ID: 1128907948

View in Genome Browser
Species Human (GRCh38)
Location 15:71485042-71485064
Sequence CACTAGCCTCTAGAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3065
Summary {0: 1, 1: 0, 2: 3, 3: 118, 4: 2943}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128907948_1128907953 1 Left 1128907948 15:71485042-71485064 CCCAGCTCCTCTAGAGGCTAGTG 0: 1
1: 0
2: 3
3: 118
4: 2943
Right 1128907953 15:71485066-71485088 TTCCAGATTTGGAAGAAAGAGGG 0: 1
1: 0
2: 2
3: 42
4: 2361
1128907948_1128907958 17 Left 1128907948 15:71485042-71485064 CCCAGCTCCTCTAGAGGCTAGTG 0: 1
1: 0
2: 3
3: 118
4: 2943
Right 1128907958 15:71485082-71485104 AAGAGGGCTGGGCTGACTAAGGG 0: 1
1: 0
2: 1
3: 12
4: 165
1128907948_1128907956 6 Left 1128907948 15:71485042-71485064 CCCAGCTCCTCTAGAGGCTAGTG 0: 1
1: 0
2: 3
3: 118
4: 2943
Right 1128907956 15:71485071-71485093 GATTTGGAAGAAAGAGGGCTGGG 0: 1
1: 0
2: 1
3: 41
4: 379
1128907948_1128907952 0 Left 1128907948 15:71485042-71485064 CCCAGCTCCTCTAGAGGCTAGTG 0: 1
1: 0
2: 3
3: 118
4: 2943
Right 1128907952 15:71485065-71485087 TTTCCAGATTTGGAAGAAAGAGG 0: 1
1: 0
2: 5
3: 41
4: 425
1128907948_1128907957 16 Left 1128907948 15:71485042-71485064 CCCAGCTCCTCTAGAGGCTAGTG 0: 1
1: 0
2: 3
3: 118
4: 2943
Right 1128907957 15:71485081-71485103 AAAGAGGGCTGGGCTGACTAAGG 0: 1
1: 0
2: 1
3: 11
4: 210
1128907948_1128907951 -10 Left 1128907948 15:71485042-71485064 CCCAGCTCCTCTAGAGGCTAGTG 0: 1
1: 0
2: 3
3: 118
4: 2943
Right 1128907951 15:71485055-71485077 GAGGCTAGTGTTTCCAGATTTGG 0: 1
1: 1
2: 0
3: 11
4: 136
1128907948_1128907955 5 Left 1128907948 15:71485042-71485064 CCCAGCTCCTCTAGAGGCTAGTG 0: 1
1: 0
2: 3
3: 118
4: 2943
Right 1128907955 15:71485070-71485092 AGATTTGGAAGAAAGAGGGCTGG 0: 1
1: 0
2: 1
3: 44
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128907948 Original CRISPR CACTAGCCTCTAGAGGAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr