ID: 1128909486

View in Genome Browser
Species Human (GRCh38)
Location 15:71499369-71499391
Sequence TGGCATGGCAAAAATGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128909486 Original CRISPR TGGCATGGCAAAAATGTGCT AGG (reversed) Intronic
905861777 1:41356938-41356960 GGGCAGGGAAAAAATGAGCTTGG - Intergenic
906268560 1:44455507-44455529 TGGGATGGAAAAAATGTGGTAGG + Intronic
906734706 1:48114632-48114654 TGGCATGGACAATCTGTGCTTGG + Intergenic
907735238 1:57105731-57105753 TGGCATAGCAAAATCATGCTGGG - Intronic
908463125 1:64365829-64365851 AGGGATGGCAAAAATGTGATGGG + Intergenic
909478257 1:76106857-76106879 TGTCATGGGAAAAGTGTGCATGG + Intronic
910941494 1:92539804-92539826 TGGCATGATAAAAATATTCTAGG - Intronic
913150860 1:116041571-116041593 TGGTTTGGCAACCATGTGCTAGG - Intronic
914961196 1:152209717-152209739 AGGCATTTCAAAAATGTTCTTGG + Intergenic
920183142 1:204144828-204144850 TGGCATGGCAGAAATAAGCAGGG - Intronic
921772214 1:219054068-219054090 TGGCAAGTCCAAAATGTGCGGGG - Intergenic
922988731 1:229886870-229886892 TGGCAGGGCAGAAATGTGGTAGG - Intergenic
923406380 1:233665297-233665319 TGGAAAGGCACAAATGTGCATGG - Intronic
1062983612 10:1746031-1746053 TGGCAGGGCAGCAGTGTGCTGGG + Intergenic
1064646206 10:17462414-17462436 TGGCATGTCAAAAACCTGCACGG - Intergenic
1066587163 10:36948524-36948546 TGACATGTCAAAACTGGGCTAGG + Intergenic
1066697447 10:38091618-38091640 TGGCAGGACAAAAAAGTTCTTGG + Intergenic
1067268621 10:44770162-44770184 TGGCATGGCAAATAGGTGAAAGG + Intergenic
1068657916 10:59593521-59593543 TGGCATGGCTAAGCTGTGCTGGG - Intergenic
1070576981 10:77686885-77686907 TGGCAAGGCAAGAAAGTGATAGG - Intergenic
1072010853 10:91301756-91301778 TGGGATGGCAAAAATTTGGGGGG + Intergenic
1073199331 10:101722182-101722204 TGGCCTCCCAAAAAAGTGCTGGG - Intergenic
1073229668 10:101958506-101958528 TTTCATGGACAAAATGTGCTAGG - Intronic
1073851716 10:107627903-107627925 TGGCAAGTCAAAAATCTGCAAGG - Intergenic
1075900566 10:126039815-126039837 TGGAATGGCAAATCTGTGCTGGG - Intronic
1078253664 11:9639135-9639157 TGGCCTGCCAACAATGTCCTTGG - Intergenic
1079313621 11:19389007-19389029 TGTTATGCCAAAAATGAGCTTGG - Intronic
1079508399 11:21181485-21181507 GGGCATGGCAGAAATGAGATTGG + Intronic
1080636364 11:34127297-34127319 TGGCAGGGCAAAAATGGGATGGG - Intronic
1081894062 11:46569515-46569537 TAGCATGGTAAACATCTGCTAGG - Intronic
1083237241 11:61359061-61359083 TGAAAATGCAAAAATGTGCTGGG + Intronic
1084430471 11:69108019-69108041 AGGCAGACCAAAAATGTGCTTGG - Intergenic
1087989334 11:104729063-104729085 TGTCATGGGAAGAATGTGGTGGG + Intergenic
1088702312 11:112424453-112424475 AGGCATGGGATGAATGTGCTAGG - Intergenic
1091148838 11:133306815-133306837 TGGCATGGAAAATTTTTGCTAGG - Intronic
1096015423 12:48268756-48268778 AAGAATGGCAAAAATTTGCTGGG - Intergenic
1096429764 12:51533181-51533203 TGGCCTCCCAAAAGTGTGCTGGG - Intergenic
1100333795 12:93610663-93610685 TGGCAGGGCAAAAACGGACTAGG - Intergenic
1100397025 12:94194453-94194475 AGGTATTGCAAAAAAGTGCTGGG + Intronic
1101488118 12:105185880-105185902 TGGGATGATAAAAATGTCCTGGG - Intronic
1102851955 12:116255465-116255487 TGGGATGGCAAAGATGTCTTAGG + Intronic
1102966050 12:117126791-117126813 TAGCATGTCACACATGTGCTTGG + Intergenic
1104242478 12:127003428-127003450 AGGCATGGACAAAATGGGCTTGG - Intergenic
1106361123 13:29031476-29031498 TGGCAAGTCAAAAATCTGCAGGG + Intronic
1108912917 13:55578213-55578235 ACGCATGAAAAAAATGTGCTGGG - Intergenic
1113154749 13:107306993-107307015 TCCCATGGCAAAAACGTGTTTGG - Intronic
1114990012 14:28274677-28274699 TGGCCTGGAAAAAGTCTGCTGGG - Intergenic
1116663254 14:47739908-47739930 TGACATGGGAAAAATGTGTGAGG - Intergenic
1116779375 14:49219238-49219260 TGGCATGGCACAAAAGAGCACGG - Intergenic
1117570000 14:57038287-57038309 TGGGAGGGCAAAAATTAGCTGGG - Intergenic
1118381996 14:65225004-65225026 TGGCAAAGCAAAACTGTGGTTGG + Intergenic
1119452407 14:74723163-74723185 TGTCATTGCAAAAGTGTCCTGGG + Intronic
1120183659 14:81370303-81370325 TGGCATTGGAAAGATGTTCTTGG - Intronic
1122652229 14:103232183-103232205 TGGGGTGGCAGAAATGGGCTGGG + Intergenic
1122715411 14:103693941-103693963 TGTCATGGCAAAAAGGTGGCAGG - Intergenic
1125234491 15:37497059-37497081 ATGCATGTCAAAAATGTGCATGG + Intergenic
1125850194 15:42895867-42895889 TGGGATGGTGAAAATGTTCTGGG - Intronic
1125927197 15:43572595-43572617 TGGAATGGAAAATATGTTCTGGG - Intronic
1125940341 15:43672160-43672182 TGGAATGGAAAATATGTTCTGGG - Intergenic
1126869153 15:52969177-52969199 TGAAGTGCCAAAAATGTGCTAGG + Intergenic
1128909486 15:71499369-71499391 TGGCATGGCAAAAATGTGCTAGG - Intronic
1131425725 15:92344106-92344128 TGGCATGAGAAAAAAGTGCCCGG + Intergenic
1133645276 16:7758417-7758439 TTGCATGGCACAGGTGTGCTTGG - Intergenic
1138228352 16:55318995-55319017 TGGCATCCCAAAAATGTGCCAGG - Intergenic
1138264428 16:55650417-55650439 TGGCATGGCAGAAAAGCACTGGG - Intergenic
1138369223 16:56511630-56511652 TGGCAAGTCAAAAATCTGCATGG - Intronic
1140076876 16:71708132-71708154 TGGGATGGCAAAAATGTTTGGGG - Intronic
1140347720 16:74230378-74230400 TAACCTGGCAATAATGTGCTTGG + Intergenic
1142775241 17:2132631-2132653 TTGCATGAGAAAATTGTGCTGGG - Intronic
1145764051 17:27445811-27445833 TGGCTTGGAAGAAATGAGCTGGG + Intergenic
1150210960 17:63441220-63441242 TGGCAGGGCAGACGTGTGCTTGG + Intronic
1150346167 17:64406289-64406311 TGGCCTCCCAAAAAAGTGCTGGG + Intronic
1153498642 18:5725008-5725030 AGACATGGCAAAATTGTACTGGG + Intergenic
1153972770 18:10241527-10241549 TGGCATCTTAAAAATGTGCTTGG + Intergenic
1155835267 18:30574476-30574498 TGATATGGCTAAAATGTCCTGGG + Intergenic
1156587119 18:38443786-38443808 AGGCTTGGCAAAAATGTCCTAGG + Intergenic
1157872141 18:51240150-51240172 TGGCAAGTCAAAAATCTGCAAGG - Intergenic
1158326223 18:56316229-56316251 TGGCATGTCCAAAATCTGCAGGG - Intergenic
1159656654 18:71036851-71036873 TGGCATGTGAAATATGTACTGGG - Intergenic
1165702407 19:37948630-37948652 TGCCATGGCACACAAGTGCTGGG + Intronic
925760594 2:7180858-7180880 TGGCAGGACAATAATCTGCTGGG - Intergenic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
928770312 2:34696927-34696949 TGGGATGGCAAAAATTTTTTGGG + Intergenic
928991007 2:37232727-37232749 TGGCATTGGAGACATGTGCTGGG + Intronic
930400549 2:50879276-50879298 TGGCAAGTCAGAAATGTGTTGGG - Intronic
932513650 2:72322464-72322486 TGGCATGATAGAAATGTTCTTGG + Intronic
932759057 2:74427736-74427758 AGGAATGGCAAAAAAGGGCTGGG + Intronic
933997531 2:87680564-87680586 TGGCATGGCAGAAGTCTCCTCGG + Intergenic
935366555 2:102297676-102297698 GGGCTTGGCACAAATGAGCTTGG + Intergenic
936296321 2:111270348-111270370 TGGCATGGCAGAAGTCTCCTTGG - Intergenic
938809108 2:134835257-134835279 TGGCATGCCAAAGATGTGGTTGG + Intergenic
939698744 2:145362515-145362537 TGGCATGGGCAAAATCTGCAAGG - Intergenic
941872429 2:170399882-170399904 TGGCATGGTAAGGCTGTGCTGGG + Intronic
942857437 2:180566703-180566725 TGGCAGGGGAAAGGTGTGCTCGG + Intergenic
946467087 2:219921547-219921569 TGGCCTGTGAAAAATGTGGTTGG - Intergenic
946835486 2:223768294-223768316 TGGCCTTGAAAAAATGAGCTTGG - Intronic
947217246 2:227760549-227760571 TGGCCTCCCAAAAAAGTGCTGGG + Intergenic
948427748 2:237898532-237898554 TGGCCTGGGAAATGTGTGCTGGG - Intronic
1169109161 20:3020770-3020792 TGGCATGGGAAGACAGTGCTAGG + Intronic
1169621871 20:7516136-7516158 TTGGAGGGCAAAATTGTGCTGGG - Intergenic
1169710916 20:8562402-8562424 AGGTAAGGCAAAAATGTGCCTGG + Intronic
1173380513 20:42535574-42535596 AGCCATTGCAAAAATGTTCTTGG - Intronic
1175206182 20:57313305-57313327 TGGCCAAGCAAAAATGTGCATGG + Intergenic
1175594878 20:60222982-60223004 TGGCATGGAGAGAATGTGCATGG + Intergenic
1177035747 21:16040408-16040430 AGGCATGGCACTAATGTTCTGGG + Intergenic
1179475561 21:41641300-41641322 TTGCATGGCCAGAATGTGCTGGG + Intergenic
1179588013 21:42386074-42386096 TGGCACTGTAAAAATGAGCTGGG - Intronic
1182676788 22:32045250-32045272 TGGCAGGGCTAAAATGAGATTGG - Intronic
1184685962 22:46096480-46096502 TGGCATCCCACAGATGTGCTTGG - Intronic
951340335 3:21478179-21478201 TGGCATGCCTATTATGTGCTAGG - Intronic
951587980 3:24234762-24234784 TGGCTTTGGAAAAATGAGCTGGG + Intronic
953585005 3:44191678-44191700 TGGGAAGGAAAAAGTGTGCTTGG - Intergenic
956884606 3:73546494-73546516 GGGCATGGCACAAGTATGCTGGG - Intronic
958135508 3:89484680-89484702 TGGCCTGCTAAAAATATGCTGGG - Intergenic
959619466 3:108384507-108384529 ACCCATGGCAAAAATGTGCGTGG - Intronic
959642967 3:108662398-108662420 TGGCAAGACAAAAATATGGTTGG - Intronic
959923898 3:111900322-111900344 AGGCATGCCAAAAATGAGATAGG - Intronic
959989383 3:112614246-112614268 AGTGATGGCAAAAATTTGCTAGG + Intronic
963858344 3:150279960-150279982 TGGCTTGGCATCAAAGTGCTGGG + Intergenic
966013187 3:175107410-175107432 TGGCAAGTCAAAAATCTGCAAGG - Intronic
967687414 3:192433853-192433875 GGGCATGGCACAAAAGTGCATGG - Intronic
970662956 4:18306642-18306664 TGGCAAGGCCAAAATCTGCAGGG - Intergenic
971095626 4:23399126-23399148 TAGCATGGCAATATTGTGCATGG - Intergenic
972334581 4:38096056-38096078 TGACATGGAAAAAATGCACTCGG + Exonic
974248025 4:59347701-59347723 TGACACAGCAAAAATGTGATAGG - Intergenic
974674277 4:65070521-65070543 TGACATTGTAAAAATGAGCTTGG + Intergenic
978076265 4:104533913-104533935 TGGAACATCAAAAATGTGCTAGG + Intergenic
979604710 4:122625616-122625638 TTGCATGGGAAAACTGTGCCAGG + Intergenic
979822097 4:125188028-125188050 TGGCTTGACCAAAATGTACTAGG - Intergenic
980576355 4:134687788-134687810 TGCCAGTGCAAACATGTGCTTGG - Intergenic
981484551 4:145271450-145271472 TGGCAAGTCCAAAATGTGCAGGG - Intergenic
984560194 4:181258970-181258992 GGCAATGGCAAAAATGTGATGGG - Intergenic
986173828 5:5334854-5334876 TGGCAGGAAGAAAATGTGCTGGG - Intergenic
988247461 5:28706021-28706043 TGGCAAGTCTGAAATGTGCTGGG + Intergenic
990256520 5:53976238-53976260 TGGCATGTCAAAAATGCACTAGG + Intronic
993142242 5:84049806-84049828 GGACATGGCAAAAATGTGTGAGG - Intronic
994323096 5:98415741-98415763 TGGCCTGGCCAAGATGTTCTTGG - Intergenic
994540189 5:101085678-101085700 GGGCATGGAAAAAATGTGTCTGG - Intergenic
995070655 5:107918044-107918066 TGGCAAGCCAAAAATGTGGAAGG - Intronic
997184274 5:131866162-131866184 TGGCATGGCTACAATGGGTTGGG + Intronic
997291498 5:132739163-132739185 TGGAATGATAAAAATGTTCTAGG - Intergenic
1000969365 5:167696987-167697009 TGGCAGGGCTAAACTGTGCAGGG - Intronic
1002171371 5:177376610-177376632 GGGCATGGTAAAAATTAGCTGGG + Intergenic
1002623354 5:180506544-180506566 TGTAATGGCAAAAGTGTGTTGGG - Intronic
1003722519 6:8719652-8719674 TGGGATGCCAACAGTGTGCTGGG + Intergenic
1004192607 6:13477301-13477323 TGGCAAGTCTAAAATGTGCAGGG + Intronic
1004321799 6:14637528-14637550 TTGCATGGCAAGAGTGTGCAAGG - Intergenic
1004629538 6:17408306-17408328 TGGCAAGGAAAAAATGAGCCTGG - Intronic
1008603630 6:53119440-53119462 TGGCAAGGCAAAAAATAGCTAGG + Intergenic
1011570534 6:88729669-88729691 TGGCTTGGGAAAATTGTGATAGG + Intronic
1013761374 6:113522861-113522883 AGAAATGGCAAAAATGGGCTAGG + Intergenic
1014361667 6:120484434-120484456 TGGCAAGTCCAAAATCTGCTGGG - Intergenic
1014920336 6:127207258-127207280 TGGCATGCCAAGTATGTACTGGG + Intergenic
1015452973 6:133391825-133391847 TGGCAGGTTAAAAATGTCCTGGG - Intronic
1015625297 6:135175411-135175433 CGGCATACCAAAAAAGTGCTGGG + Intergenic
1017490927 6:154944682-154944704 TGGCCTCCCAAAAAAGTGCTGGG - Intronic
1020477210 7:8610902-8610924 GGGCATGGAACAAGTGTGCTGGG + Intronic
1024862065 7:53856182-53856204 TGGGCTGGCAAAAATGAGATGGG - Intergenic
1027190113 7:75991652-75991674 TGGCTTCCCAAAAAAGTGCTGGG + Intronic
1030661507 7:112223936-112223958 TGGGATTAGAAAAATGTGCTGGG + Intronic
1031485650 7:122320408-122320430 TGGCATTTCAAAAATGATCTTGG + Intronic
1032889619 7:136180640-136180662 TGGCATGCCAATTATGTGCCAGG + Intergenic
1034335619 7:150321843-150321865 TGGCTTGGCATTAATTTGCTTGG + Intronic
1035248136 7:157578348-157578370 TGGCATGGGATAAATTTGCGGGG - Intronic
1035591756 8:821484-821506 TGCCATGGAAAAAATGAGCTGGG + Intergenic
1036803594 8:11811419-11811441 GGGCATGGGATAAATGTGTTAGG + Intronic
1037072087 8:14663264-14663286 TGGGATGCTAATAATGTGCTAGG - Intronic
1038145588 8:24892326-24892348 TTGCATGTCCAATATGTGCTAGG - Intergenic
1039054229 8:33521962-33521984 TGGCCTCCCAAAAAAGTGCTGGG - Intergenic
1039588086 8:38723651-38723673 TGGCATGATAAAAATGTTCTAGG - Intergenic
1044314943 8:90739313-90739335 TGGCAAGTCCAAAATGTGCAGGG + Intronic
1045766089 8:105670965-105670987 TGGAAAGGCCAAAATTTGCTTGG + Intronic
1046804867 8:118469045-118469067 TGGACAGGCAGAAATGTGCTGGG - Intronic
1046865846 8:119149603-119149625 TGGGATGGCAAGAAAGGGCTAGG - Intergenic
1047580970 8:126214788-126214810 TGGCCTGGCAGATATGTGCTTGG - Intergenic
1048011511 8:130460385-130460407 TGACATGACAAAAAGGTTCTGGG - Intergenic
1048262742 8:132959251-132959273 TGACATGGCAAAAATGTTAAAGG - Intronic
1050782966 9:9362167-9362189 AGGGATGGCAAATATGTGGTTGG + Intronic
1051444554 9:17126560-17126582 TGGCATACCTAATATGTGCTAGG - Intergenic
1055909593 9:81332960-81332982 TGGGGTGGTAAAAATGTTCTGGG + Intergenic
1056286605 9:85093443-85093465 GGGCATGGGAAATATGGGCTTGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1058678887 9:107424663-107424685 TAAAAAGGCAAAAATGTGCTGGG - Intergenic
1060601450 9:124881000-124881022 TGTCATCGCTAAAAAGTGCTTGG + Intronic
1060714775 9:125914992-125915014 TGACATGGCAATACAGTGCTGGG - Intronic
1187776847 X:22769951-22769973 TTGCATTTCTAAAATGTGCTGGG + Intergenic
1188483202 X:30654560-30654582 TGGCATAACAAAAATTAGCTGGG + Intronic
1192669629 X:73126553-73126575 TGGGATGACAAAAGTGTGCAAGG + Exonic
1193294723 X:79820920-79820942 TGGCATGGCAAGAAGGTGTAGGG + Intergenic
1194651860 X:96524660-96524682 TGGCAAGGCCAAAATCTGCAGGG + Intergenic
1194659458 X:96613651-96613673 TGGCAAGCAAAAAATGTGCTTGG - Intergenic
1196226707 X:113176652-113176674 TGGGATGGCAAAAATTTTTTGGG + Intergenic
1196779018 X:119365769-119365791 TAGCATGGCAACAGTGTGGTAGG - Intergenic
1197816949 X:130507547-130507569 TGCCATTGCAAAATTGTACTTGG + Intergenic
1198238126 X:134756175-134756197 TTGCATGGCAAAAATCAGATAGG - Intronic
1198493641 X:137168460-137168482 TGGCATGGTGAAGATGTGGTTGG + Intergenic
1198640375 X:138749564-138749586 TGGGAGGGTGAAAATGTGCTGGG + Intronic
1198759501 X:140017111-140017133 TGGGGTGGCCAAAATGTGGTTGG - Intergenic
1199021808 X:142887886-142887908 TGCCATGCTAAATATGTGCTAGG + Intergenic
1202348119 Y:23956732-23956754 TGCCATGCCACAAATGTGCATGG - Intergenic
1202522655 Y:25713372-25713394 TGCCATGCCACAAATGTGCATGG + Intergenic