ID: 1128910497

View in Genome Browser
Species Human (GRCh38)
Location 15:71509457-71509479
Sequence CTCATTAGCTTGTAAGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128910495_1128910497 -1 Left 1128910495 15:71509435-71509457 CCATGAAACCATGATAGATTAAC 0: 1
1: 0
2: 2
3: 12
4: 147
Right 1128910497 15:71509457-71509479 CTCATTAGCTTGTAAGTAAGTGG 0: 1
1: 0
2: 2
3: 11
4: 116
1128910494_1128910497 19 Left 1128910494 15:71509415-71509437 CCAAGATTCTCTGCTAGTATCCA 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1128910497 15:71509457-71509479 CTCATTAGCTTGTAAGTAAGTGG 0: 1
1: 0
2: 2
3: 11
4: 116
1128910496_1128910497 -9 Left 1128910496 15:71509443-71509465 CCATGATAGATTAACTCATTAGC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1128910497 15:71509457-71509479 CTCATTAGCTTGTAAGTAAGTGG 0: 1
1: 0
2: 2
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128910497 Original CRISPR CTCATTAGCTTGTAAGTAAG TGG Intronic
902237635 1:15067890-15067912 CTTATTTTCTTGTAAGTAAAGGG - Intronic
910450905 1:87343792-87343814 TTAATTAGCTTGGAAGTAGGGGG + Intronic
910740652 1:90512473-90512495 CTCATTGGGTTTTAAGTAAATGG - Intergenic
910748214 1:90597397-90597419 CTCATTAGGTTGAAACTAAGTGG - Intergenic
911508367 1:98782687-98782709 CTAACATGCTTGTAAGTAAGTGG + Intergenic
911520981 1:98930725-98930747 CTCATTAGTGAGTAAGTAAAGGG + Intronic
911531876 1:99052443-99052465 CTCAATAGCTACTAAGTAAGGGG - Intergenic
916405075 1:164490070-164490092 CCCATTACCTTGCAGGTAAGAGG + Intergenic
918864498 1:189877357-189877379 CTCAATATCATGTAAATAAGGGG - Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1063725483 10:8632961-8632983 CTTATTATCTTGTAAGTTACAGG + Intergenic
1069071110 10:63991310-63991332 TTCATTATCCTGAAAGTAAGGGG + Intergenic
1070246669 10:74738689-74738711 CTCTTGAGCTTGGAAGGAAGAGG + Intergenic
1073745022 10:106458384-106458406 CTCAGTTGGCTGTAAGTAAGTGG + Intergenic
1075058141 10:119235354-119235376 CTCACTAGCATGTAAGTAATTGG + Intronic
1075168984 10:120095756-120095778 CTCAATAGCATGTAATTCAGTGG - Intergenic
1075279963 10:121130630-121130652 CCCATTAGCTTGTAAGGGAATGG + Intergenic
1075842037 10:125512944-125512966 TCCATCAGCTTATAAGTAAGTGG - Intergenic
1077907689 11:6546775-6546797 TTCATCAGCTTGTAAGTCATAGG - Exonic
1082984569 11:59157412-59157434 CTCATTAGCAGGTAGGTCAGTGG - Intergenic
1083014078 11:59433982-59434004 GTCATTTGATTGTAAGTATGTGG - Intergenic
1091579657 12:1776279-1776301 CACAGTAGCTGGTGAGTAAGTGG + Intronic
1093721995 12:22454311-22454333 CAAATTAGCTAGTAAGTAAATGG + Intronic
1095490792 12:42731836-42731858 CTCTTGAGCTTGAAAATAAGAGG - Intergenic
1098145592 12:67494606-67494628 CTCCTTATTTTGTAAGGAAGGGG - Intergenic
1098705309 12:73680262-73680284 CTCATTACATTACAAGTAAGTGG - Intergenic
1102452273 12:113050706-113050728 CTCATCAGCTTTTAATTAACTGG + Intergenic
1110043198 13:70792515-70792537 CTCGTTAGCTTGTAAGTGGGGGG - Intergenic
1110689206 13:78412284-78412306 CTAATTAGATTGTAAGTTTGTGG - Intergenic
1111785437 13:92780550-92780572 CTCATTAGCTTTAAAGTCAGAGG + Intronic
1112185508 13:97124452-97124474 CTCAGGAGCTTGTAAGGAAAAGG - Intergenic
1112267337 13:97936863-97936885 CTCTTTAGATTGTAACTGAGAGG - Intergenic
1118489366 14:66244253-66244275 CTCATTAGCTAGATAGTCAGGGG + Intergenic
1119369583 14:74127950-74127972 CTCTTGAGCATGTAAGTCAGTGG + Intronic
1119999795 14:79289903-79289925 CTCAATAGCTGGTAAGCAAGAGG - Intronic
1123184269 14:106500170-106500192 ATTATTAGCTTGAAAGTAAGTGG - Intergenic
1124917094 15:33986502-33986524 CTACTTAGCTAGAAAGTAAGAGG + Intronic
1126204611 15:46031151-46031173 ATCAGTTGATTGTAAGTAAGTGG + Intergenic
1128910497 15:71509457-71509479 CTCATTAGCTTGTAAGTAAGTGG + Intronic
1129193302 15:73950229-73950251 CTTGTGAGCTTGTAAGCAAGGGG - Intronic
1130980417 15:88808463-88808485 CCCATTAGACTGTAAGTAGGTGG - Intronic
1131739048 15:95366907-95366929 CTCATGAGGTTGTAAGTGAATGG - Intergenic
1137775362 16:51049642-51049664 TTCCCTAGCTTGTAAGTCAGAGG + Intergenic
1138721704 16:59089952-59089974 CTCTTTACCTTGTAATAAAGAGG - Intergenic
1140778272 16:78270664-78270686 CTCATTAACTTACAAGGAAGAGG + Intronic
1144209751 17:13004064-13004086 CACATCAGCATGTTAGTAAGTGG - Intronic
1146910872 17:36647697-36647719 ATCAGGAGCTTGTAAGGAAGGGG + Intergenic
1148377395 17:47160531-47160553 CTCCTTAGCTTTTAAATAGGAGG + Intronic
1153343156 18:3997285-3997307 CTTATTTTCTTGTAAGTAAAGGG + Intronic
1154002753 18:10497587-10497609 CTTATTAGCTTGAAACTAAATGG + Intergenic
1155035963 18:22025365-22025387 CTCATTGGCTTATATGTAAGGGG - Intergenic
1155265599 18:24089821-24089843 CTGAATTGCCTGTAAGTAAGTGG + Intronic
1156330727 18:36119149-36119171 CTCATTATATTGTGAGTATGGGG - Intronic
1158342581 18:56482655-56482677 CTCATTAGCTTTTAAGATGGGGG - Intergenic
1159647054 18:70931290-70931312 CTCTTTAGCCTGTAATAAAGTGG + Intergenic
1160153686 18:76415457-76415479 CGCCTTAGACTGTAAGTAAGTGG + Intronic
925843373 2:8012996-8013018 CTCATTCTCTTGTAAGGCAGTGG - Intergenic
933929077 2:87130284-87130306 ACCATTAGCTTCTAAGTCAGGGG + Intergenic
934000408 2:87706060-87706082 ACCATTAGCTTCTAAGTCAGGGG + Intergenic
936363865 2:111833108-111833130 ACCATTAGCTTCTAAGTCAGGGG - Intronic
942281954 2:174374414-174374436 CTGATTAGATTGTAAATCAGGGG + Intronic
943974784 2:194460306-194460328 CTCATAGGCTTTTAAATAAGGGG + Intergenic
944449659 2:199828394-199828416 CTCATCAGTTTTCAAGTAAGTGG + Intronic
946955468 2:224924984-224925006 TTCATTAGCTTGTAAATGAGAGG + Intronic
947539635 2:230967196-230967218 CTGATTTGCTTGTATATAAGTGG - Intergenic
947853097 2:233304405-233304427 CTCATTACCTTGTAATGAAATGG - Intergenic
948440086 2:237981149-237981171 CTCATTACCTTGTAGGTGGGTGG + Intronic
1176895230 21:14369661-14369683 AACATTAGCTGGTAAATAAGAGG + Intergenic
1178782313 21:35615147-35615169 CTCATTAGCTTCTAAGTATGGGG + Intronic
949837727 3:8287230-8287252 TTCTTTTGCTTGTAAGTAACAGG - Intergenic
956801552 3:72764206-72764228 CTCTTCTACTTGTAAGTAAGTGG - Intronic
958791454 3:98656087-98656109 CTTAGTAGTTGGTAAGTAAGTGG - Intergenic
959528112 3:107400024-107400046 CACATTTGCTTCTAATTAAGAGG - Intergenic
960554341 3:119010972-119010994 CTCAGTAACTTCTAAGTAGGAGG - Intronic
960646621 3:119892234-119892256 CACATTAGCTTGTAAGCAGTTGG - Intronic
961662139 3:128474884-128474906 CCCATTATCTTGTAAATAATAGG + Intergenic
968175373 3:196544713-196544735 CTCATTAGCTGATGAGTATGTGG - Intergenic
976130242 4:81876383-81876405 ATCATTAGCATGCAAGCAAGAGG - Intronic
978271384 4:106894044-106894066 CTCCTTAGCTTGTAGGCAACAGG - Intergenic
978454924 4:108878448-108878470 CTAATTAGCCTTTAAGCAAGAGG - Intronic
979322423 4:119339892-119339914 CTCATTAGATTTCAAGTAATAGG + Intergenic
980093702 4:128467934-128467956 CTCATTAGCTTGCATGAATGTGG - Intergenic
980305691 4:131058526-131058548 ATCAGTTGGTTGTAAGTAAGTGG - Intergenic
981888476 4:149707792-149707814 CTTTTTAGCTTGTAAATATGGGG + Intergenic
983240401 4:165225507-165225529 CTCATTAGATTTCAAGTAATAGG + Intronic
987106118 5:14641298-14641320 ATCAGTTGCTTGTAAGTATGTGG + Intergenic
987717789 5:21594273-21594295 CTCATTGGCTTTTAAGGCAGAGG - Intergenic
993170604 5:84414135-84414157 CTTTTTAACCTGTAAGTAAGTGG - Intergenic
995682860 5:114740257-114740279 CCCATTAGGTTATAAGTTAGTGG - Intergenic
996849320 5:127935062-127935084 GTCATTAGCTTGAAAGGCAGAGG + Intergenic
998408895 5:141892823-141892845 TTCATTACCTTTTAAGTAATTGG + Intergenic
1002978675 6:2112298-2112320 GTCATTAACTAGTAAGTAATAGG + Intronic
1004391077 6:15210291-15210313 CTTATTAGCTAGGAAGGAAGTGG + Intergenic
1006484628 6:34328709-34328731 CTCATAAACTTGTCAGGAAGGGG - Intronic
1006719977 6:36143701-36143723 CTCCTGAGCTTTTAGGTAAGAGG + Intronic
1007739122 6:44000436-44000458 CTCAGTAGGTTGTAGGGAAGGGG + Intergenic
1013569856 6:111411141-111411163 CTCTTTAGCTTCAAAGCAAGGGG - Intronic
1015524802 6:134166043-134166065 GTCATTAGCTGGTCAGTAAGTGG - Intergenic
1015588001 6:134795808-134795830 CTCATTCTCTTGGAAGTAAAGGG - Intergenic
1016194299 6:141314249-141314271 CTCTTTAGAGTGTAAGTAATTGG - Intergenic
1017040806 6:150307342-150307364 ATTATTATGTTGTAAGTAAGAGG + Intergenic
1017200150 6:151744145-151744167 CTCATTAGCTTGTACACAACTGG + Intronic
1018376869 6:163221149-163221171 TTCATTATCTTGGAAGTAAATGG + Intronic
1020954881 7:14728560-14728582 CTCATGACCTTGTAAGTATCGGG - Intronic
1021868007 7:24978413-24978435 CTCATTAGGATGTAAGTACCAGG - Intronic
1022233907 7:28443078-28443100 CTAATTAGGTTGCAAGTAGGGGG - Intronic
1024324451 7:48097968-48097990 CCCAATAGCTTGTCAGGAAGAGG + Intronic
1027432775 7:78131822-78131844 CTCATTAGATTGTGGGTAGGAGG + Intronic
1028238381 7:88388294-88388316 TTCATTAACATGTAAGTTAGGGG + Intergenic
1028989027 7:97029815-97029837 CTTATTAGGTTGGAATTAAGTGG - Intergenic
1030464434 7:109882089-109882111 AACAGTAGCTTGTAAGCAAGAGG + Intergenic
1030488858 7:110206109-110206131 CTCCTTAGCTTGCAGATAAGAGG - Intergenic
1030976753 7:116134426-116134448 CTGATTAGCTTTTAAGTAAGAGG - Intronic
1031441430 7:121799536-121799558 CTCCTTAGCTTTTAAGAAATAGG + Intergenic
1038103581 8:24408240-24408262 CTCATTGGCTAGGAAGTCAGTGG - Intergenic
1041585211 8:59509024-59509046 CTCATTTACATGTAAGCAAGTGG - Intergenic
1041595233 8:59642917-59642939 CTCTTTATCTTGTATGTAAGAGG + Intergenic
1042427980 8:68671382-68671404 CTCAGTAACTTGCAACTAAGTGG - Intronic
1042855066 8:73258486-73258508 ATAATTAACTTGAAAGTAAGGGG + Intronic
1044303622 8:90613157-90613179 CTCATTAACTTTTAAGTATTAGG + Intergenic
1045178312 8:99751138-99751160 ATAATTAGCTCCTAAGTAAGGGG - Intronic
1046115420 8:109778342-109778364 TTCATTTGATTGTAAGAAAGTGG + Intergenic
1048673513 8:136750209-136750231 ATCATTAGCTTGATAGTAAATGG - Intergenic
1062560033 9:137137427-137137449 CTCATCAGCGTGGAAGAAAGGGG - Intergenic
1187347842 X:18483220-18483242 TTCATTAGCCTATAAGTAGGTGG + Intronic
1188061565 X:25607100-25607122 CTGATTAGCTCCTAAGGAAGGGG - Intergenic
1190462593 X:50693259-50693281 CTGACTATCTTGAAAGTAAGAGG + Intronic
1192032002 X:67523876-67523898 CTCATTAGGTTTTCAGTAAAGGG - Intergenic
1193511626 X:82408604-82408626 GTAATTACCTTGTAGGTAAGTGG - Intergenic
1195089661 X:101446643-101446665 CTCATGAGGTTGCAATTAAGAGG + Intronic