ID: 1128912351

View in Genome Browser
Species Human (GRCh38)
Location 15:71527414-71527436
Sequence GTGAAAAATGTGACAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128912351 Original CRISPR GTGAAAAATGTGACAACAGA AGG Intronic
900760372 1:4466519-4466541 GTGACACATCTGACTACAGAAGG + Intergenic
901911256 1:12460239-12460261 GTGGAAGGTGTGAAAACAGAAGG + Exonic
903697843 1:25221761-25221783 GTGAAAAAGGACATAACAGAAGG - Intergenic
903791809 1:25898356-25898378 GTGAAAGGAGTGACCACAGAGGG - Intronic
904560278 1:31392287-31392309 GTGAAAAATATTATAACAGTAGG - Intergenic
904648313 1:31985325-31985347 GAGAAAAATGTGGCAGCAGAGGG + Intergenic
905926127 1:41751204-41751226 GGATAAAAAGTGACAACAGATGG + Intronic
905989129 1:42317780-42317802 GTAGAAAATGTAAGAACAGAAGG + Intronic
908559522 1:65291928-65291950 GGGAAAAAAGTGACAACGGTGGG - Intronic
909183373 1:72451947-72451969 GTGACATATGAGACAACATAAGG + Intergenic
909183892 1:72460765-72460787 GTGAAAACTGGGACAATAAATGG - Intergenic
909414947 1:75395355-75395377 GTAAAAAATGTATCAGCAGATGG - Intronic
909440841 1:75693780-75693802 GTGAAGAAAGTGACTCCAGAAGG + Intergenic
909844624 1:80376416-80376438 GGGAAATATATGACTACAGAAGG + Intergenic
910633260 1:89379197-89379219 GTGAGAAAGGGAACAACAGAGGG + Intronic
910928519 1:92420269-92420291 GTGTATAATGTGAAAACTGAAGG - Intergenic
911067690 1:93806115-93806137 GAGAAAAATGTTAAAACAAAAGG + Intronic
911479580 1:98421399-98421421 TTGAAAAATATGATAACATAAGG + Intergenic
911513011 1:98830408-98830430 CTGAAACAAGTGACACCAGATGG + Intergenic
912004735 1:104883831-104883853 GTATAAAATGTTACAACAGTTGG - Intergenic
912898651 1:113622940-113622962 GTGAAAAATGTGCTGAAAGATGG + Exonic
914925022 1:151877473-151877495 GTGAAAATAGGGCCAACAGATGG + Intronic
914950124 1:152106449-152106471 GGGAAAAATGTGTGAACATAGGG - Exonic
915267257 1:154727929-154727951 GTTAAAAATGGAACATCAGATGG + Intronic
915602238 1:156929611-156929633 GTGGAGAATGTGAGAAGAGAGGG - Intronic
917715116 1:177727192-177727214 GAGAAAGATGTGAAAACATATGG + Intergenic
917814119 1:178690334-178690356 GGGAAAAAAGTGACAATAAAAGG - Intergenic
917862850 1:179164047-179164069 GGGGAATATGTGACTACAGAGGG + Intronic
918234692 1:182569411-182569433 GAGAAAAAAGTGACAACAATAGG - Intergenic
918955971 1:191208030-191208052 GTGACAAATGTGATGACATAAGG - Intergenic
919150045 1:193684839-193684861 GTGAAAAGTGAGACATCTGAGGG + Intergenic
920212491 1:204338472-204338494 GTGAAAAAGGGGAAAGCAGATGG + Intronic
920392773 1:205620468-205620490 GTGACAAATTTGATGACAGATGG + Exonic
921515400 1:216085391-216085413 GTGAATAGGGTGATAACAGAAGG + Intronic
922527905 1:226320226-226320248 TTGAAAAATGTGGTAAAAGAGGG + Intergenic
922684136 1:227626151-227626173 GAGAAAAATATGACAAGGGAGGG + Intronic
922752081 1:228074991-228075013 GAGAAAAATTTGAGGACAGAGGG + Exonic
922953522 1:229579407-229579429 GTGAACAATGAGAGGACAGAAGG - Intergenic
923700420 1:236294847-236294869 GTGAAGACTGTGACTACTGATGG - Intergenic
923949150 1:238927426-238927448 GAGAAAAAGCTGAAAACAGAAGG + Intergenic
924132711 1:240928539-240928561 ATGAAAGATGACACAACAGATGG + Intronic
924327537 1:242910863-242910885 GTGGAAAATGTGATAAATGATGG + Intergenic
924367150 1:243307021-243307043 CTGAAAAATGAGACTACTGAAGG - Intronic
924721691 1:246628882-246628904 GTGAAAAAGGTGAAAACTGCTGG - Intronic
1064017827 10:11786485-11786507 GTGAAAAATGTGATAGGAGTGGG - Intergenic
1064155739 10:12901810-12901832 GTATAAAATGTGGGAACAGAAGG - Intronic
1064425925 10:15229244-15229266 CTGAAAAATGAAACAACAGCAGG - Intronic
1064687047 10:17873703-17873725 ATGAAAATAGTGACAATAGAAGG + Intronic
1064815219 10:19253568-19253590 GTGAAAGATGTGTATACAGAGGG - Intronic
1066362034 10:34740396-34740418 GTGAAAGAGGTGGCATCAGAAGG - Intronic
1066550691 10:36553064-36553086 GTGCCAAATGTGACAGGAGAGGG - Intergenic
1068030996 10:51704741-51704763 GTGAGGAGTGTGACAAAAGATGG + Intronic
1068080539 10:52313655-52313677 GAGAAAAATGTGCAAAGAGAAGG - Intergenic
1069042233 10:63707896-63707918 TTGAAAAAGTTGACAATAGATGG + Intergenic
1069654092 10:70075105-70075127 GTAAGAGATGTGAGAACAGAAGG - Intronic
1071103641 10:82068667-82068689 ATGAAAGAGGTGACACCAGAGGG + Intronic
1072173821 10:92895897-92895919 TTTAAAAATGGGACAAAAGATGG - Intronic
1073771892 10:106743768-106743790 GTGAAAAATCTGACTGCAAAAGG + Intronic
1076649592 10:131978756-131978778 GGGATAAATGTCAGAACAGAGGG + Intronic
1077139222 11:1016310-1016332 GAGGAAGATGTGCCAACAGAAGG + Exonic
1077307431 11:1874434-1874456 GTGAAATGGGTGAGAACAGAGGG + Intronic
1077733103 11:4756620-4756642 ATAAAATATGTGAAAACAGATGG + Intronic
1078427775 11:11265587-11265609 GTGGAATATCTGACAGCAGATGG + Intergenic
1078928198 11:15892804-15892826 TTGATAAATGTAACAGCAGAAGG - Intergenic
1079933396 11:26591706-26591728 AAGAAAAATGTGACAAAGGAGGG + Intronic
1080079470 11:28199072-28199094 GGCAAATATTTGACAACAGAGGG - Intronic
1080207420 11:29746473-29746495 GAGAAAAATGAAACTACAGAAGG - Intergenic
1082640728 11:55657199-55657221 GTGAAAAAAGTCAACACAGAAGG + Intergenic
1082817856 11:57522154-57522176 ATGAAAAATCTTACAACAGGAGG + Intergenic
1084726921 11:70947935-70947957 GTGGGAAATGAGACCACAGAGGG - Intronic
1085070997 11:73545436-73545458 GTGGAGAAGGGGACAACAGAGGG + Intronic
1086091540 11:83009500-83009522 GTGTAAAATTTAGCAACAGATGG + Intronic
1086804439 11:91222664-91222686 CTGAAAAATGTGACACTTGATGG - Intergenic
1088376449 11:109146634-109146656 TTGAAGAATCTGAGAACAGAAGG + Intergenic
1088568177 11:111195304-111195326 TTGAAAAATCTGACAACATGGGG + Intergenic
1089764480 11:120752785-120752807 GTGCAAACAGTGACAACAGGTGG - Intronic
1090274872 11:125412085-125412107 GGAAAAAATGTGGCAACACATGG + Intronic
1091088148 11:132743685-132743707 GTGTAAAATGTGACACCAGCAGG - Intronic
1091972584 12:4799957-4799979 TTTAAAAATGAGAAAACAGAAGG - Intronic
1093147929 12:15588928-15588950 GTCAGAAATGTGACATTAGAAGG + Intronic
1093691505 12:22114718-22114740 GTGAAGAATGTGATAGAAGATGG - Intronic
1094160969 12:27390499-27390521 GGGAAAAAAATGACAAGAGATGG + Intronic
1094166797 12:27451421-27451443 GATAAAAATGTGACTAGAGAGGG - Intergenic
1094812436 12:34151617-34151639 TTGAACAGGGTGACAACAGAGGG - Intergenic
1095257803 12:40060330-40060352 ATGACAAATGTAACAAAAGAAGG - Intronic
1095433372 12:42158733-42158755 GAGAAAAATCTGACAGGAGATGG - Exonic
1097355223 12:58593654-58593676 CTGAAAAATGTAACATCTGAAGG + Intronic
1099099994 12:78427313-78427335 ATTAAAAATTTGATAACAGAGGG + Intergenic
1099668119 12:85656705-85656727 GCTAAAACTATGACAACAGAAGG + Intergenic
1099790916 12:87332375-87332397 GTGTAAAATTTGTCAACAAATGG + Intergenic
1100862295 12:98818909-98818931 GTGAAAAATATGAAAAAACAAGG + Intronic
1101459892 12:104880380-104880402 TTGAAAAGTGTGACAAGACAGGG - Intronic
1104188042 12:126451176-126451198 GTGAAAAATGAGGCAGCAGAGGG - Intergenic
1104302413 12:127576367-127576389 GTGAAAAATGTGACCAGGGTGGG + Intergenic
1104343824 12:127977643-127977665 GTGAAAAAAGTGAAAAGAGATGG - Intergenic
1104855691 12:131901539-131901561 GTGAAGAATGAGAAAGCAGAGGG - Intronic
1106265525 13:28106172-28106194 GTGGAATATGGGACAACACAGGG + Intergenic
1107268270 13:38583334-38583356 GTAAACAATGTGCCAACAGCCGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108508376 13:51133797-51133819 GAGAAAAATGAGACAGAAGAGGG + Intergenic
1109135112 13:58639458-58639480 GAGAAAAATCTGAAAATAGAAGG - Intergenic
1109266085 13:60201932-60201954 GTGTTAAATGTGTCAGCAGATGG + Intergenic
1109279576 13:60340444-60340466 GTGACACATGTAACAAGAGATGG - Intergenic
1109370964 13:61418291-61418313 TAGAAATATGTGACACCAGAAGG - Intronic
1109464901 13:62717524-62717546 GTGAAAAATTTAACAGCTGAGGG - Intergenic
1110077903 13:71273114-71273136 GTACAAAATGTTACAACAGATGG - Intergenic
1110176313 13:72560213-72560235 TTTAAACATGTTACAACAGATGG + Intergenic
1110923435 13:81119023-81119045 TTGAAAAATATGACAACCTATGG - Intergenic
1112630207 13:101152965-101152987 GGGAAAAATGTCACACCAAAGGG + Intronic
1112779989 13:102889894-102889916 GTGAAAAATATTAGAAGAGATGG + Intergenic
1113027873 13:105960912-105960934 GTGAAAAACATGACACAAGAAGG - Intergenic
1113053551 13:106241225-106241247 TTGAAAAATATGAAAACAAATGG + Intergenic
1113127411 13:106995236-106995258 GTCATAAATGTGACCACAGCAGG - Intergenic
1115423284 14:33222879-33222901 GGGAATAATGTGAAAACAAAGGG + Intronic
1115608895 14:35033423-35033445 ATGAAAACTGTGAGAACTGAAGG - Intergenic
1115895499 14:38082222-38082244 GTAAAAAACATGACAGCAGATGG + Intergenic
1115929669 14:38477311-38477333 GAGAAAAATGTGAAAAAAGTTGG + Intergenic
1116679776 14:47951675-47951697 GTGAAAACTGTGTATACAGAGGG + Intergenic
1117364926 14:55017095-55017117 GTGAAATATCTGACATCAGTGGG + Intronic
1118543106 14:66853310-66853332 GTAATAAATGTGACAAGAAAAGG - Intronic
1119392266 14:74299048-74299070 TTGAAAGAGGTGACAACGGAGGG + Intronic
1119637906 14:76291754-76291776 GGGAAAAACGTGCCAAGAGAAGG + Intergenic
1120614519 14:86686763-86686785 GTAAAAATTGTAACAAAAGAAGG - Intergenic
1120655060 14:87179522-87179544 GGGAAAACTGAGACTACAGAGGG - Intergenic
1121833181 14:97069299-97069321 CAGAAATGTGTGACAACAGATGG + Intergenic
1122053569 14:99076923-99076945 GTGAAAAATGTTTCCATAGAAGG + Intergenic
1202935168 14_KI270725v1_random:81191-81213 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1124088312 15:26573016-26573038 ATTAAAAATGTGAACACAGAAGG + Intronic
1124808061 15:32906317-32906339 TTGAAAAAAGAGTCAACAGAAGG + Intronic
1125691585 15:41600470-41600492 AGGAAAAATGTGACAGCACATGG - Intergenic
1127261626 15:57330862-57330884 GTGAAAAATCTGGCATCAGAGGG + Intergenic
1127653527 15:61033298-61033320 CTGAACAATCTGAGAACAGAGGG - Intronic
1128912351 15:71527414-71527436 GTGAAAAATGTGACAACAGAAGG + Intronic
1131167137 15:90150452-90150474 GGGAAAAATGTGAGGACACAAGG - Intergenic
1131701954 15:94946841-94946863 GGGATAAATTTGACAAAAGATGG - Intergenic
1131794801 15:96004971-96004993 ATGAAAAATCTGACAACAGTAGG - Intergenic
1132326009 15:100970893-100970915 GAAAAAAATGTAACAAAAGATGG - Intronic
1133673379 16:8045904-8045926 GTGAAAAGAGTGACATAAGATGG - Intergenic
1137360934 16:47814490-47814512 TTGAAAAATGTTACAAGACATGG + Intergenic
1137589933 16:49687237-49687259 GTGAAAAATGTGTTGAGAGAGGG - Intronic
1140023239 16:71259821-71259843 GTGAAGAATGTGAGAAGAGCAGG + Intergenic
1141393340 16:83682769-83682791 GTGACTAATGTGACATGAGATGG - Intronic
1141597532 16:85106524-85106546 GGGAAAGATGTGACTACAGAGGG + Intronic
1141710654 16:85697082-85697104 GAGAAAAGTGTGAAAACAGATGG - Intronic
1143236509 17:5406132-5406154 GTGATAAGTGCAACAACAGAAGG + Intronic
1143279258 17:5739058-5739080 GTGATGAATGTGACACAAGAAGG + Intergenic
1146086461 17:29834696-29834718 GTAAAAAATTTGACACCACAAGG - Intronic
1146142154 17:30377669-30377691 GTGATAAATGCTACAACAGAGGG - Intergenic
1147495147 17:40908326-40908348 CTGAAAAATGGGCCAACAGAAGG + Intergenic
1148248608 17:46053973-46053995 TTTAAAAATATCACAACAGATGG + Intronic
1148326016 17:46783933-46783955 GTGCAAAATGAGACAAGAGGTGG + Intronic
1148409058 17:47448693-47448715 GTGAAGATTGTGGCAACAAAGGG - Intergenic
1149064840 17:52466866-52466888 GTGAAATATGTGTCAACGTAGGG - Intergenic
1149588150 17:57807496-57807518 GAGGGAAATGTGACTACAGAAGG + Intergenic
1151247610 17:72806979-72807001 ATGCAAAATGTGAGAAAAGAAGG - Intronic
1152977787 18:240468-240490 TTCAAAAATGTCAAAACAGAGGG + Intronic
1155994923 18:32321067-32321089 GTGAATAATGTGATAATGGAAGG - Intronic
1156245382 18:35292685-35292707 GTGAGAAAAGGGACAACTGAAGG - Intergenic
1156732348 18:40209552-40209574 TAGAAAAATGTGAGAACAAATGG + Intergenic
1156895292 18:42239407-42239429 GTGACAGATGTGATAACAAATGG + Intergenic
1156959223 18:43002937-43002959 GGGAAAGATGTGACTACGGAAGG + Intronic
1157160173 18:45306883-45306905 GAGAAAAAAATGAGAACAGATGG - Intronic
1157639243 18:49196609-49196631 GTGAAAAATGTAAGAAAATATGG + Intronic
1157666639 18:49492921-49492943 GTGAAAAATGCGCTAACTGAAGG + Intergenic
1157850539 18:51045007-51045029 GTGAAAGAGATAACAACAGAGGG + Intronic
1158227637 18:55217349-55217371 TAGAAAAATCTGAAAACAGAAGG - Intergenic
1159098633 18:63935282-63935304 GTGAAAAATGTACCATGAGATGG + Exonic
1159108012 18:64026257-64026279 GTCAAAAATGTCATTACAGACGG + Intergenic
1159342429 18:67153143-67153165 GTAAAAAATATGACAAAAGCAGG + Intergenic
1162560788 19:11417113-11417135 GTGATGAATGTGACTAGAGAAGG - Intronic
1163817595 19:19476360-19476382 GTGACAAATAAGACAACAGCAGG - Intronic
925674700 2:6349815-6349837 GTTAACAATGGAACAACAGAAGG + Intergenic
926279024 2:11429950-11429972 GTGAAAAATATGATAAAAGTAGG - Intergenic
926398507 2:12470350-12470372 GGGGAAAGTGTGACTACAGAGGG - Intergenic
926544000 2:14216209-14216231 GTGAAAAATGTCAGAAGAAACGG + Intergenic
930164755 2:48194197-48194219 GTGTAAAATAAGAAAACAGAGGG + Intergenic
930362450 2:50399098-50399120 GTGAAAAACATAAAAACAGAGGG - Intronic
931454519 2:62398021-62398043 GAATAAAATGTGACAAGAGATGG - Intergenic
932443285 2:71752219-71752241 CTGAGAAATGGCACAACAGAGGG + Intergenic
933219493 2:79671419-79671441 TTGAAAAATGTGTAAAAAGATGG + Intronic
934306064 2:91823103-91823125 CAGAAAAATGTGAAAAGAGACGG + Intergenic
934327192 2:92029639-92029661 CAGAAAAATGTGAAAAGAGACGG - Intergenic
934465574 2:94260219-94260241 CAGAAAAATGTGAAAAGAGACGG - Intergenic
934975009 2:98795800-98795822 GTGAAATCTGAGAAAACAGAGGG - Intronic
935149855 2:100424215-100424237 GTTAATAATTTGACAACAGCAGG + Intergenic
935502475 2:103858183-103858205 TTGACAAATGTGGCCACAGATGG - Intergenic
935614046 2:105058088-105058110 GTGAAAAATGATACATCAAATGG - Intronic
937740657 2:125348993-125349015 GTTTAATATGTGACAACATAAGG - Intergenic
938108488 2:128549149-128549171 GTGAAAACTGAGACCAGAGAGGG - Intergenic
938577472 2:132618474-132618496 ATCACAAATGTGACAATAGATGG + Intronic
939386191 2:141502015-141502037 GCATAAAATGTAACAACAGATGG + Intronic
940228277 2:151423356-151423378 GTGAAAAATGTGGCATTACATGG - Intronic
940558403 2:155262547-155262569 GGGAAAAAGTAGACAACAGATGG - Intergenic
941569934 2:167157764-167157786 GTGAAAAATGTTGCAATAGGAGG + Intronic
942706832 2:178783341-178783363 GTGATAAACATCACAACAGAAGG - Intronic
942775534 2:179576978-179577000 GAGGAAAATCTCACAACAGACGG + Intronic
943169831 2:184384663-184384685 GTCAGAGATGTGAGAACAGATGG - Intergenic
943424664 2:187715818-187715840 GAGAAAAATCTCAGAACAGAGGG + Intergenic
945891916 2:215438683-215438705 GAGAGAAATGTGACAAAAAAAGG + Intergenic
946387139 2:219390557-219390579 GTTAAAAATGAGATAACAGTTGG + Intronic
947474643 2:230431761-230431783 ATGGAAAATGTGAAAAAAGAAGG - Intronic
948265759 2:236634251-236634273 ATAGAAAATGTGACAACAGCAGG - Intergenic
1168962454 20:1878484-1878506 GTGAAAAATGTAGCCACAGCAGG - Intergenic
1169445821 20:5670348-5670370 ATTAAAAATGTGAAAACAGGTGG + Intergenic
1169504187 20:6190994-6191016 GTGAAAACTGGGACAAGACAGGG + Intergenic
1171141402 20:22746936-22746958 CTGAGAAATGTGGGAACAGAAGG - Intergenic
1175797651 20:61782598-61782620 GTAATAAATATGACAACAGTAGG + Intronic
1176596586 21:8703427-8703449 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1177181834 21:17752642-17752664 GTGAAAAATGTGAATGCAGTAGG - Intergenic
1177314891 21:19446601-19446623 GTGATAAATAGGACAAAAGAGGG + Intergenic
1177326274 21:19593373-19593395 GAGAAATATGGAACAACAGATGG - Intergenic
1178842014 21:36145296-36145318 ATTAAAAATGTGACTATAGAAGG - Intronic
1180279504 22:10680869-10680891 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1180586717 22:16899398-16899420 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1180590822 22:16935855-16935877 CAGAAAAATGTGAAAAGAGATGG - Intergenic
1180654158 22:17405057-17405079 GGGATAAATCTGACAAAAGATGG - Intronic
1181418330 22:22776673-22776695 GTGAAACATGTGAAAACAATGGG - Intronic
1182066506 22:27435166-27435188 GTGAAAAATTTGAGAAGAGTGGG - Intergenic
1182237420 22:28886339-28886361 GTGAGAAATGAGAAAGCAGAAGG + Intronic
1182438996 22:30350704-30350726 CAGAAAAATGTGAAAACAGCTGG + Intronic
1183651584 22:39157831-39157853 GTGATTTATGTGACATCAGAAGG + Intergenic
949688170 3:6601852-6601874 GTGATAAAGGTGAAAAGAGAAGG - Intergenic
949873613 3:8609538-8609560 TTGAAAAATGTTGAAACAGATGG - Intergenic
951689400 3:25380126-25380148 GAGAAAAATCTGACAACTAATGG + Intronic
952341035 3:32447567-32447589 GTGAAAAATGAGAAAAATGAAGG - Intronic
953476927 3:43213209-43213231 ATGAAAAAAGTGACAACGCAGGG + Intergenic
955713966 3:61809324-61809346 GAGAAAAATGTGATCACTGATGG + Intronic
956147222 3:66202749-66202771 ATGAAAAAAGAGACAAAAGAAGG + Intronic
957216011 3:77320342-77320364 TTTAAAAATGAGACAAGAGAGGG - Intronic
957671652 3:83312608-83312630 GTGAAAAATATGAAAATAGCTGG + Intergenic
957932888 3:86905003-86905025 ATGAAAAGTATGACTACAGAGGG + Intergenic
958155830 3:89754705-89754727 CTGCAAAATGTTAGAACAGAAGG + Intergenic
958200529 3:90309137-90309159 TTGAAAATTGTCACAACACAGGG - Intergenic
958540600 3:95465754-95465776 GTGATATTTGTGACAATAGATGG + Intergenic
960277708 3:115746123-115746145 GAGAAAAATGTGACAAGGGAGGG - Intergenic
961155341 3:124674930-124674952 GGGTCAAATGTGGCAACAGAAGG - Intronic
961442203 3:126959797-126959819 GTGAAAAATCAGAGAACAGAGGG + Intronic
962269932 3:133970067-133970089 GTGAAGAATGTGACAGCTTATGG - Intronic
962891895 3:139679226-139679248 GTGTAAAATGTGGCTCCAGAAGG + Intergenic
962932569 3:140051588-140051610 GAGTAGAATGAGACAACAGATGG - Intronic
963865796 3:150359781-150359803 TTGAAAAATAAGACAAGAGAAGG - Intergenic
964678124 3:159306139-159306161 GTGAAAAAAGTTACTGCAGATGG - Intronic
967113110 3:186312762-186312784 CTGAAAAATGTCAAAACAGAAGG + Intronic
970840350 4:20461509-20461531 ATGAGAAATGTGACAAGATATGG + Intronic
971065912 4:23033067-23033089 GAAAAAAATGTGACAATAGGTGG - Intergenic
974230741 4:59110655-59110677 TTGAAAAATGGCACAACAAAAGG - Intergenic
975376081 4:73647310-73647332 GTGAAAAATCTGTCAACATTCGG + Intergenic
975999315 4:80354150-80354172 CTGATAAATGTGTGAACAGATGG + Intronic
976072983 4:81262929-81262951 GTGAAAAATGTGAGTACATATGG - Intergenic
977611805 4:99043156-99043178 TTGAAAAATGTGAAAACAGTTGG - Intronic
978283308 4:107043303-107043325 GCTAAATATGTGAAAACAGAGGG + Intronic
978623721 4:110661045-110661067 GTGGAAAATGTGAAAAGTGAGGG + Intergenic
979021387 4:115503483-115503505 GTAAAAAATGAGAGAACACAGGG - Intergenic
979054237 4:115976375-115976397 TTGAAAAATGGAATAACAGAAGG + Intergenic
979618403 4:122770412-122770434 GTGAAAAATTGGACATCAGAGGG - Intergenic
979811340 4:125039869-125039891 CTAAAACATGTTACAACAGAAGG - Intergenic
981193162 4:141887036-141887058 GTAAAAAATGTGACAGGATAGGG + Intergenic
981239053 4:142452511-142452533 GGGTAAAATGTTTCAACAGAAGG + Intronic
981862207 4:149370189-149370211 GCTAAAAATGTTACAACAGGTGG - Intergenic
983657407 4:170097620-170097642 ATGAAATATGTCTCAACAGATGG - Intergenic
983669896 4:170224512-170224534 GTGACAAATGTGACAAATCATGG - Intergenic
984579204 4:181490865-181490887 TTGAAAAATCTGAAGACAGATGG - Intergenic
985728949 5:1534815-1534837 ATGATAAATCTGACAAAAGATGG - Intergenic
987173430 5:15282782-15282804 GTGAATAATCTGACACCATATGG - Intergenic
988229494 5:28456470-28456492 GCGAAAAATGAGACACCAGAAGG + Intergenic
988710859 5:33773343-33773365 GTGAGAAGAGTGAAAACAGAAGG - Intronic
989815367 5:45729989-45730011 ATGAAAAATGCAAGAACAGATGG + Intergenic
992884277 5:81142322-81142344 GTGAATGGTGTGAAAACAGAAGG + Intronic
993534586 5:89066899-89066921 GTGAACAATGGGACAGTAGATGG - Intergenic
994174677 5:96698518-96698540 GTAAAAAATATGAGAACGGAAGG - Intronic
994733110 5:103517789-103517811 CTGAAAAACATGACAGCAGAAGG + Intergenic
998231666 5:140364780-140364802 TTGAGAAATAAGACAACAGAAGG + Intronic
999930485 5:156427601-156427623 CTGAAAAATGGAACAACACAAGG - Intronic
1001267648 5:170286284-170286306 GTGAAAGATGTGGCAATTGAGGG - Intronic
1002100007 5:176852898-176852920 GTAAAACATGTCACAACAGCAGG - Intronic
1002304151 5:178273641-178273663 GTGAAAACTGACACAGCAGACGG + Intronic
1003959762 6:11198124-11198146 GTGAAAGATCTGGCAACACAGGG - Intronic
1004116691 6:12775367-12775389 GTTAACTATGTGGCAACAGATGG - Intronic
1004732243 6:18369083-18369105 GTGAACAATGTTACTACATAGGG - Intergenic
1004759912 6:18655224-18655246 CTTAAAAAAGTGACAACATAAGG + Intergenic
1004785640 6:18964654-18964676 GAGGAAAGTGTGACCACAGAAGG + Intergenic
1006939589 6:37743050-37743072 GGGAAACAAGTGACAAAAGAGGG + Intergenic
1009958576 6:70489198-70489220 ATGAGTAATGTGAAAACAGATGG + Intronic
1010388578 6:75310597-75310619 GTCAAAAATGTCAATACAGAGGG + Intronic
1011664009 6:89617717-89617739 GTAAAATATATGACACCAGAGGG - Intronic
1011880019 6:92012521-92012543 GTTAAAAATGTGAAAAATGATGG + Intergenic
1012374947 6:98550594-98550616 GAGAAAAATCTGATAACAAAAGG + Intergenic
1012951918 6:105527223-105527245 AAGAAGAGTGTGACAACAGAAGG - Intergenic
1014477427 6:121890537-121890559 AGGAAAAAGGTGAGAACAGAAGG - Intergenic
1015105297 6:129529238-129529260 ATAAAATATGTAACAACAGAAGG + Intergenic
1015129075 6:129789705-129789727 GTGACAAAAGTGCAAACAGAGGG - Intergenic
1016124113 6:140378629-140378651 GGGAAAAATGTGACAGTATAAGG + Intergenic
1016325168 6:142892739-142892761 GTGTAAAATGTGAAGACAGCAGG + Intronic
1016446219 6:144134466-144134488 GAGAAATATGTGACTACAAATGG + Intergenic
1016590376 6:145736845-145736867 ATGAAAAATGTGAAGACAGAAGG + Intergenic
1017039305 6:150295000-150295022 TTCAAGAATGTGACAGCAGAGGG - Intergenic
1017289506 6:152719659-152719681 GAGATAAATGTGACAATATATGG + Intronic
1017379203 6:153807897-153807919 ATGAAAAATGTGAAAACAAATGG - Intergenic
1017703424 6:157097612-157097634 GAGAAATTTGTGACAAGAGAGGG + Intronic
1017809534 6:157974876-157974898 GTGAAAAATGAAACAAGTGAGGG - Intergenic
1018272563 6:162096007-162096029 GTGAAAAATGTGTCCATACAGGG + Intronic
1019031443 6:169017145-169017167 CTGAAAAATATGACACAAGAAGG - Intergenic
1019892990 7:3962130-3962152 GTGATAATTGTGACTTCAGAAGG - Intronic
1021280576 7:18711902-18711924 GTGAGAAATGAGAGAAGAGATGG - Intronic
1021639233 7:22721949-22721971 GGGAGAAAAGTGACAGCAGATGG + Intergenic
1024620437 7:51152505-51152527 CTGACAAATGTGCCAACAGAAGG - Intronic
1025640079 7:63358554-63358576 GGCAGAAATGTGACAAAAGAAGG + Intergenic
1025642620 7:63389538-63389560 GGCAGAAATGTGACAAAAGAAGG - Intergenic
1026302890 7:69113554-69113576 ATGACAAATGACACAACAGAGGG - Intergenic
1027643028 7:80761194-80761216 TTCAAATATGTGACAACAGCAGG + Intronic
1028537939 7:91910148-91910170 GTGAAAAAGGTGGTAATAGATGG - Intergenic
1029807503 7:103012008-103012030 CTGAAAAATGCTACAAAAGAAGG + Intronic
1031471867 7:122176291-122176313 GAGAAAAATATGACAAGGGAGGG - Intergenic
1031853727 7:126897460-126897482 GTGAAAAATGTGTAAAGACAGGG + Intronic
1031918790 7:127586622-127586644 GTGAAGGAGGTGACAACAGAGGG + Intronic
1032207001 7:129874723-129874745 GAGAAAAATGCAACAACGGAAGG + Intronic
1032796813 7:135284153-135284175 GTGACACAAGTGGCAACAGATGG - Intergenic
1033785371 7:144723490-144723512 AAGAAAGATGTGAAAACAGATGG - Intronic
1033786807 7:144741592-144741614 GTTAAAAATATAACAACTGAAGG - Intronic
1038714984 8:29983482-29983504 TTAAAAAATGCTACAACAGAGGG + Intergenic
1038754054 8:30324440-30324462 GTGTAAAGTGTGACAAGAGAAGG - Intergenic
1038977975 8:32722942-32722964 CTGCAAAATGTGAAAAAAGATGG - Intronic
1040137093 8:43867282-43867304 TTGAAAACTGGCACAACAGAGGG + Intergenic
1042106008 8:65326838-65326860 GTGACAATTGTGGAAACAGAAGG + Intergenic
1045232491 8:100317941-100317963 GGCAAAAATGTCACAACAGTTGG - Intronic
1047230578 8:122994956-122994978 GAGAAAACTGGGAAAACAGAGGG + Intergenic
1047467628 8:125133378-125133400 GTGTAAAATGGGAAAACAGCTGG + Intronic
1048116322 8:131527533-131527555 GTTACACATGTGATAACAGATGG + Intergenic
1048183402 8:132216662-132216684 GTGAAAAATGCCACAAAAAAAGG + Intronic
1050253840 9:3773584-3773606 GTGAATTATCTGGCAACAGAGGG + Intergenic
1050551957 9:6756819-6756841 GTGAACATTGTGAGGACAGATGG - Intronic
1052171552 9:25403878-25403900 GTGAAAACTGTGAAAGAAGATGG + Intergenic
1052277653 9:26695532-26695554 GGCAAAATTGTGACTACAGAAGG - Intergenic
1053695638 9:40637003-40637025 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1054306885 9:63436221-63436243 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1054405616 9:64760209-64760231 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1054439243 9:65245696-65245718 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1054491163 9:65776243-65776265 CAGAAAAATGTGAAAAGAGACGG + Intergenic
1054981193 9:71208788-71208810 TTGAAAAATGGGACAACAAATGG - Intronic
1058669676 9:107350375-107350397 GGGAAAGATCTGAGAACAGACGG - Intergenic
1059872553 9:118594113-118594135 GAGAAAAATGAAACAACAGAAGG - Intergenic
1062258984 9:135648488-135648510 GTGAAAAAAATGTCTACAGAAGG + Intergenic
1202778083 9_KI270717v1_random:10615-10637 CAGAAAAATGTGAAAAGAGACGG - Intergenic
1203441467 Un_GL000219v1:12552-12574 GTGAAAACTCTGTCAAAAGAAGG + Intergenic
1203512276 Un_KI270741v1:131460-131482 GTGAAAACTCTGTCAAAAGAAGG + Intergenic
1186549710 X:10490255-10490277 GTGATAAATCTAACAAAAGATGG - Intronic
1188093492 X:25992365-25992387 GTGAAAAATGAAACAACTTATGG + Intergenic
1188605741 X:32027309-32027331 GAGAAAAATGAGTTAACAGAAGG - Intronic
1188666309 X:32825449-32825471 GTCAAAAAGTTCACAACAGAAGG + Intronic
1189595407 X:42559735-42559757 GAAAAAGATGTGACAAAAGAAGG - Intergenic
1189595571 X:42561727-42561749 GTTAAAAATGGGATAATAGAGGG + Intergenic
1192543692 X:71995708-71995730 GAGAAAAATGAAACAACGGAGGG - Intergenic
1192714906 X:73628850-73628872 GAGAAAAATGGCACAATAGAAGG - Intronic
1192839354 X:74837522-74837544 TTGTAAAATGTGACAAAAGCAGG - Intronic
1194763239 X:97818685-97818707 GAGAGAAATGTGGCAACAGAAGG - Intergenic
1195006670 X:100691941-100691963 GTGAAAAATGAGACTGGAGAGGG - Intronic
1195268146 X:103203756-103203778 GTGAAAAATGTTGCCACAAAAGG - Intergenic
1195409530 X:104554955-104554977 GTGAAAGAGGTGACATCTGAGGG - Intergenic
1199509102 X:148600024-148600046 GTGAAAAAATTGACAAGTGAAGG + Intronic
1199517785 X:148697582-148697604 TTGAAAAAAGTGGCGACAGAAGG - Intronic
1201224950 Y:11809777-11809799 GTGGAAAATGTGATAAATGATGG + Intergenic
1202142488 Y:21742824-21742846 GTGAAGATTGAGAAAACAGAAGG + Intergenic
1202144370 Y:21762794-21762816 GTGAAGATTGAGAAAACAGAAGG - Intergenic