAAGGAAGG - Intergenic
940238287 2:151534484-151534506 GAAGATTACCTGAAGAAGGCTGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
940528285 2:154844922-154844944 GAGGGCGAGCTGAAGCAGGCAGG - Intronic
940644478 2:156376226-156376248 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940964436 2:159821883-159821905 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941069098 2:160936333-160936355 GAGGTTGAACTGAAAAAGAAAGG + Intergenic
941164049 2:162066288-162066310 GATGGTGGCTTGGAGAAGGATGG - Intronic
941180491 2:162253704-162253726 GAGGGAGTTGTGAAGAAGGATGG + Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941896053 2:170630078-170630100 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
942410952 2:175708960-175708982 GAGGGTGAACTGAAGCCGGGTGG + Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942458951 2:176156640-176156662 GAGGGGGCGCGGAAGAAGGAGGG - Intronic
943352438 2:186811911-186811933 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
943552576 2:189358020-189358042 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
943660399 2:190554009-190554031 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944347292 2:198684600-198684622 GAGGGTGAGCTGAAGAAGGCTGG + Intergenic
945185019 2:207131518-207131540 GAGGGTGGCTTGAAGAAAGAAGG - Intronic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945671413 2:212806695-212806717 ATGTGTGACCTGAAGAAGAAAGG - Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
946251634 2:218417678-218417700 GAGGGTGACGTGAAGTGGGCTGG - Intergenic
946794029 2:223330655-223330677 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947190898 2:227503553-227503575 GAGGGAGAAATGAGGAAGGAAGG - Intronic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947365927 2:229394922-229394944 GAGGGTGGCAAGAGGAAGGAGGG - Intronic
947440632 2:230118090-230118112 GAGAGTGAGCTGAAGTGGGACGG - Intergenic
948270796 2:236671857-236671879 CTGGGTGACCTGAGGATGGAAGG + Intergenic
948379099 2:237540761-237540783 GAGGCTGACCAGCAGCAGGAGGG - Intronic
948456696 2:238107777-238107799 GAATGTGACCTGGGGAAGGAGGG - Exonic
948902981 2:240965501-240965523 GAGGGTGCCCGGAAGGAGGTGGG + Intronic
1169074077 20:2750834-2750856 GAGGTTGACCTGGGGAAGGAAGG + Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169746156 20:8945241-8945263 GAGGGTGTGCTGATGATGGAAGG + Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170294155 20:14806299-14806321 GAGGGCGACCAGAAGCAGGGTGG + Intronic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1171030406 20:21671351-21671373 GAATGTGGCCTGAAGCAGGATGG + Intergenic
1172456334 20:35077229-35077251 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1172699680 20:36845541-36845563 GAGGGTGAGCTGACAAAGGCAGG + Intronic
1173165902 20:40687388-40687410 GAGGCTGAGCGAAAGAAGGAAGG - Exonic
1173527653 20:43745256-43745278 GAATGAGACCTGAAGAAGGAAGG + Intergenic
1173771843 20:45666395-45666417 GAGGGTGAGCGGAAGCAGGGTGG - Intronic
1174224117 20:48982968-48982990 TAGGGTGAGCTGAAGCAGGGCGG - Intronic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175531982 20:59680088-59680110 GATGGGGACAGGAAGAAGGAAGG - Intronic
1176019706 20:62956419-62956441 GAGGGTGACCAGGAGATGGGTGG - Intronic
1176716617 21:10355679-10355701 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1177092064 21:16781678-16781700 GAAGGTGAGCTGAAGCAGGATGG + Intergenic
1177111463 21:17034280-17034302 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1177136296 21:17308446-17308468 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
1177184275 21:17776037-17776059 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1177627351 21:23680027-23680049 GTGAGTGCCCTGAGGAAGGAAGG - Intergenic
1178180679 21:30157509-30157531 GAGGGTGGCTTGGAGAAGGCAGG + Intergenic
1178413848 21:32387917-32387939 GAGAGTGACCTGAACACAGAAGG - Intronic
1178589065 21:33894038-33894060 GAGGGTGGCCTGGACCAGGATGG - Exonic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179167528 21:38946534-38946556 GAGGGAGAGATGGAGAAGGAGGG + Intergenic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1179311080 21:40196649-40196671 GAGGGGAAAGTGAAGAAGGAAGG - Intronic
1179486219 21:41712365-41712387 GAGGGGGACCTGCAGGGGGAGGG + Intergenic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180158951 21:45990537-45990559 GAAGGTGACCAGGGGAAGGACGG + Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180596152 22:16974857-16974879 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1180601719 22:17024257-17024279 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1180961311 22:19763624-19763646 GAGGGAGACTTGAAGAAGTCCGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1182097006 22:27632899-27632921 GAGGCTGAGCTGGAGAAGGCTGG + Intergenic
1182335443 22:29580747-29580769 GATGGGGACCTGATGAAAGATGG - Intronic
1182432862 22:30310870-30310892 GAGGGTGATAAGAAGAGGGAAGG - Intronic
1182489694 22:30663162-30663184 GATGGTGCCCAGAAGAAAGAGGG - Exonic
1183021574 22:35031241-35031263 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1183032381 22:35115925-35115947 GAGCTTGGTCTGAAGAAGGAAGG - Intergenic
1183175037 22:36217319-36217341 GAGGGTGGCAAGAGGAAGGAGGG - Intergenic
1184651599 22:45921685-45921707 GAGGGTGACAGGATGAGGGAGGG + Exonic
1184886138 22:47345408-47345430 GAGGGTGTCCTGCATGAGGAGGG + Intergenic
1185335303 22:50268606-50268628 GAGGGTCACCTGCAAAGGGAGGG - Intronic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949423601 3:3891902-3891924 GAGGATGTGCTGAAGCAGGATGG - Intronic
949428176 3:3941855-3941877 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
949449991 3:4174706-4174728 GAGGGTGAGCCAAAGCAGGATGG + Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949801281 3:7906631-7906653 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
949939036 3:9139813-9139835 TAAGATGACCAGAAGAAGGAAGG + Intronic
950961333 3:17111162-17111184 GTGTGTGGGCTGAAGAAGGAAGG - Intergenic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951006261 3:17618873-17618895 GAGGGTGAGCTGAAGCAAGGCGG - Intronic
951368256 3:21812372-21812394 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
952517730 3:34122560-34122582 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
952661739 3:35858725-35858747 AAGGGAGACCCCAAGAAGGAAGG + Intergenic
952704402 3:36362780-36362802 GAGGGTGTCAAGAGGAAGGAGGG - Intergenic
952962693 3:38602699-38602721 GAGGATGGCCTGAAGATGCAGGG - Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
954083196 3:48224438-48224460 GATTGTGACTTCAAGAAGGACGG + Exonic
954178722 3:48864802-48864824 GAAGGTGGCCTGAAGTAGTATGG + Intronic
954501035 3:51014137-51014159 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
955410643 3:58653410-58653432 AAAGGTGACCCGAAGAAGGAAGG - Intronic
955657918 3:61264111-61264133 GAGGGTGAGATGAAGCAGGGTGG - Intergenic
956207803 3:66772117-66772139 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956316873 3:67947957-67947979 GAGGGTGAGCTGAAGGAGAGCGG + Intergenic
956373287 3:68587116-68587138 GAGGGTGAGCTGAAGCAAGGCGG - Intergenic
956875590 3:73459495-73459517 GAGGGTGAAGGGTAGAAGGAAGG - Intronic
957249578 3:77756590-77756612 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958414005 3:93852732-93852754 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
958434615 3:94081204-94081226 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
958618442 3:96526811-96526833 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
958694643 3:97511476-97511498 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
958975959 3:100668079-100668101 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
959059814 3:101605780-101605802 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
959736433 3:109664888-109664910 GAGGGTGTGCTGAAGCAGGGCGG + Intergenic
959815753 3:110671581-110671603 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
960183536 3:114611184-114611206 TTGGTTGAACTGAAGAAGGAAGG + Intronic
960763401 3:121097609-121097631 GAGGGTGATCTGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
960836098 3:121908354-121908376 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
961362933 3:126379524-126379546 GACAGTGACCTGAAGCAGGGAGG - Intergenic
961744685 3:129056918-129056940 GAGGGTGTCCTGAAGACAGCAGG + Intergenic
961981305 3:131081993-131082015 GAGGCTGACCTGAAGGGGAATGG - Intronic
961984890 3:131121950-131121972 GAGCGTGAGCTGAAGCAGGGCGG - Intronic
961998324 3:131269524-131269546 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962512258 3:136114111-136114133 GAGGGTGACCCGAAGCAGGGTGG + Intronic
962665963 3:137654052-137654074 GAGGGTGAGCCGAAGAAGGGTGG + Intergenic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
962914140 3:139883414-139883436 GAGGGTGAGCCAAAGCAGGATGG - Intergenic
963306816 3:143662475-143662497 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
963898584 3:150711981-150712003 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964434308 3:156635924-156635946 AAAGGGGATCTGAAGAAGGAAGG - Intergenic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
965221359 3:165931244-165931266 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
966031387 3:175352292-175352314 GAGGCTGAGGAGAAGAAGGAAGG + Intronic
966926936 3:184650639-184650661 GAGGGTGACGCGATGAGGGACGG + Intronic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967756823 3:193179532-193179554 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
968005688 3:195241103-195241125 AAGGCCGACCTGAAGAAGCAGGG + Intronic
968070422 3:195781101-195781123 GATGGTGACATGAAGAGGGGTGG + Exonic
968376078 4:42519-42541 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
968605195 4:1532108-1532130 GAGGGTGACCGGAGAAAGGGAGG + Intergenic
968649415 4:1754513-1754535 GAGGGGGACCTGAACACTGAAGG + Intergenic
968938677 4:3626668-3626690 GAGGGAGACATGAAGCACGAAGG - Intergenic
969301620 4:6300484-6300506 GAGGGCCACCTGGAGAAGGGGGG + Intronic
969525325 4:7701274-7701296 GAGGGAGACGGGAAGAGGGAGGG + Intronic
970044946 4:11841559-11841581 GAGGGTGAACTGAGTAAGCAAGG + Intergenic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970355288 4:15245209-15245231 GAGGGTGGCCTGGAGTGGGAGGG - Intergenic
970496227 4:16628774-16628796 GAGGGTGAGCCGAAGAAGGGTGG + Intronic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
970792031 4:19868803-19868825 GAGGGTGAGCCGAAGCAGGTTGG - Intergenic
970802529 4:19990989-19991011 GACGATGACCTGAACCAGGATGG - Intergenic
970971551 4:21989957-21989979 GAGGGAGACATGAAGGAAGAGGG - Intergenic
971437204 4:26640577-26640599 GAGGGTGAGCCGAAGCAGGGAGG + Intronic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972596105 4:40531206-40531228 AAAGGTGACCTGGAGAAGGAAGG + Intronic
972755477 4:42041904-42041926 GAGGGTGACCCGAAGCAGGGTGG + Intronic
973198357 4:47471968-47471990 GAGAGTGGCAGGAAGAAGGAGGG - Intergenic
973272920 4:48279759-48279781 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
973626118 4:52774128-52774150 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
973798307 4:54451044-54451066 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
973835718 4:54807218-54807240 GAGGGTGAATTGAAGCAGGGTGG + Intergenic
973871381 4:55170081-55170103 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
973883501 4:55297300-55297322 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974279938 4:59779963-59779985 GAGGGTGAGCGGAAGCAGGCTGG + Intergenic
974378838 4:61111564-61111586 GAGGGTGGCCTGCAGAAGATGGG + Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
974528560 4:63077333-63077355 GAGGGTGAGCCGAAGCAGGTTGG - Intergenic
975054924 4:69918269-69918291 GAGGGTGAGCTGAGGAAGTGAGG - Intergenic
975245778 4:72119624-72119646 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
975247975 4:72142402-72142424 GAGGGTGAGCCAAAGCAGGACGG - Intronic
975305828 4:72847809-72847831 GAGTGTGAGCTGAAGCAGGGAGG + Intergenic
975350503 4:73340340-73340362 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
975365003 4:73518808-73518830 GAGGGTGAGCCAAAGTAGGATGG - Intergenic
975425050 4:74215491-74215513 GAGGGCGAACTGAAGCAGGGTGG - Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975751144 4:77524692-77524714 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
975865809 4:78722632-78722654 GAGGGAGGCCTGGAGAGGGAAGG - Intergenic
976061350 4:81131281-81131303 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
976394823 4:84544798-84544820 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
976506509 4:85853448-85853470 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
976534412 4:86194042-86194064 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976580557 4:86730776-86730798 GAGGATGAGCTGAAGCCGGACGG - Intronic
976585337 4:86791014-86791036 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
977057382 4:92211006-92211028 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
977203899 4:94148499-94148521 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
977439048 4:97038387-97038409 GAGGGTGACCAGAAGCAGTGGGG - Intergenic
977540261 4:98310159-98310181 GAATGAGACCTGAAGATGGAGGG - Intronic
977771756 4:100868776-100868798 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
977877581 4:102166946-102166968 GAGGGTCATCTGATGATGGAAGG - Intergenic
977946429 4:102919579-102919601 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
978110780 4:104961745-104961767 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
978138986 4:105296790-105296812 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
978197925 4:105991972-105991994 CAGGAGGACATGAAGAAGGATGG - Intronic
978464498 4:108994126-108994148 GAGGGCTACCTGAAGCAGGGAGG + Intronic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979115199 4:116814962-116814984 GAGGGTGATCCGAAGCAGGGTGG + Intergenic
979377123 4:119960306-119960328 GAGGGTGAGTGGAAGAGGGATGG + Intergenic
979543852 4:121917382-121917404 GAGGGAGAGGTGAAGCAGGAAGG - Intronic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
980584005 4:134789394-134789416 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
981199640 4:141965850-141965872 GAGGGTGAGCCAAAGCAGGAAGG + Intergenic
981671455 4:147292316-147292338 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
981749770 4:148082410-148082432 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
981788065 4:148503165-148503187 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
981796336 4:148599270-148599292 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
981859932 4:149341829-149341851 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
982355954 4:154468915-154468937 GGGAGAGACGTGAAGAAGGAAGG + Intronic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982853044 4:160342772-160342794 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982909302 4:161118542-161118564 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983594264 4:169448827-169448849 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
983602834 4:169549253-169549275 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
983787974 4:171758976-171758998 GAGGGTGAGTTGAAGCAGGGTGG + Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984224390 4:177017357-177017379 GAGGGTGAACCGAAGCAGGGCGG + Intergenic
984372383 4:178884070-178884092 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
984405336 4:179321867-179321889 GAGTTTAACCTGAAGAAGTATGG - Intergenic
984434069 4:179685648-179685670 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
984895768 4:184538106-184538128 GAGGGTGATCTGATGAATGTCGG + Intergenic
985794734 5:1953580-1953602 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986838892 5:11672901-11672923 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
986947614 5:13043844-13043866 AAGGGAGACTTGAAGTAGGAAGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987781529 5:22442688-22442710 GAGGATGATCTGAAGTAGGCAGG + Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988771177 5:34434754-34434776 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
988795152 5:34646674-34646696 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
988797602 5:34666465-34666487 GATGGGGACCTGAAGAAGACAGG + Intronic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
989349957 5:40474727-40474749 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989418198 5:41205397-41205419 GAGTGTGAGCTGAAGAAGGGCGG + Intronic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989675335 5:43966227-43966249 GAGGGTGAGCCAAAGCAGGATGG - Intergenic
989687710 5:44108848-44108870 GAAGGTGACCAGAAGCAGGGTGG - Intergenic
989980404 5:50636593-50636615 GAGGGTCAAATGAAGAAGCATGG - Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990713065 5:58606070-58606092 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
991105411 5:62837237-62837259 GAGGGTGAGCTGAAGCACGGTGG + Intergenic
991151422 5:63375836-63375858 GAGGGGGAGCTGAAGCAGGGTGG + Intergenic
991575806 5:68102374-68102396 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992254971 5:74912065-74912087 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992292513 5:75293544-75293566 GAGGGCGAGCTGAAGAAGAGTGG - Intergenic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
993081189 5:83302486-83302508 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
993366755 5:87042993-87043015 GAGGGTGAGCTGAAGCAGGTCGG - Intergenic
993546568 5:89220051-89220073 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
993888243 5:93442217-93442239 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
994005247 5:94829263-94829285 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994138039 5:96309748-96309770 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994142945 5:96361627-96361649 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994377991 5:99037453-99037475 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
994622551 5:102179803-102179825 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
994636533 5:102351462-102351484 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
995134967 5:108671193-108671215 GAGGGTGAGCAGAAGAAGTGTGG - Intergenic
995162585 5:108998444-108998466 GAGGGCGAGCCGAAGAAGGATGG - Intronic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995643014 5:114278841-114278863 GAGGGTGAGCTGAAGTAGGGCGG - Intergenic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997220442 5:132157658-132157680 GAGGGCGACCTGAAGCAGGGTGG - Intergenic
997380830 5:133436369-133436391 GAGGATGACCTGTGGCAGGAAGG + Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998691905 5:144596290-144596312 GAGGGTGAACCGAAGCAGGGTGG - Intergenic
998772746 5:145564948-145564970 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
999327384 5:150651529-150651551 GAGGGTGACCTGGTGAGGGAAGG + Exonic
999755154 5:154658739-154658761 ATGGGTGACCTGGAGAAGGAGGG - Intergenic
1000041008 5:157485213-157485235 AAGGTTGTCCTGAAGAAAGATGG - Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1000591574 5:163165196-163165218 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1000757990 5:165184559-165184581 GAGGGTGGCCAGAAGAGTGAGGG - Intergenic
1001362757 5:171103898-171103920 GAGGGCGAGCCGAAGAAGGGTGG - Intronic
1002417466 5:179127900-179127922 GAGGGTGACCACGAGAAGGTAGG - Intronic
1002944713 6:1750428-1750450 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1003165915 6:3678147-3678169 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1003434444 6:6072715-6072737 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1003535003 6:6969100-6969122 GAGGGTGCCCTGAGGGAGGGAGG - Intergenic
1003647463 6:7925842-7925864 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1003751274 6:9059753-9059775 GAGGGTGAGATGAGGCAGGAGGG + Intergenic
1003860308 6:10316860-10316882 GAATGTCACCAGAAGAAGGAGGG + Intergenic
1003970973 6:11299010-11299032 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1004152731 6:13135422-13135444 GGGGCTGACCTGAAGAATTACGG - Intronic
1004171168 6:13296567-13296589 TAGGGAGACCTGAACTAGGATGG - Intronic
1004284537 6:14308571-14308593 GAGGGTGCCCAGGAGAAGGTGGG - Intergenic
1004780780 6:18906119-18906141 GAGGGTCACATGAAGAAAGCTGG - Intergenic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1005027568 6:21478111-21478133 GAGGGGAGGCTGAAGAAGGATGG - Intergenic
1005732273 6:28709678-28709700 GAGGAGGACGAGAAGAAGGAAGG - Intergenic
1005747093 6:28848590-28848612 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1005768311 6:29037369-29037391 GAGGGTGGCAGGAGGAAGGAGGG - Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007788584 6:44296484-44296506 GCTGGGGACCTGAGGAAGGATGG - Intronic
1007943858 6:45807708-45807730 TCTGGTGACCTGAAGCAGGATGG + Intergenic
1008090202 6:47286027-47286049 GAGGTGGAGCTGGAGAAGGACGG + Exonic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008575558 6:52856853-52856875 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1008865334 6:56203812-56203834 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009290009 6:61869703-61869725 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1009628622 6:66166650-66166672 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010006148 6:70997839-70997861 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1010171862 6:72984683-72984705 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010422186 6:75688366-75688388 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010447080 6:75960165-75960187 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1010522139 6:76850254-76850276 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010676938 6:78756269-78756291 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1010747205 6:79577793-79577815 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1010755724 6:79664138-79664160 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1010917793 6:81641999-81642021 AAGAATGAACTGAAGAAGGAAGG + Intronic
1010961486 6:82151063-82151085 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1011183418 6:84647658-84647680 GAGGGTGAACTGACCAAGAATGG - Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011298319 6:85847428-85847450 GAGAGTGAGCTGAAGAAGGGTGG - Intergenic
1011348016 6:86392744-86392766 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011417700 6:87139829-87139851 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011578107 6:88827235-88827257 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012207548 6:96479190-96479212 GAGGGTGAACTGAAGCAAGGTGG - Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012414970 6:99003200-99003222 GAGGGTGCCCTGATGAAGACTGG + Intergenic
1012484136 6:99702270-99702292 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1012585289 6:100914105-100914127 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1012725908 6:102809418-102809440 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
1012940965 6:105415153-105415175 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014122798 6:117745870-117745892 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1015623484 6:135156631-135156653 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1015801994 6:137069979-137070001 GAGGGTGAGCTGAAACAGGGTGG + Intergenic
1016006046 6:139090401-139090423 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1016074070 6:139775542-139775564 GAGGGTAACTGGAAGCAGGAAGG + Intergenic
1016111383 6:140229983-140230005 GAGGGCGAGCCGAAGCAGGATGG + Intergenic
1016312534 6:142749563-142749585 GATGGAGACCTGGAGAAAGAAGG - Intergenic
1016334839 6:142993891-142993913 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1016542084 6:145177792-145177814 GAGGGTGAGCTGAAACAGGGTGG + Intergenic
1017279602 6:152609139-152609161 GAGGGTGAGCTGACGAAGCAGGG + Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1018094601 6:160374302-160374324 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1018114722 6:160572170-160572192 GAGGGTGACCTGAAGCAGGGTGG - Intronic
1018175837 6:161178595-161178617 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020231711 7:6324211-6324233 GAGGGTGAGCTGAGAAAAGAGGG - Intergenic
1020367318 7:7394229-7394251 GAGGGTGAGTTGAAGTAGGGTGG - Intronic
1020693960 7:11392240-11392262 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021071607 7:16248734-16248756 GAGGGCGAGCTGAAGAAGGGTGG + Intronic
1021207772 7:17806802-17806824 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022136069 7:27449518-27449540 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1022291298 7:29006249-29006271 GAGGGTAAACTGAAGAGAGAGGG - Intronic
1023051841 7:36259139-36259161 GAGGGCGAGCTGAACCAGGATGG - Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023760690 7:43462656-43462678 GAGGGCGCCCTGCAGTAGGATGG - Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1023967606 7:44971010-44971032 GAGGGTGGGCTGCAGAAGGAGGG - Exonic
1024372968 7:48607339-48607361 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1026528376 7:71175541-71175563 GAGGATGAAATAAAGAAGGAAGG + Intronic
1027843270 7:83341461-83341483 GAGGGCGAGCTGAAGCAGTATGG + Intergenic
1027864656 7:83630081-83630103 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1028013635 7:85679804-85679826 GAGGGTGAGCTGAAACAGGGCGG - Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028476416 7:91258172-91258194 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1028630086 7:92925197-92925219 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1028648122 7:93120714-93120736 GAGGGTGAGCTGAAGCTGGGTGG + Intergenic
1029306018 7:99620585-99620607 GAGGCTGAACTACAGAAGGACGG - Intronic
1030166441 7:106560416-106560438 GAGGGCGAGCTGAAGCAGGATGG - Intergenic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030533952 7:110743633-110743655 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1030612720 7:111706489-111706511 GAGGGTGAGCTGAAGCAGGTTGG - Intergenic
1030703166 7:112662857-112662879 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1031467202 7:122127084-122127106 GAAGGTTACCTGTAAAAGGAAGG - Intronic
1031612570 7:123844996-123845018 GAGGGCGAGCTGAAGCAGGCGGG - Intronic
1032312668 7:130802820-130802842 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1033150859 7:138913944-138913966 GAGGGAGACAGGAAGGAGGAGGG + Intronic
1033887493 7:145966733-145966755 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034685865 7:152970816-152970838 GAGGGTGGCAAGAGGAAGGAGGG + Intergenic
1034715192 7:153235290-153235312 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1034746929 7:153530831-153530853 GAGGGTGAGCTGAAAGAGAATGG - Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035558876 8:590031-590053 GAGTGTGAGCTGAAGAAGGGCGG - Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036476179 8:9095608-9095630 GAGGATCACCTGAAGCAGGGAGG - Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037557679 8:20041289-20041311 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1037883106 8:22582358-22582380 GAGCGGGACCCCAAGAAGGAGGG + Intronic
1038236208 8:25759007-25759029 GAGGGTGCTCTCCAGAAGGAAGG - Intergenic
1038761119 8:30384788-30384810 GAGGGCGACCTGGAGAGGGAGGG - Exonic
1039154045 8:34535545-34535567 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039639793 8:39206631-39206653 GAAGGTGACCTCAAGGATGAAGG - Intronic
1039680916 8:39735501-39735523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1040354929 8:46608294-46608316 GAGGGAGAGCTGAAGCAGGGTGG + Intergenic
1040384026 8:46901067-46901089 GAGAGAAACCTGAAGTAGGAGGG - Intergenic
1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041634793 8:60130635-60130657 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1041944273 8:63424215-63424237 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1041997661 8:64083819-64083841 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1042308758 8:67358915-67358937 GAGGGCGATCTGAAGCAGGGCGG - Intergenic
1042510494 8:69606235-69606257 GAGGGAGAGCTGTTGAAGGAAGG + Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043048818 8:75359823-75359845 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1043244442 8:77979698-77979720 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044956651 8:97488121-97488143 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045646980 8:104308735-104308757 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045690951 8:104759313-104759335 GAGAGTGAAATGGAGAAGGAGGG + Intronic
1045797655 8:106065101-106065123 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045802529 8:106117936-106117958 GAGTGTGAACTGAAGCAGGGTGG - Intergenic
1045975185 8:108123321-108123343 GAGGGAGAGCTGAAGCAGGGTGG - Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046277725 8:111985433-111985455 GAGGGTGAGCCAAAGAAGCACGG + Intergenic
1046879257 8:119290291-119290313 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1046880868 8:119306947-119306969 AAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1047133600 8:122051216-122051238 GAGGGTGAACTGAAGCACGGTGG + Intergenic
1047198842 8:122746514-122746536 GAGGGTGACCAGCAGAATGCAGG - Intergenic
1048053675 8:130843910-130843932 GAGAGTGACCTGAAGGAGTTGGG + Intronic
1048286156 8:133143242-133143264 GAAGGACACCTGAAGGAGGAAGG - Intergenic
1049702562 8:144021780-144021802 GAGAGAGACCTGAAGTGGGAGGG - Intronic
1049702616 8:144022006-144022028 GAGAGAGACCTGAAGTGGGAGGG - Intronic
1049702662 8:144022182-144022204 GAGAGAGACCTGAAGTGGGAGGG - Intronic
1049702768 8:144022627-144022649 GAGAGAGACCTGAAGTGGGAGGG - Intronic
1050234474 9:3563176-3563198 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1050597263 9:7216405-7216427 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1050645274 9:7713072-7713094 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051112165 9:13651411-13651433 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1051124767 9:13791687-13791709 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051308766 9:15746771-15746793 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1051366743 9:16326642-16326664 GAGGGTGGCTGGGAGAAGGAGGG + Intergenic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052146992 9:25061627-25061649 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1052887692 9:33666172-33666194 GAGGGTGAGCTGAACCAGGGCGG + Intergenic
1053608245 9:39681685-39681707 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1053866085 9:42438045-42438067 GAAGGTGAGCTGAAGTAGGGTGG - Intergenic
1054245286 9:62660724-62660746 GAAGGTGAGCTGAAGTAGGGTGG + Intergenic
1054452062 9:65408667-65408689 GAGGGAGACATGAAGCACGAAGG + Intergenic
1054559414 9:66695255-66695277 GAAGGTGAGCTGAAGTAGGGTGG + Intergenic
1054887304 9:70212592-70212614 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1054918966 9:70522792-70522814 GAGGGTGACATGCCCAAGGAGGG - Intergenic
1054986068 9:71262812-71262834 GAGAGTGAGCTGAAGCAGGCTGG - Intronic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055642881 9:78334481-78334503 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1055733427 9:79302853-79302875 GAAGGTGAACTGAGGAAGTAGGG - Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056003608 9:82243297-82243319 GAAGGTGAGCTGAAGCAGGATGG - Intergenic
1056078416 9:83063901-83063923 GAGGGTCTCCTGGAAAAGGATGG - Intergenic
1056241845 9:84655537-84655559 GAGGGTCACCGGGAGAGGGAAGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056997864 9:91479948-91479970 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1057026291 9:91736324-91736346 GAGGGTGACCTGAACTTAGAAGG + Intronic
1057348931 9:94278319-94278341 GAGGGAGACATGAAGCAGGGTGG - Intronic
1057698186 9:97342147-97342169 GAGGGTGAGCCGAAGAAGGGCGG - Intronic
1057969280 9:99538095-99538117 AATAGTGACCTGAAGAAGTAGGG + Intergenic
1058123996 9:101170848-101170870 GAGGATGACTTGAACCAGGAAGG + Intronic
1058203035 9:102067153-102067175 GAAGGTGAGCTGAAGCAGGGCGG - Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1059080387 9:111242959-111242981 GGGGCTTACCTGAGGAAGGAGGG + Intergenic
1060886225 9:127154291-127154313 CAGGGTGTCCTGGAGAAGGGTGG + Intronic
1061520463 9:131114588-131114610 GAGTTTGACCTGAACAATGAAGG + Exonic
1061552430 9:131345363-131345385 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1061580822 9:131534793-131534815 TAGGGTGGCTTGAAGGAGGAGGG - Intergenic
1061817808 9:133206956-133206978 GAGGGTCACCTTAAGGGGGAGGG - Intronic
1061842738 9:133369067-133369089 GAGGGTGACCTGAACACCCAGGG - Intronic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1203573148 Un_KI270744v1:151631-151653 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1185911061 X:3981847-3981869 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1186370094 X:8937687-8937709 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186908480 X:14136400-14136422 GGGGATGACCTCATGAAGGACGG + Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187556236 X:20354805-20354827 GTGGGTGAAGTGAGGAAGGAGGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187673116 X:21688339-21688361 GATGGTGACCTGAAGAAATTGGG + Intergenic
1187829207 X:23363625-23363647 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
1187840019 X:23477200-23477222 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1188123054 X:26334150-26334172 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1188910250 X:35838720-35838742 GAGGGTGGCACGAAGAAGGATGG + Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1188954610 X:36418835-36418857 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189575190 X:42343666-42343688 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189754051 X:44252977-44252999 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1189978506 X:46486361-46486383 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1190071321 X:47282202-47282224 GAGGGAGAAAGGAAGAAGGATGG - Intergenic
1190648999 X:52550908-52550930 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1190683451 X:52849531-52849553 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191073762 X:56430051-56430073 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191645621 X:63478164-63478186 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191686658 X:63899282-63899304 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1191705040 X:64085545-64085567 GAGGGTGAGTTGAAGCAGGATGG + Intergenic
1191793699 X:64999287-64999309 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1191873016 X:65765674-65765696 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1191882455 X:65856630-65856652 GAGGGTGAGCTGAAGCAGGGAGG - Intergenic
1191907443 X:66108279-66108301 GAGGGTGAGGTGAAGCAGGGTGG - Intergenic
1191941756 X:66489041-66489063 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192129063 X:68530761-68530783 GGGGGTGAGCTGAAGCAGGGTGG - Intronic
1192223594 X:69213735-69213757 GAGAGTGACCTGGACAAGGATGG + Intergenic
1192327501 X:70145364-70145386 GATGGTGACCTGAAATAGGAAGG - Intronic
1192371893 X:70521111-70521133 GAGGGTGAGCTGCTGAAGCAGGG - Intergenic
1192524468 X:71829810-71829832 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1192554435 X:72078636-72078658 GAGGGTGACCTTGGCAAGGATGG - Intergenic
1192598470 X:72437184-72437206 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1192701837 X:73482466-73482488 AAGGGTGAGCAGAAGAAGGGTGG - Intergenic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192727469 X:73768066-73768088 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192825879 X:74695860-74695882 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192975060 X:76273990-76274012 GAGGGTGAGTTGAAGCAGGTTGG - Intergenic
1192977364 X:76300314-76300336 GAGGCTGAGCTGAAGCAGGGTGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1192999691 X:76550719-76550741 GAGGGTGAGATGAAGCAGGGTGG - Intergenic
1193003727 X:76591725-76591747 GAGGGTGACCCAAAGCAGGGTGG - Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193081670 X:77412335-77412357 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1193266772 X:79481847-79481869 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193402567 X:81063841-81063863 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1193477202 X:81981601-81981623 GAGGGCAAGCTGAAGAAGGGTGG + Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1193646698 X:84079160-84079182 GAGGGCGAGCTGAAGGAGGGTGG + Intronic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194208586 X:91040470-91040492 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1194254791 X:91622625-91622647 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194355702 X:92881812-92881834 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194391082 X:93319272-93319294 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1194837558 X:98699409-98699431 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194959146 X:100215080-100215102 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1195097981 X:101524483-101524505 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1195508228 X:105684203-105684225 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1195529882 X:105941907-105941929 GAGGGGGAAGTAAAGAAGGATGG - Intronic
1195547297 X:106126817-106126839 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195842670 X:109191853-109191875 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1195947368 X:110229677-110229699 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196139639 X:112246691-112246713 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1196491397 X:116271594-116271616 GAGAGAGAAATGAAGAAGGAAGG - Intergenic
1196960298 X:120993348-120993370 GAGGGCGAGCTGAAGCACGATGG - Intergenic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1198085549 X:133278837-133278859 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1198098766 X:133405583-133405605 GAGGGTGACCAGAAGCTGAATGG - Intronic
1198293737 X:135263788-135263810 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1198402130 X:136278527-136278549 GAGGATGTCATTAAGAAGGACGG + Intergenic
1198402182 X:136278889-136278911 GAGGATGTCATTAAGAAGGAGGG - Intergenic
1198571251 X:137959825-137959847 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199022997 X:142904469-142904491 GAGGATGACTGGAAGAAGGCTGG + Intergenic
1199180952 X:144853792-144853814 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1199292304 X:146119007-146119029 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199316564 X:146385433-146385455 GAAAGTGAGCAGAAGAAGGAGGG + Intergenic
1199383738 X:147200442-147200464 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199436528 X:147819213-147819235 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1199911876 X:152295669-152295691 GAGGGTGACCCGAAACAGGGCGG - Intronic
1199939653 X:152612568-152612590 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1200388581 X:155918603-155918625 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200573577 Y:4862228-4862250 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1201314470 Y:12630071-12630093 GAAGGTGAGCTGGAGCAGGATGG - Intergenic
1201353420 Y:13071772-13071794 GAGGGTGAGATGAAGCAGGGTGG + Intergenic
1201393147 Y:13520269-13520291 GAGTGTGAGCTGAAGCAGGCAGG - Intergenic
1201453283 Y:14140168-14140190 AAGGCTTTCCTGAAGAAGGATGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201776194 Y:17668552-17668574 GAGTGTGAGCTGAAGAAGGGTGG - Intergenic
1201825362 Y:18237440-18237462 GAGTGTGAGCTGAAGAAGGGTGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic