ID: 1128904811

View in Genome Browser
Species Human (GRCh38)
Location 15:71457431-71457453
Sequence AGCCCCAGCCAGAATGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128904811_1128904816 25 Left 1128904811 15:71457431-71457453 CCTTGCCCATTCTGGCTGGGGCT 0: 1
1: 0
2: 3
3: 27
4: 295
Right 1128904816 15:71457479-71457501 GCCGTCCAGTCTCCTTGCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128904811 Original CRISPR AGCCCCAGCCAGAATGGGCA AGG (reversed) Intronic
900324386 1:2100921-2100943 AGCCCCAGCCTGAAGGAGCGGGG - Intronic
900358820 1:2278201-2278223 TGCCCCACCCATCATGGGCAGGG + Intronic
900762654 1:4483347-4483369 AGCCCCAGCCAGTGTGGGAGTGG - Intergenic
901401786 1:9019631-9019653 AGACACAGCCAGGCTGGGCATGG + Intronic
901916621 1:12505170-12505192 AGCGCCAGCCAGAACTGGCGGGG - Intronic
903372268 1:22844345-22844367 AGCCTCAGCCAGGAAGAGCAGGG + Intronic
903780261 1:25816143-25816165 AGCCCCAGCCAGGAGGGGCCAGG + Exonic
904813761 1:33180913-33180935 AGGCCCAGTCAGAATGGTCCTGG - Intronic
905127469 1:35725664-35725686 AGGGCCAGCCTGAATGGGCTTGG + Intronic
906287296 1:44595652-44595674 ACCCTCAGCCAGAATGGACAGGG + Intronic
906492685 1:46280370-46280392 GGACCCAGCCAGAATGGTGAAGG - Intronic
909583005 1:77259306-77259328 AGATCCAGCCAGGATGGACAGGG + Intergenic
910000091 1:82331082-82331104 AGACCCAGCCACAATGGGAGAGG - Intergenic
913166570 1:116192584-116192606 AGCCCCAGTGATAAAGGGCAGGG + Intergenic
913329478 1:117655151-117655173 AGCCCCACTCAGCATGGGTAGGG - Intergenic
914390372 1:147216186-147216208 AGACCCAGGCAGAATCCGCAAGG - Intronic
920008543 1:202851156-202851178 AGCCCCTGCCAGAAAGGCGAGGG - Intergenic
920561665 1:206943086-206943108 AGCCCCAGCCACCCTGGGCTGGG - Intronic
921112169 1:212049211-212049233 AGTCCAAGCCAGGCTGGGCATGG - Intronic
921168502 1:212525161-212525183 AGCCACAGTCAGACTGGCCAAGG - Intergenic
921194013 1:212735494-212735516 AGCCCAAGCCATAAAGGGCCAGG + Intronic
921473199 1:215572721-215572743 AACCCCAGCCAAAATGGCTAAGG - Intronic
922211488 1:223490091-223490113 AGACCCAGGCAGGGTGGGCAGGG + Intergenic
923033305 1:230266704-230266726 GTCCCCATCCAGCATGGGCATGG + Intronic
923317590 1:232796272-232796294 AGCCCCAGCCATGACGGGAAGGG + Intergenic
1063116275 10:3074219-3074241 AGCTCCAGGCAGAAAGGGCCTGG - Intronic
1063947721 10:11193537-11193559 AGCCCCAGACGGAGTGGGGAGGG - Intronic
1065047184 10:21754839-21754861 AGCCTCAGCCAGCAGGGACAGGG - Intergenic
1066049169 10:31619167-31619189 AGCCCCACCCATGAGGGGCAAGG - Intergenic
1066382340 10:34912150-34912172 TGCCCCAGCCAGAAGGGACTTGG + Intergenic
1067045659 10:42983817-42983839 AGCCCCAGCCAAAAAAGGCGTGG - Intergenic
1067225979 10:44375837-44375859 ACCCCCATGCAGACTGGGCAGGG - Intronic
1067243140 10:44513342-44513364 AGCCCTAGCAAGGGTGGGCATGG + Intergenic
1069662276 10:70131740-70131762 AGCCCCAGCCAGGGTGGGCTGGG - Intronic
1070954760 10:80456300-80456322 TGCCCCAGGAAGAAAGGGCATGG + Intronic
1071329574 10:84546406-84546428 AGTGACAGCCAGACTGGGCAGGG + Intergenic
1072763253 10:98075755-98075777 AGCCCCAGCCAGTTAGGTCAGGG + Intergenic
1073319227 10:102604190-102604212 GGCCCCAGCCAGACTCTGCAGGG + Intronic
1073424638 10:103449051-103449073 TACCCCAGCCAGATTGAGCATGG - Intronic
1074351622 10:112743415-112743437 AGCCCCAGCCACAAAGTGGAAGG - Intronic
1075084644 10:119406484-119406506 AGCCCCAGGGAGAATGGGACAGG - Intronic
1075275008 10:121085506-121085528 GGCCACAGCCACAATGGGCGGGG - Intergenic
1075558619 10:123451332-123451354 AGCCCCAGACCGACAGGGCAGGG - Intergenic
1075686972 10:124371119-124371141 AGCCACAGCCAGAATCAGCTGGG + Intergenic
1075742408 10:124703928-124703950 AGCCCCTGCCAGGAGGAGCACGG - Intronic
1076480425 10:130781644-130781666 TGCACCAGGCAGAAAGGGCAGGG - Intergenic
1076566110 10:131400633-131400655 AGCCCCAACCTGAGTGGGGAGGG + Intergenic
1077109183 11:854561-854583 GGCCCCAGCCTGGAGGGGCACGG + Intronic
1077555093 11:3222154-3222176 AGCCTCAGCCACAGTGCGCAAGG + Intergenic
1078128788 11:8594486-8594508 AGCCCCAGCCAGTTGGAGCAAGG + Intergenic
1080569345 11:33542219-33542241 CATCCCAGCCAGTATGGGCAGGG + Intronic
1081572853 11:44302314-44302336 GGACCCAGAGAGAATGGGCACGG + Intronic
1083511951 11:63217618-63217640 AGCCCCAGCCAAGAAGCGCAGGG + Exonic
1084537043 11:69763454-69763476 AGCAGCAGCCAGAAGAGGCAAGG + Intergenic
1084630605 11:70346152-70346174 AGGCCAAGCCAGCGTGGGCAGGG - Intronic
1084741932 11:71145771-71145793 GGCCCCAGCCACGATGGGGAAGG - Intronic
1085792846 11:79510878-79510900 GGGCCCAGCCAGAATTAGCACGG + Intergenic
1086888306 11:92227012-92227034 GGCCCCAGCCAGACTAGGGAGGG + Intergenic
1087094506 11:94306467-94306489 AGGCCCAGGCAAAAGGGGCAAGG - Intronic
1089313785 11:117577036-117577058 TGCCCCAACCAGAATGGCAATGG + Intronic
1089732090 11:120525461-120525483 AGCCCCATTCATACTGGGCAGGG + Intronic
1089831107 11:121328981-121329003 AGCACCAGGCAGAATGGGAGAGG - Intergenic
1090456515 11:126855010-126855032 AGCCCCAGCCCGAAGGCCCAGGG + Intronic
1092335487 12:7629073-7629095 AGACCCAGCCAGAGTGGACAGGG - Intergenic
1092446680 12:8564507-8564529 AGACCCAGCCAGAGTGGACAGGG + Intergenic
1092847940 12:12601492-12601514 AGCCCCAAACAGGACGGGCATGG + Intergenic
1096579633 12:52576325-52576347 AGCCACAGCAAGGATGGGCAGGG + Intergenic
1097245454 12:57605206-57605228 AGGCACAGCCCGGATGGGCAAGG - Intronic
1097916357 12:65024400-65024422 GGCCTCAGCCAGGGTGGGCAGGG - Intergenic
1101579922 12:106033300-106033322 AGCCCCAGACAGAGAGGCCATGG - Intergenic
1102901875 12:116645208-116645230 AGCCCCAGCTAGACTAGGAAGGG + Intergenic
1104467640 12:129003808-129003830 AGCCCCAGGCAGGAAGGGCTTGG + Intergenic
1104485773 12:129150228-129150250 AGCCCCATCCAGAGTGTGCTGGG + Intronic
1104793124 12:131496463-131496485 ACACCCAACCAGAATGGGCAAGG + Intergenic
1105405739 13:20131233-20131255 AGCCGCAGCCTTAATGGGCCTGG - Intergenic
1105645348 13:22312117-22312139 AGCCCCAGCCAGAAGCAGCTGGG - Intergenic
1107756481 13:43628985-43629007 AGCCCCAGCAAGAAGGGGCAGGG + Intronic
1108069371 13:46612459-46612481 AGCCCACGACAGAATAGGCAAGG - Intronic
1109792123 13:67262752-67262774 TGCCCTAGCCAGAGTGGGGAGGG - Intergenic
1110089797 13:71431477-71431499 AGCCCCAGCCAGCAGAGGGAAGG - Intergenic
1111005106 13:82237033-82237055 AGCCACATCCAGCATGTGCAGGG - Intergenic
1113460682 13:110479896-110479918 TGCCCCAGCCAGAGCTGGCAAGG + Intronic
1114658355 14:24329488-24329510 AGCCCCTGCCAGCAGGGCCAGGG + Exonic
1115096959 14:29648942-29648964 AGCCCCAGCCAGGCCGGGCATGG - Intronic
1115129041 14:30031546-30031568 AGCCCCAGGCAGAAAGACCATGG + Intronic
1117043178 14:51786535-51786557 AGCCCCAGCCAATAGGGGGAAGG - Intergenic
1117761308 14:59031658-59031680 AGCCCCAGACAGATTTGACATGG + Intergenic
1118199160 14:63656225-63656247 AGCCCCTGCGAGAATGCTCAGGG + Intergenic
1118574278 14:67226064-67226086 AGGCCCTGCCAAGATGGGCAAGG - Intronic
1118710302 14:68513426-68513448 AGCCCCAGCCAAATGGGCCATGG + Intronic
1119516284 14:75251237-75251259 AGCCCCAGCCCAGATGGACAAGG + Intronic
1121356095 14:93216334-93216356 AGCACCAGATAGACTGGGCATGG - Intronic
1121632643 14:95432355-95432377 AGCCCAAGCCAGGTTGGCCATGG - Intronic
1123003632 14:105310666-105310688 AGCCCCAGCCAGATGGCGCCCGG + Exonic
1123043197 14:105498982-105499004 AGACCCAGCCAGGCTGGGCCAGG - Exonic
1125430617 15:39589651-39589673 AGCCTCAGGGAGAATGGGGAGGG + Intronic
1128904811 15:71457431-71457453 AGCCCCAGCCAGAATGGGCAAGG - Intronic
1129481179 15:75827726-75827748 AGCTCCAGCCAGAAAGAGCTAGG - Intergenic
1130183028 15:81651181-81651203 ACCCCAAGTCAGAAAGGGCAGGG - Intergenic
1130619753 15:85450129-85450151 ACCCCCACCCAGACTGAGCAAGG - Intronic
1131207701 15:90465388-90465410 AGGCCCAGACAGACTGGGAAGGG - Intronic
1132896596 16:2232248-2232270 AGCCCCCGCCAGCAGGGGCTGGG + Exonic
1133688718 16:8192023-8192045 AGCCCAAGGCAGCATGGCCATGG + Intergenic
1133969808 16:10559377-10559399 AGCTCCAGCCACAGTGAGCATGG - Intronic
1134883698 16:17771038-17771060 GGGCCCATCCACAATGGGCAGGG + Intergenic
1137600132 16:49750798-49750820 AGCTCCAGCCAGAGTGGTGAGGG + Intronic
1138434478 16:56989448-56989470 AGCCCGAGCCAGATGGGGCTCGG - Intergenic
1139031474 16:62887018-62887040 AGGCCCATCCACAATGGGGATGG - Intergenic
1140482212 16:75267701-75267723 TGCCCCAGCCAGAATGGGGCGGG + Intronic
1140817997 16:78638372-78638394 AGACCCAGCCAGAGGGGGAAAGG - Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1141904854 16:87017777-87017799 AGCTCCAGGCAGAAGGGCCAGGG - Intergenic
1142024204 16:87803828-87803850 AGGCCCAGCCAGAATGCACAGGG + Intergenic
1142067289 16:88069968-88069990 AGCCCCAGTCAGCATGCGGACGG + Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142139774 16:88467720-88467742 GGTCCCAGCCACAAAGGGCACGG - Intronic
1142216759 16:88833927-88833949 ACCACCAGCCAGCAGGGGCAAGG - Intronic
1143205539 17:5137602-5137624 AGCCCCAGCCTGGAAGGGCCAGG + Intronic
1143539175 17:7559247-7559269 GGCCCCTCCCAGAATGGGGAAGG + Exonic
1144369895 17:14580053-14580075 ACCCCCAGGGAGAATGGGAAAGG - Intergenic
1144772655 17:17768640-17768662 AGTGCCAGCCAGGATGGGCAGGG + Intronic
1144876583 17:18400294-18400316 AGCCCCAGCCTGGAAGGGCCAGG + Intergenic
1144949246 17:18985170-18985192 AGCCAAAGCCAGGATGGGAAGGG + Intronic
1145155643 17:20544126-20544148 AGCCCCAGCCTGGAAGGGCCAGG - Intergenic
1145411571 17:22670434-22670456 AGCCCCATCCACAATGAGAAAGG - Intergenic
1145761251 17:27426411-27426433 AGCCCCAGCCTGGAAGGGCCAGG + Intergenic
1145961027 17:28886640-28886662 AGGCCCAGCCAGGATGGGCCAGG - Intronic
1146161295 17:30560568-30560590 AGCCCCAGCCTGGAAGGGCCAGG + Intronic
1147623554 17:41884409-41884431 TGCCCCAGCAATAATGGACAGGG + Intronic
1147987860 17:44316526-44316548 AGCCCCAGCCAGGTGGGGCTTGG + Intronic
1148331077 17:46814424-46814446 AGCCCCACCCATAATGGGGGCGG + Intronic
1148470507 17:47890184-47890206 AGCCTCAGGAAGAAAGGGCAGGG - Intergenic
1149654775 17:58304527-58304549 AGCCCCAGCCAGAAAACTCAGGG - Intronic
1150583676 17:66498399-66498421 TGCCCCATCAAGAATGGGAAGGG + Intronic
1150740006 17:67771862-67771884 TGCCCCGGCCAGAAAGAGCAGGG + Intergenic
1151118444 17:71765702-71765724 AGCCCCTGCCAGACCTGGCAAGG + Intergenic
1151344179 17:73491732-73491754 ACACCCAGAGAGAATGGGCAAGG - Intronic
1152152208 17:78609297-78609319 AACCCCAGGCAGAAGGGCCAGGG + Intergenic
1152546823 17:81004322-81004344 AGCCGCAGCCAGGAAGGGCGGGG - Intronic
1153341039 18:3975268-3975290 ATCCCCATCAAAAATGGGCAAGG + Intronic
1153964048 18:10164975-10164997 AGCCCCAGCGGGAATGGCCCAGG + Intergenic
1155469199 18:26172980-26173002 AGCCCCATCAAGAGTGGTCAAGG + Intronic
1159842517 18:73416063-73416085 AGCGCCAGTGGGAATGGGCAGGG - Intergenic
1160876056 19:1296688-1296710 AGCCGCACCCAGACTGGGTAGGG + Intronic
1161680735 19:5678509-5678531 TGCCCCGGCCAGAACGGGCAGGG - Exonic
1161903742 19:7139188-7139210 AGCCCCAGCCAAACTGGCCCAGG + Intronic
1162907267 19:13831345-13831367 AGCCCAAGCCAGTCTGGGTAAGG - Exonic
1163795172 19:19333840-19333862 AGCCCCAGCCTGGGTGAGCAAGG - Intronic
1165328951 19:35130833-35130855 AGGCCCAGCCAGAGGGGTCAGGG - Intronic
1166137485 19:40786281-40786303 AGGCCCAGGCAGAAGGGTCAGGG + Intronic
1166339887 19:42131103-42131125 AGGCCCAGGCAGAAGGGTCAGGG - Intronic
1167096303 19:47376625-47376647 AGCCCCAGCCAGAGGGGCCTGGG - Intronic
1167459825 19:49618974-49618996 AACACCAGGCAGAAAGGGCAAGG - Intronic
1167612181 19:50512874-50512896 AGACCAAGACAGAAGGGGCAGGG + Intronic
925615394 2:5740487-5740509 AGCCAGAGGCAGAATGGGTAAGG - Intergenic
925859903 2:8163988-8164010 CTCCCCAGCCTGAATGGGGATGG + Intergenic
928107096 2:28477587-28477609 TTCCCCAGCCTGAATGGGCTTGG - Intronic
928115932 2:28545279-28545301 AGCCTCAGCCAGCAGGGACATGG + Intronic
928192421 2:29184713-29184735 AGCCCCAGGCAGAAGGGAAAGGG - Intronic
928209309 2:29311935-29311957 CTCCCCAGCCAGCATGGGCATGG - Intronic
928329131 2:30344211-30344233 AGCCCAGGTCAGAATGGGCCTGG + Intergenic
928644879 2:33341347-33341369 AGCCCCACCCAGAAAGGAGAAGG + Intronic
929752366 2:44729070-44729092 AGCCCCAGCCTGAATGAGAGTGG + Intronic
929849469 2:45570930-45570952 AGCCCCAGCCATGAGGGGTAAGG + Intronic
931456203 2:62411528-62411550 TTCCCCAGTCTGAATGGGCAGGG - Intergenic
932716334 2:74102657-74102679 AGACCCAGCGAGACTGGGCGGGG - Exonic
932880865 2:75500755-75500777 AGCCTCAGGCAGAAAGGGGAAGG - Intronic
933061847 2:77747806-77747828 AGCCCCACTCTGAATGGGTATGG + Intergenic
933709214 2:85313628-85313650 AGACCCAGCCACATGGGGCAGGG - Intergenic
934476076 2:94594515-94594537 AGTCCCAACTAGAAGGGGCATGG + Intronic
935729528 2:106053887-106053909 AGCACCAGCGGGCATGGGCAAGG + Intergenic
936494881 2:113009801-113009823 AACCCTTGCCAGAATAGGCAGGG - Intergenic
936771681 2:115921014-115921036 ATTCCCAGCCATAATGGGAAGGG - Intergenic
937928726 2:127188255-127188277 AGCTGCACCCAGAATGGGCTGGG + Intronic
938406813 2:131037356-131037378 GGCCTCTGCCTGAATGGGCAGGG - Intronic
942453992 2:176125236-176125258 AGCCCCAGCCTGAAAGTGCCTGG - Intergenic
943478624 2:188389768-188389790 AGCTACATCCAGAATGGGGAGGG - Intronic
944375607 2:199038357-199038379 AGCCCCACCAACAAGGGGCAAGG - Intergenic
944893635 2:204142511-204142533 AGAGCCAGGCAGAATAGGCAGGG - Intergenic
944950267 2:204740554-204740576 GGCCTCAGCTAGAATGGCCAAGG + Intronic
945251792 2:207770270-207770292 AGCTGCAGGCAGAAAGGGCAGGG - Intergenic
946227877 2:218274122-218274144 AGCCCAAGCCAGAATGCAGAAGG + Intronic
946422456 2:219572312-219572334 AGACCCTGGCAGAAGGGGCACGG + Exonic
946789521 2:223285745-223285767 AGTCCCAATCAGAAGGGGCAGGG + Intergenic
948492522 2:238322204-238322226 AGCCACAGCTAGAGTGGGCTGGG - Intronic
948570067 2:238912422-238912444 AGCCCCAGGCAGAAGGGGCAAGG + Intergenic
948576176 2:238950970-238950992 AGCCCCAGAAAGAAAGGGCGAGG + Intergenic
948999309 2:241603219-241603241 AGACACAGCCAAAATGAGCAAGG - Intronic
948999331 2:241603319-241603341 AGACACAGCCAAAATGAGCAAGG - Intronic
948999351 2:241603419-241603441 AGACACAGCCAAAATGAGCAAGG - Intronic
948999372 2:241603519-241603541 AGACACAGCCAAAATGAGCAAGG - Intronic
1169118215 20:3081005-3081027 AGCCCCAGCCAGATGGGGGATGG + Intergenic
1169767761 20:9166562-9166584 CGCCCCTTCCAGAATGGGAAGGG - Intronic
1171448032 20:25218459-25218481 AGACCCAGCCCGAGTGGGGAAGG - Intronic
1172060494 20:32184068-32184090 AGCACCAGCTATAATAGGCATGG - Intergenic
1173444555 20:43106033-43106055 AGCCCCAGACAGACTGTGCCTGG + Intronic
1174326098 20:49780127-49780149 AGCCTGAGCCAAAATGAGCAAGG + Intergenic
1175867077 20:62184591-62184613 AGCCTCAGTCTGAGTGGGCAGGG + Intronic
1176363436 21:6017597-6017619 TGACCAAGCCAGAATGGGCAGGG + Intergenic
1178789690 21:35688443-35688465 AACCCCAGCCAGTAAGGGCACGG + Intronic
1178823072 21:35992737-35992759 AGCCCCAGCTTGAATCGGAAGGG - Intronic
1179005545 21:37510959-37510981 AGCATCAGCCAGAGTGGTCAGGG + Intronic
1179760082 21:43520948-43520970 TGACCAAGCCAGAATGGGCAGGG - Intergenic
1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG + Intronic
1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG + Intronic
1181845896 22:25708346-25708368 AGGCCCAGCCAGGATGGTCCTGG - Intronic
1183103163 22:35596403-35596425 AGCTCCAGGCTGGATGGGCAGGG + Intergenic
1183117703 22:35704483-35704505 AGCCCCAGTCAGACTGTTCATGG + Intergenic
1185205508 22:49535779-49535801 AGCCCCCGGGAGGATGGGCAAGG + Intronic
950016433 3:9757773-9757795 GGCACCAGCCAGGAGGGGCAGGG - Exonic
950645545 3:14374552-14374574 TGCCCCTGCCAGGATGGGCAGGG + Intergenic
950666221 3:14496684-14496706 GGACCCAGCCCCAATGGGCAGGG - Intronic
950668783 3:14512922-14512944 CAGCACAGCCAGAATGGGCATGG - Intronic
950764231 3:15261449-15261471 AGCCCCAGCCAGGAGGGGCTGGG - Intronic
951217298 3:20037466-20037488 AGCACCAGGGAGAATGGGAAGGG + Intergenic
952549441 3:34460232-34460254 AGCACCAGCCATTCTGGGCAAGG - Intergenic
954137508 3:48588827-48588849 AGTCCCAGCCAGGAAGGACAGGG + Intronic
954518026 3:51197677-51197699 AGCACCAGCCATCATGGACAGGG + Intronic
954584377 3:51720863-51720885 AGGCCCACCCAGACAGGGCAAGG - Intergenic
954593308 3:51802640-51802662 AACCCCACCCACAAGGGGCAAGG - Intergenic
955640554 3:61078433-61078455 AGCCACAGAGAGAATGGGTAAGG - Intronic
955994123 3:64660559-64660581 AGCCCCAGGCAGGATGGGGCAGG - Intronic
958130233 3:89409840-89409862 AGGCCCAGCCAGAAAGGGCAAGG - Intronic
959094271 3:101936352-101936374 AGACCCAGCCAGGCTGGGCACGG + Intergenic
961005284 3:123401361-123401383 AGCCCCATCCAGATGGGGAATGG + Intronic
961463576 3:127068287-127068309 AACCCCGGCCTGCATGGGCAAGG + Intergenic
961502980 3:127350644-127350666 AGCAGCAGCCAGAAGGGGAATGG - Intergenic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
964414717 3:156435148-156435170 AGCCCCAGGGAAAACGGGCAGGG + Intronic
965168241 3:165224639-165224661 AGCTCCAGCCAGAATGCATAAGG + Intergenic
966454082 3:180094893-180094915 AGGCCCTGCCACTATGGGCAAGG - Intergenic
966538061 3:181056212-181056234 AGAACCAGCCAGAATGGATAGGG + Intergenic
967531500 3:190553582-190553604 AGCCCCAGCCGGGATGGGACGGG + Intronic
967983224 3:195077872-195077894 AACCCCAGGCAGGCTGGGCACGG - Intronic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
969620184 4:8275033-8275055 AGCCCCAGCGGGAGTGGGCGGGG - Intronic
975655429 4:76636717-76636739 AGTCCCAGTCTGAATGAGCATGG + Intronic
975671699 4:76787032-76787054 AGCTCCGGCCTGAAAGGGCAGGG - Intergenic
976344522 4:83985153-83985175 AGACCCAGCCAGAAGGGGCCAGG - Intergenic
978914280 4:114104800-114104822 AAGCACAGCCAGAATAGGCATGG + Intergenic
979616478 4:122748238-122748260 ATACCCAGCAAGAATGTGCAGGG + Intergenic
981698778 4:147585335-147585357 AGCCCCACCCACACTGGGGAAGG + Intergenic
983124510 4:163933759-163933781 ACCTCCAGCCAGAAATGGCAAGG - Intronic
987590448 5:19918994-19919016 AGCCCCACCCAGACTGGAAATGG + Intronic
988879392 5:35484637-35484659 AGCCCCAGCCAGCATCTTCATGG - Intergenic
989754772 5:44939520-44939542 AGACCCATCCAAAATGTGCATGG + Intergenic
991650553 5:68848142-68848164 ATCCCAAAACAGAATGGGCAAGG + Intergenic
992713457 5:79485013-79485035 AGCCCCCAGCAGACTGGGCAGGG - Intronic
994261311 5:97661989-97662011 AGCCCAAGCTAGGCTGGGCACGG - Intergenic
994353807 5:98773731-98773753 GGCCCCAGCCAGCGTGGGCTCGG - Intronic
997346499 5:133196163-133196185 AGCCCCAGGCAGGGTGGGCTGGG + Intergenic
997518903 5:134509547-134509569 AGTGCCAGCCAGCATAGGCAAGG + Intergenic
998150327 5:139753403-139753425 AGGCCCAGCCACACTGGCCATGG - Intergenic
998192777 5:140041944-140041966 AGACCCTGCCAGCCTGGGCACGG + Intronic
1000302140 5:159965776-159965798 CGCCCCAGCAGGGATGGGCAAGG + Intronic
1001452117 5:171834964-171834986 GGCCACAGCCAGAATTGGCCTGG - Intergenic
1002936885 6:1681609-1681631 AGCCCCAGGCAGAGAGGCCAGGG + Intronic
1003550951 6:7101556-7101578 CACTCCAGCCAGAGTGGGCAGGG - Intergenic
1006377983 6:33682430-33682452 GGGCCCAATCAGAATGGGCATGG - Intronic
1006640097 6:35485427-35485449 AGCCCAAGTCAGCATGGTCAAGG + Intronic
1011479037 6:87776080-87776102 ACCCCCACCCAGAATGGCCCAGG - Intergenic
1015046318 6:128780189-128780211 CGCCTCACCCAGGATGGGCAAGG - Intergenic
1016857368 6:148684506-148684528 AGCCCCACCCAGATTCTGCAGGG - Intergenic
1017468003 6:154712888-154712910 ATGCCCAGCCAGAATGCGTAAGG - Intergenic
1018201177 6:161397037-161397059 AGCCTCAGCCAAAATGATCAAGG + Intronic
1019597531 7:1865123-1865145 AGTCCCAGACAGGATGGGCCTGG - Intronic
1019726701 7:2606755-2606777 AGCCCCAGCCAGGAGGTGGAGGG + Intronic
1019922822 7:4173785-4173807 AGCCACAGCCTGGATGGCCAGGG + Intronic
1020363120 7:7351265-7351287 AGCAGCAGCCAGAATGAGAAAGG + Intergenic
1023811474 7:43915566-43915588 AGCCCCAGCTGGGAGGGGCAGGG - Intronic
1024001661 7:45194038-45194060 AGCCGCAGCCTGAACGGGAAAGG + Intergenic
1024115345 7:46187567-46187589 TTCCCCTGCCAGAATGGGCCAGG + Intergenic
1024618933 7:51140691-51140713 AGCACCAGGCAGCAGGGGCACGG + Intronic
1024715159 7:52071252-52071274 AGCCCCACCCACATTGGGAAGGG - Intergenic
1025227996 7:57180287-57180309 AGCCCCAGCCAAGAAGGGCAAGG + Intergenic
1025258003 7:57398688-57398710 AGCCCCAGCCAAGAACGGCAAGG - Intergenic
1026170330 7:67948432-67948454 AGACCCAGGCAGAATCTGCAAGG - Intergenic
1026943645 7:74302910-74302932 AGCCCCAGGAAGAATGGGGTGGG - Intronic
1027651425 7:80873269-80873291 AGGCACAGCCAGACTGTGCAGGG + Intronic
1029225946 7:99028533-99028555 AGCACCAACCAGCATGGGGATGG + Exonic
1029617013 7:101665427-101665449 ATCCTCAGCTAGAATGGGAATGG - Intergenic
1030007399 7:105132724-105132746 AGCCCCATCCAGAGTGTGAAAGG + Intronic
1032074329 7:128829458-128829480 AGCCCCAGCCAGAGCAGCCAGGG - Intergenic
1033600561 7:142885683-142885705 AGCCCCAGCCAGTTTGGAGAGGG + Exonic
1034857333 7:154563890-154563912 ATCCTCAGCCAGACTGCGCATGG + Intronic
1034902794 7:154917908-154917930 AGCCCCAGCCGACATGGGGAAGG + Intergenic
1034996993 7:155583932-155583954 AGCCCCAGCCTGGGAGGGCATGG + Intergenic
1035438130 7:158874690-158874712 AGATCCAGCCAGCAAGGGCAAGG - Intronic
1035831776 8:2702650-2702672 AGGCCGAGCCAGCATGGGTAGGG - Intergenic
1036106917 8:5851037-5851059 TACCTCAGCCAGAATGGGTAAGG + Intergenic
1036368939 8:8146303-8146325 ACCCTCATCCAGACTGGGCACGG - Intergenic
1036881953 8:12519339-12519361 ACCCTCATCCAGACTGGGCACGG + Intergenic
1036985129 8:13520795-13520817 AGCCTCAGCCTCTATGGGCAGGG - Intergenic
1037251043 8:16894679-16894701 TATCCCAGCCAGAATGGCCATGG - Intergenic
1037567031 8:20126656-20126678 AGCCACAGCTAATATGGGCAGGG + Intergenic
1040564391 8:48552964-48552986 AGCACCAGGCAGAGTGGGCAAGG + Intergenic
1041014157 8:53573963-53573985 AGCCCCACCCAGCAATGGCAAGG + Intergenic
1041674161 8:60521275-60521297 AGGCACCGCCAGAGTGGGCATGG + Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044927387 8:97221207-97221229 AGCCCCAGCTGGATTGGACAGGG + Intergenic
1045051238 8:98327749-98327771 AGCCCCAGGCAGCTTAGGCAGGG + Intergenic
1047348122 8:124048253-124048275 AGCCTCAGCCAAAAAGAGCAAGG + Intronic
1047997288 8:130348925-130348947 AGCCCCAGCAAGAATCAGAAGGG + Intronic
1048043593 8:130753189-130753211 AGCACCAGACAGAAAGGGAAAGG - Intergenic
1048540197 8:135335107-135335129 AGCCCCAGGCAGACTGGGACTGG + Intergenic
1049576859 8:143393593-143393615 AGCCCTGCCCAGGATGGGCAGGG - Intergenic
1049778753 8:144418014-144418036 AGCCCCACCCACAATGCTCAGGG - Intergenic
1050094277 9:2047423-2047445 AGCCCCATCCAGAAACCGCAAGG + Exonic
1052336987 9:27330327-27330349 TTCCCCAGCCAGAACGGTCAAGG + Exonic
1052381253 9:27773395-27773417 ACTCCCAGCCAGACTGAGCATGG - Intergenic
1052853963 9:33395403-33395425 AGTCCCAACTAGAAGGGGCATGG - Intronic
1053296513 9:36918370-36918392 AGCTCAAACCAGGATGGGCATGG + Intronic
1055440813 9:76334440-76334462 AACACCAGCCAGGCTGGGCAGGG + Intronic
1056675692 9:88675181-88675203 AGGCCAAGCTGGAATGGGCATGG - Intergenic
1059785477 9:117578362-117578384 AGCCACAGCTAGGATGGCCAAGG - Intergenic
1061516213 9:131091928-131091950 AGCCACAGACAGAATCGGCAGGG - Exonic
1062556575 9:137115614-137115636 AGCCCCACACAGGATGGGCAGGG - Intergenic
1185977219 X:4734774-4734796 AGCCACAGGCAGAATAGGTATGG + Intergenic
1187169410 X:16836601-16836623 AGCCACAGCCAGCAGGGGGACGG - Intronic
1187488234 X:19724918-19724940 ATCCCCAGGCAGCGTGGGCAGGG - Intronic
1190448091 X:50551033-50551055 AGCCTTATCCAGTATGGGCAAGG + Intergenic
1192451169 X:71245955-71245977 GGACCCAGCCAGGAAGGGCAGGG + Intronic
1194668041 X:96697184-96697206 ATAGCCAGCAAGAATGGGCAGGG + Intronic
1196098321 X:111823268-111823290 AGGCCCAGGCAGAATGGGGGAGG + Intronic
1197034797 X:121860290-121860312 AGCCACAGCTGGAATGGCCAAGG + Intergenic
1199778754 X:151038810-151038832 TGAACCAGACAGAATGGGCAGGG + Intergenic