ID: 1128915012

View in Genome Browser
Species Human (GRCh38)
Location 15:71551901-71551923
Sequence GTTCCCATCATTCCCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 2, 2: 4, 3: 24, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128915012_1128915019 13 Left 1128915012 15:71551901-71551923 CCAGTTCTGGGAATGATGGGAAC 0: 1
1: 2
2: 4
3: 24
4: 201
Right 1128915019 15:71551937-71551959 AAGTTACCAGATGCCAGCCTAGG 0: 1
1: 1
2: 24
3: 107
4: 313
1128915012_1128915020 14 Left 1128915012 15:71551901-71551923 CCAGTTCTGGGAATGATGGGAAC 0: 1
1: 2
2: 4
3: 24
4: 201
Right 1128915020 15:71551938-71551960 AGTTACCAGATGCCAGCCTAGGG 0: 1
1: 1
2: 23
3: 84
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128915012 Original CRISPR GTTCCCATCATTCCCAGAAC TGG (reversed) Intronic
900781186 1:4618025-4618047 GTTCCCATCACTCTAAGAAGTGG - Intergenic
905284944 1:36873174-36873196 GTTCCCACCACCCCCAGCACAGG + Intronic
906244825 1:44265801-44265823 GTTCCCAGAATTGCCAGAATAGG + Intronic
906887652 1:49668810-49668832 GTTTCCCTCATTCCCCTAACAGG + Intronic
907971213 1:59383503-59383525 CTTCCCATCATGGCCTGAACTGG - Intronic
910120393 1:83782126-83782148 GTTCCAACCATTCCTAGGACTGG - Intergenic
910321163 1:85946010-85946032 GTTCCCAGCATTTCCAAAACTGG + Intronic
910382898 1:86648491-86648513 GTTACATTGATTCCCAGAACAGG - Intergenic
911676218 1:100661230-100661252 TTTCCCATCATTCCAAGAGATGG + Intergenic
916644545 1:166770133-166770155 GTTTCCTTAATTCCCAGGACCGG - Intergenic
917855265 1:179094397-179094419 TTTCCAAGCATTCCCAGAAAAGG - Intronic
918074265 1:181158654-181158676 GTTACCCTCATCCACAGAACAGG - Intergenic
918107059 1:181424548-181424570 GTCCCCCTCCTTCCCAGTACAGG - Intronic
918224802 1:182471740-182471762 CTTCCCATCACTCCCACTACAGG - Intronic
919947356 1:202329318-202329340 TTTCCCATCCTTCCCTGAGCTGG + Intergenic
922550161 1:226488858-226488880 GTTCCTGTCCTTCCTAGAACAGG + Intergenic
923059777 1:230460708-230460730 GTTCCAAGCTTTCTCAGAACAGG + Intergenic
923466464 1:234251385-234251407 GTTCCCATCATTACCCTATCGGG - Intronic
924572630 1:245251263-245251285 GTTCCTACCATTCCTAGAACTGG - Intronic
924872498 1:248064050-248064072 CTTCCCATCCTTCTCAGGACTGG - Intronic
1063059609 10:2537755-2537777 GTTCCCATTCTTCCAAGCACAGG - Intergenic
1063230542 10:4062156-4062178 GCTCCTCTCATTCCAAGAACAGG + Intergenic
1063480267 10:6369428-6369450 TTTCCCATCATTCACAGCCCAGG - Intergenic
1063728014 10:8660980-8661002 ATGCCTATCATTCCCTGAACTGG + Intergenic
1064359307 10:14649089-14649111 ATTCCCATCATGGCCTGAACTGG - Intronic
1065866397 10:29918928-29918950 GTTCTCAGCATTCCAAGAAGAGG - Intergenic
1066452584 10:35544746-35544768 GCTCCTAGCATTCCCAGGACAGG - Intronic
1066481271 10:35798043-35798065 GTTCCCATGAAACCCAGCACTGG - Intergenic
1068586141 10:58800935-58800957 GTCACCAGCATTCCCAGAATGGG - Exonic
1073084272 10:100878443-100878465 GCTCCCATCCTTCCCAGAGCTGG + Intergenic
1073138239 10:101231227-101231249 CTTCCCAACATTCACAGAACTGG - Intergenic
1073590648 10:104754390-104754412 GTGCCCATGATTCCCAAACCTGG - Intronic
1073868132 10:107828718-107828740 GGTCCAATCAATCCTAGAACAGG + Intergenic
1074251548 10:111755753-111755775 GATCCCAACATTCCCAGGACTGG + Intergenic
1075207480 10:120459535-120459557 ATTGCCATCATTTCCAGTACTGG - Intronic
1075720826 10:124586336-124586358 GTTCCCATCTTTCTCTGCACCGG - Intronic
1075848549 10:125567296-125567318 GTTCCCATCATGGCCTGAACTGG + Intergenic
1079513513 11:21239321-21239343 TTTCCCATCATACCTATAACAGG + Intronic
1080824062 11:35833114-35833136 GGTCCCATCATCCCAAGAGCAGG - Intergenic
1080827300 11:35859156-35859178 TTTCCCATCGTGCCTAGAACAGG + Intergenic
1084034063 11:66497358-66497380 GTTACCATCACTCCCACCACAGG + Exonic
1089698602 11:120230789-120230811 GCTCCCAGAACTCCCAGAACAGG + Intergenic
1091311086 11:134575738-134575760 GTTCCCCTCCTTCCCAGCAGAGG - Intergenic
1092004943 12:5061321-5061343 CTTCCCTTCCTTCCCAGAATGGG - Intergenic
1095317956 12:40789330-40789352 GTTCCCTTCTTTCTCAGAAATGG + Intronic
1096860741 12:54526084-54526106 GTTCCGATCACTGCCAGAAATGG - Intronic
1097135994 12:56856178-56856200 ATTCCCATCATTCCCATATGGGG - Intergenic
1097741593 12:63249578-63249600 GTTCTCATCATTCCTTGGACAGG + Intergenic
1098949435 12:76624266-76624288 GTTCCCACCATTCCCAGAACTGG - Intergenic
1099539805 12:83893727-83893749 TTTCCTATCACTCACAGAACAGG + Intergenic
1100038322 12:90280742-90280764 GTTCCCATAATTCCCACATGTGG + Intergenic
1100525688 12:95417565-95417587 TTTCCCCACATTCACAGAACTGG + Intergenic
1101887503 12:108678803-108678825 GTGCCATTCATTTCCAGAACTGG - Intronic
1102444274 12:112989736-112989758 CTTCCCATCATGGCCTGAACTGG + Intronic
1103945398 12:124523341-124523363 GTTCCCAGGAGCCCCAGAACAGG - Intronic
1104594586 12:130112482-130112504 GTTCCAATCATGCCAAGACCAGG + Intergenic
1104694063 12:130850117-130850139 CTTCCCATCATGGCCTGAACTGG - Intergenic
1105944594 13:25178335-25178357 GTTCCCGTCACCCCTAGAACAGG - Intergenic
1106716983 13:32400794-32400816 GTTTGCATCATTCATAGAACTGG - Exonic
1110558739 13:76887370-76887392 GTTCCCGTCAGTCTCAGAAAGGG + Intergenic
1112083481 13:96002910-96002932 GTTCCCATAGCTCCTAGAACAGG + Intronic
1112261342 13:97880843-97880865 CTTCCCATCATGGCCTGAACTGG - Intergenic
1112698717 13:101979538-101979560 GTCCCCATCATTCCCAAACCTGG + Intronic
1113985249 13:114309776-114309798 GTGCCTGCCATTCCCAGAACAGG + Intergenic
1116596401 14:46852634-46852656 GTGCCCAGCATTCACAGGACTGG + Intronic
1117552249 14:56848082-56848104 GTTCCTCTCATTCCCAGCTCAGG - Intergenic
1118392634 14:65308390-65308412 GTTCCCATAATCCCCACAAGTGG - Intergenic
1120216311 14:81683880-81683902 GTTACCACTATTCCCAGAACTGG - Intergenic
1202899583 14_GL000194v1_random:27559-27581 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1123983891 15:25627214-25627236 GTTCCCAGCAATCCCATTACTGG - Intergenic
1127627013 15:60789488-60789510 GTTGCCAGAATTCCCAGCACTGG + Intronic
1128915012 15:71551901-71551923 GTTCCCATCATTCCCAGAACTGG - Intronic
1129200199 15:73994107-73994129 CTTCCCATCACTCACAGAACTGG + Intronic
1136014153 16:27384075-27384097 GCCCTCATCATTCCCCGAACAGG + Intergenic
1139073463 16:63413973-63413995 TGTCCCACCATTCACAGAACAGG - Intergenic
1141244391 16:82292704-82292726 GTTCCCTCCATTCTCAGAACTGG - Intergenic
1144483043 17:15643198-15643220 CTTCCCATCATGGCCTGAACTGG - Intronic
1144915638 17:18721832-18721854 CTTCCCATCATGGCCTGAACTGG + Intronic
1146661988 17:34671001-34671023 GTTCTCTTCTTTCCCAGAAATGG + Intergenic
1147019485 17:37520238-37520260 GTCAACAACATTCCCAGAACAGG + Intronic
1147467539 17:40622062-40622084 GTACCTATCACTCACAGAACTGG + Intergenic
1149371719 17:56001127-56001149 CTTCTCACCATTCCCAAAACTGG + Intergenic
1150152955 17:62825556-62825578 GTTGCCAACATTCACAAAACAGG - Intergenic
1150194771 17:63285901-63285923 GTTCTTACCATTCCCAGAACTGG - Intronic
1151117777 17:71757323-71757345 CTTCCCATCAGTCCCAGATGTGG + Intergenic
1152724189 17:81937152-81937174 GTTCCCACCCCGCCCAGAACTGG + Intronic
1203162605 17_GL000205v2_random:64526-64548 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1156303198 18:35853465-35853487 GTTCCCATAATTCCCACATGTGG - Intergenic
1157388244 18:47278741-47278763 GTTACCATCATGCCCCTAACTGG + Intergenic
1158948982 18:62474616-62474638 GTTCCCCTCTGTCCCAGAGCAGG + Intergenic
1159926176 18:74271006-74271028 GTTCCCATCAGCCACTGAACTGG - Intronic
1160796036 19:945837-945859 GGTCCCATCACTCCCAGCCCAGG - Intronic
1163592997 19:18204747-18204769 CTCCCCACCATTCCCAGAAAAGG + Intergenic
1164846105 19:31433823-31433845 CTTCCCATCATTTCCAGAATGGG - Intergenic
1165211126 19:34236648-34236670 GTTCCCGCCATTCCCAGAACTGG - Intergenic
1167142945 19:47664795-47664817 GTTCCCCTGAGTTCCAGAACAGG - Intronic
1168031673 19:53684678-53684700 GTTCACATAAGTCCCAGTACAGG - Intergenic
1168441857 19:56375119-56375141 GTTTCTACCATTCCCGGAACTGG - Intergenic
1202647874 1_KI270706v1_random:158070-158092 CTTCCCATCAGTCCCTGCACTGG + Intergenic
1202647980 1_KI270706v1_random:158517-158539 CTTCCCATCAGTCCCTGAGCTGG + Intergenic
925258607 2:2510690-2510712 GTGGTCATCATTCCCAGAACAGG + Intergenic
929815493 2:45227934-45227956 GCTCCCATCATTCCCACATGTGG + Intergenic
932164608 2:69494572-69494594 GATCCCATGATTACCAAAACAGG + Intronic
933510349 2:83233331-83233353 TTTCCCACCATGCTCAGAACTGG + Intergenic
934528691 2:95070460-95070482 GTTGGCATCATTTCCAGAATAGG - Intergenic
935312733 2:101801619-101801641 GTTTCCACCGCTCCCAGAACTGG - Intronic
936669557 2:114640848-114640870 CTTCCCCTCATTCCAAGACCGGG - Intronic
937349896 2:121154089-121154111 CTTGCCATCCTTCCTAGAACGGG + Intergenic
939630286 2:144520548-144520570 GTGCACACCATTCACAGAACTGG + Intronic
943548249 2:189308241-189308263 CTTCCCATCATGGCCTGAACCGG - Intergenic
943618115 2:190116759-190116781 TTTCCCATCTGGCCCAGAACTGG + Intronic
944458571 2:199920280-199920302 GTTTCCATTGTTCCCAGATCTGG + Intronic
944466273 2:200003011-200003033 GTTCCCCTCATCCCCAGATTTGG + Intronic
945580010 2:211581640-211581662 CTTCCCATCATTCCCACAGTTGG + Intronic
948908651 2:240992049-240992071 GTTCCCAGCATTTCCAGGCCGGG - Intronic
1169022763 20:2341810-2341832 CTTCCCTTCCTTCCCCGAACTGG + Intergenic
1169533403 20:6509776-6509798 CTTCCCATCACCCCCAAAACTGG - Intergenic
1170179574 20:13514472-13514494 GTGCCCATCCATCCCAGAATTGG - Intronic
1172809946 20:37640343-37640365 GTTGCAATCAGTCCCAGAAAGGG + Intergenic
1176366211 21:6034332-6034354 GTTTCCTTTGTTCCCAGAACCGG - Intergenic
1176603866 21:8814212-8814234 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1176603977 21:8814659-8814681 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1176618959 21:9042333-9042355 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1179757306 21:43504213-43504235 GTTTCCTTTGTTCCCAGAACCGG + Intergenic
1180346151 22:11705789-11705811 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1180346261 22:11706236-11706258 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1180353923 22:11823946-11823968 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1180354032 22:11824393-11824415 CTTCCCATCAGTCCCTGAACTGG - Intergenic
1180384213 22:12167932-12167954 CTTCCCATCAGTCCCTGAACTGG + Intergenic
1180384323 22:12168379-12168401 CTTCCCATCAGTCCCTGCACTGG + Intergenic
1182636569 22:31732348-31732370 GTTTCCACCATTCCCTAAACAGG + Intronic
1183350712 22:37333217-37333239 GTCCCCATCTGTCCCAGAAAGGG + Intergenic
1183795434 22:40113281-40113303 TTTACCATCATTCCAAGACCTGG - Intronic
1184818809 22:46893322-46893344 CCTCCCATCATACACAGAACTGG - Intronic
949879330 3:8649304-8649326 TTTCTCCTCATTCCCAGAGCAGG + Intronic
950810323 3:15644766-15644788 CTTCCTGTCATCCCCAGAACTGG - Exonic
954527349 3:51283779-51283801 GTCCCCTTTGTTCCCAGAACGGG - Intronic
955514002 3:59708814-59708836 GTTCCTATGACTCCAAGAACAGG + Intergenic
958995385 3:100898638-100898660 GTTCCCCTCACACCTAGAACAGG + Intronic
959212990 3:103412911-103412933 GTTTGCATCATTTCCAGTACTGG - Intergenic
961998490 3:131270848-131270870 TTTCCCATCTTTTCCAGAGCTGG - Intronic
962409057 3:135125469-135125491 TTTTCCATCATTCCCTCAACAGG - Intronic
962542020 3:136391860-136391882 GTTCCCCTGATTCCCAGAGTTGG - Intronic
967573673 3:191064099-191064121 GTTCCCCTCATGTCCAGCACAGG + Intergenic
968577023 4:1371767-1371789 GTTCCCATAATTCCCACACGTGG - Intronic
969856829 4:10006735-10006757 GTTGCCACCGTTCCCAGATCTGG + Intronic
973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG + Intronic
973306729 4:48660388-48660410 GGACCCACCACTCCCAGAACTGG + Intronic
973374139 4:49276257-49276279 CTTCCCATCAGTCCCTGCACTGG + Intergenic
973374250 4:49276703-49276725 CTTCCCATCAGTCCCTGAGCTGG + Intergenic
973383162 4:49333536-49333558 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
973383273 4:49333982-49334004 CTTCCCATCAGTCCCTGCACTGG - Intergenic
973386771 4:49518551-49518573 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
973386881 4:49518997-49519019 CTTCCCATCAGTCCCTGCACTGG - Intergenic
976769069 4:88631835-88631857 TTATCCATCCTTCCCAGAACTGG - Intronic
981186620 4:141811168-141811190 GCTCCTACCATCCCCAGAACTGG + Intergenic
982925157 4:161328011-161328033 GTTTCCATCCCTCCCAAAACAGG + Intergenic
983311273 4:166064250-166064272 GTTCACATCAATCCCAGAATTGG - Intronic
983576581 4:169267742-169267764 GTTCCCATAATTCGCAGATGTGG - Intronic
984352630 4:178614703-178614725 ATTCCCATCCCTCCTAGAACAGG - Intergenic
985647096 5:1090113-1090135 GTTCCCATCCTCCCCAGGCCTGG - Intronic
986353208 5:6899560-6899582 GTGGCCAGCATCCCCAGAACTGG - Intergenic
987023671 5:13901205-13901227 GTTCCCATGATTCCAACAATGGG + Intronic
987873683 5:23651732-23651754 GTTCCCATCTCTCCTAGAACAGG - Intergenic
989523539 5:42427491-42427513 GTTCCCATAATTCCCACATGTGG - Intronic
992094372 5:73347821-73347843 CTTCACATCATTTCCAGTACTGG - Intergenic
994518643 5:100801022-100801044 GCTCCCATTATTCACAGAAAAGG + Intergenic
997999654 5:138614753-138614775 ATTCCCCTCATTCCAACAACAGG - Intronic
998778866 5:145633907-145633929 GTTCCCTGCATTCCCATAGCAGG + Intronic
1001091874 5:168747764-168747786 GTCCCATTCATTCTCAGAACAGG - Intronic
1002888500 6:1315622-1315644 GATCCCATCTTACCCAGGACAGG + Intergenic
1003871698 6:10409517-10409539 TTTAACATCATTCCCAGGACAGG + Intronic
1011856761 6:91702718-91702740 GTTGTCATTATTCACAGAACAGG + Intergenic
1012227200 6:96717849-96717871 TTTCCCATCATGGCCTGAACTGG - Intergenic
1013262494 6:108459514-108459536 ATTCCCATCATGGCCAGAAGTGG + Intronic
1014186683 6:118442784-118442806 GTTCCCATAATTCCCACATGTGG - Intergenic
1014707512 6:124765892-124765914 GTTCCCTAGATTCCCTGAACAGG - Intronic
1015057339 6:128919878-128919900 GTTCCCTTTATTCTCAGAAGTGG + Intronic
1017213390 6:151881483-151881505 GCTCCTAATATTCCCAGAACTGG - Intronic
1017853541 6:158328058-158328080 GTTGCCAGCATTCTCAGAGCTGG + Intronic
1018216868 6:161536928-161536950 GTTCCCATCCATCCCATTACAGG + Intronic
1018468334 6:164072863-164072885 GTTCCCATAATTCCCACATTTGG - Intergenic
1018478940 6:164170901-164170923 CTCCCCATCATTCCCAGGTCTGG + Intergenic
1019870898 7:3759959-3759981 TTTCCCATCATTTCCAATACTGG + Intronic
1020039521 7:4991477-4991499 GTTCCCATAATACCAAAAACTGG + Intronic
1020582582 7:10023124-10023146 ATTCCAAACATTCCCAGAAGAGG + Intergenic
1021974434 7:25997890-25997912 GTTCCCATAATTCCCACATGTGG - Intergenic
1023679236 7:42667317-42667339 TTTCCCATCATTTCTAGCACAGG - Intergenic
1024731330 7:52256857-52256879 ATCCCCATCATTCCCTAAACAGG + Intergenic
1025712524 7:63926103-63926125 GCTCCCATCATTCCCAGCAAAGG - Intergenic
1027603755 7:80273428-80273450 TTTCCCATCTTTCCCATTACTGG - Intergenic
1028067100 7:86400255-86400277 CTTTGCATCATTCCCAGTACTGG - Intergenic
1028725355 7:94080847-94080869 GTTCCTTCCATTCCCAGAACTGG - Intergenic
1029330453 7:99849338-99849360 GTCTCCATCACTCCCAGCACAGG + Intronic
1032965032 7:137086502-137086524 GTTCCCATAATTCCCACATGTGG - Intergenic
1033995218 7:147337382-147337404 GTTCCCATTGTTCCCAGAACAGG - Intronic
1034215439 7:149401977-149401999 CTCTCCATCCTTCCCAGAACAGG + Intergenic
1034233010 7:149547383-149547405 GTTCCCATCACACCTAGAACAGG - Intergenic
1035280103 7:157773019-157773041 CTTCCCAGAACTCCCAGAACTGG + Intronic
1036676339 8:10837085-10837107 GTTCCCACCATTCGCAGAACTGG + Intronic
1042370373 8:67984814-67984836 ATTCCCAGCCTTCCCAGAAGAGG + Intronic
1046753581 8:117950460-117950482 GTTCCCATTTTTCCTAGAAATGG + Intronic
1047588647 8:126302714-126302736 CTTCCCACCAACCCCAGAACAGG - Intergenic
1051145555 9:14023601-14023623 GTTTCCTTCCTTCCCTGAACAGG + Intergenic
1053643432 9:40108204-40108226 CTTCCCATCAGTCCCTGCACTGG + Intergenic
1053762717 9:41357286-41357308 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1054324288 9:63705431-63705453 CTTCCCATCAGTCCCTGCACTGG + Intergenic
1054350791 9:64015813-64015835 GTTCCCATCAGTCCCTGCACTGG - Intergenic
1054541320 9:66268400-66268422 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1055076053 9:72216246-72216268 GTTCCCATTTCTCCTAGAACAGG - Intronic
1055443604 9:76360914-76360936 GTTCACAGCATTACAAGAACAGG + Exonic
1059071508 9:111142191-111142213 GTTCCCACCATTTGCAGAACTGG - Intergenic
1060958787 9:127664334-127664356 GTTCCCATCACTCCAAGACCAGG - Intronic
1062428396 9:136516464-136516486 GTTTCCATCTGTCCCAGAGCTGG - Intronic
1062569717 9:137179475-137179497 GATCCCAGCAGTCCCAGTACAGG - Intronic
1203697813 Un_GL000214v1:114168-114190 CTTCCCATCAGTCCCTGCACTGG + Intergenic
1203697923 Un_GL000214v1:114614-114636 GTTCCCATCAGTCCCTGAGCTGG + Intergenic
1203490825 Un_GL000224v1:102968-102990 ATGCCCCTCATTCCCAGAAGAGG + Intergenic
1203503449 Un_KI270741v1:44846-44868 ATGCCCCTCATTCCCAGAAGAGG + Intergenic
1203551283 Un_KI270743v1:166372-166394 CTTCCCATCAGTCCCTGAGCTGG - Intergenic
1203551389 Un_KI270743v1:166818-166840 CTTCCCATCAGTCCCTGCACTGG - Intergenic
1186076732 X:5887708-5887730 GTTCCCAACCTTCCCAGACTAGG + Intronic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1187663370 X:21574650-21574672 GTTCCCATAATTCCCACATACGG - Intronic
1189766617 X:44378635-44378657 GTTCCCACCATTTCTAGAATTGG - Intergenic
1194557441 X:95377991-95378013 GTTCCTATCATTTTCAGAATGGG - Intergenic
1196526362 X:116731781-116731803 GTCCCCATCACTCATAGAACTGG - Intergenic
1198338614 X:135692478-135692500 GTTTCCTTCATTCACAGACCTGG + Intergenic
1198459647 X:136850779-136850801 TATCCCATCATTTCCAGAAATGG + Intronic
1198981373 X:142400107-142400129 GTTACCAAGATTGCCAGAACTGG - Intergenic
1199594690 X:149497247-149497269 GTTCTCACTATTCCCAGAATTGG - Intronic
1201152662 Y:11102422-11102444 CTTCCCATCAGTCCCTGCACTGG - Intergenic