ID: 1128915576

View in Genome Browser
Species Human (GRCh38)
Location 15:71558381-71558403
Sequence CTGTTCTAATGTATTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128915576 Original CRISPR CTGTTCTAATGTATTAAAGA TGG Intronic
901339732 1:8485403-8485425 CTGTTTTAATTTAATGAAGATGG - Intronic
903105187 1:21072160-21072182 CTTTTCTAAGGTAATAAAGTTGG + Intronic
904792419 1:33033349-33033371 CTTTTCTAGTGTTTTAAAGATGG - Intronic
905158858 1:36013559-36013581 GGGTTCTAATGCATTAAAGTAGG + Intronic
908686862 1:66730577-66730599 CTGTTGAAATGTATTGGAGAGGG - Intronic
909823358 1:80094186-80094208 CTGTTCTAAAAAATCAAAGAGGG - Intergenic
911743905 1:101418178-101418200 GTGTTCTAATGTATTGCGGAAGG + Intergenic
912122896 1:106495079-106495101 CTGTTCAATTGTATGAAAGCCGG + Intergenic
914823610 1:151124601-151124623 TTGTCCTAATTTATTAGAGAAGG + Exonic
917988143 1:180343054-180343076 CTATTCTAATGAATTAAAATAGG + Intronic
918895023 1:190331395-190331417 TTGTTCTAATGGACTAAATATGG - Intronic
919399508 1:197094249-197094271 CTCTTCTAATATTTTAAAGGGGG - Intronic
923171067 1:231417992-231418014 CTTTTCTAATCTATAAAAAAAGG + Intronic
923228357 1:231960556-231960578 CAGTTCTAATGATATAAAGAAGG - Intronic
924415668 1:243853676-243853698 ATGTTCTAATGTTCTAATGACGG + Intergenic
1066506759 10:36053424-36053446 CTGTTCTTATCTATGAAATAAGG - Intergenic
1066633150 10:37476571-37476593 CTAATCTAATCTATTAATGAGGG - Intergenic
1067350628 10:45472520-45472542 ATGTTCTAATATAGCAAAGATGG - Intronic
1072023022 10:91423337-91423359 ATGTTATAATGTATTAAAGTAGG + Intronic
1072052158 10:91715729-91715751 CTGTTCCAATCTACTTAAGATGG - Intergenic
1074288630 10:112121592-112121614 CTGTTCTCATGTCTTTAATAGGG + Intergenic
1075857410 10:125641599-125641621 CTGTTTTAATGCATTAGAGTTGG - Intronic
1078073953 11:8140220-8140242 CTCTTCTACTATTTTAAAGATGG + Intronic
1084439423 11:69163828-69163850 CTGTTCTAAAGCATAAAAGAAGG + Intergenic
1086219651 11:84427360-84427382 GTGCTCTCATGTATTAAAAATGG - Intronic
1088117459 11:106328610-106328632 CTATACTAATGATTTAAAGATGG - Intergenic
1093639233 12:21506418-21506440 CATTTCTAATGCAGTAAAGAAGG + Intronic
1093823840 12:23656949-23656971 TTTTTCTAATATATTAAAGGTGG - Intronic
1094171759 12:27500923-27500945 CTCTTCTGATGTATTATAGATGG + Intronic
1095493486 12:42760409-42760431 CTGCTCTAACTTTTTAAAGATGG + Intergenic
1097850970 12:64409183-64409205 CCATTCTAATGTTTTAAAGAAGG + Intronic
1098751333 12:74296612-74296634 CTGTTCTAATATTTTATACAGGG - Intergenic
1098764217 12:74465918-74465940 CTGTTTTTATTTATGAAAGATGG - Intergenic
1099050148 12:77772038-77772060 CTTTTGTAATGTACTAAACATGG + Intergenic
1099363895 12:81743563-81743585 CAGTTATAATTTATTAGAGATGG + Intronic
1099561405 12:84180279-84180301 CTGCCTTAATGTATAAAAGAAGG + Intergenic
1099660599 12:85554558-85554580 GTTTTCTAATATATAAAAGAAGG + Intergenic
1100911990 12:99374962-99374984 CTGTTGTAAAGTAATAATGACGG + Intronic
1101108320 12:101461289-101461311 CTCTTCTGATGCATTAAATAGGG - Intergenic
1102052835 12:109875526-109875548 CTGTTCTAAAGCATTAACAATGG - Intronic
1102336257 12:112083004-112083026 TTGTTGTAAGGTATTAAAAAAGG + Intronic
1104136094 12:125940337-125940359 CTGTCCTTATGTATAAAACAGGG + Intergenic
1104524273 12:129503686-129503708 CTTTACTAATTTATTAAGGATGG + Intronic
1105768811 13:23587823-23587845 CTGTGCTAATGCTTTAAAAAAGG - Intronic
1106743437 13:32673013-32673035 CTGTTTTATTGTATACAAGATGG + Intronic
1107156651 13:37175008-37175030 GTGTTAAAATGTATTAGAGAGGG - Intergenic
1108620245 13:52175672-52175694 CTGATCCAGTGGATTAAAGAGGG - Intergenic
1109415650 13:62035991-62036013 CTGTTCTATTGTACTCATGAGGG + Intergenic
1110950670 13:81486106-81486128 CTCTGATAATGTATTAAATAAGG - Intergenic
1111238527 13:85442308-85442330 CTATTTTAATATATGAAAGAGGG + Intergenic
1112664043 13:101548123-101548145 CTGTTAGAATGTAGAAAAGAAGG + Intronic
1114781087 14:25538974-25538996 ATGTGCTCATGTATTGAAGAAGG - Intergenic
1115132896 14:30074272-30074294 CTGTTCCAAAAAATTAAAGAGGG + Intronic
1116379031 14:44241193-44241215 GTGCTCTAATGGATAAAAGAGGG + Intergenic
1117167356 14:53050113-53050135 CAGTTCTAAGGAATGAAAGATGG + Intronic
1121167043 14:91813080-91813102 ATGTTTTAATGTAAAAAAGAAGG + Intronic
1124044560 15:26136818-26136840 CTGTTATCATGTGTTAAAAATGG - Intergenic
1124195724 15:27626098-27626120 CTGTTCAAGTGGATTAAAAAAGG + Intergenic
1125521381 15:40349617-40349639 ATGTTTTAATCTATAAAAGAGGG + Intergenic
1126886999 15:53161663-53161685 CTGATCTAATTTATTAATGAGGG - Intergenic
1128915576 15:71558381-71558403 CTGTTCTAATGTATTAAAGATGG + Intronic
1130079393 15:80718956-80718978 CTCTTCTATTTTTTTAAAGAAGG + Intronic
1130724879 15:86428862-86428884 ATGTTCTCATCTATTACAGAAGG + Intronic
1133560369 16:6945043-6945065 GTGTTCTAATGCATTATTGAGGG + Intronic
1135387782 16:22059291-22059313 CTGTTCAGATGTAATAAGGAAGG + Intronic
1136936733 16:34474944-34474966 ATGATCTAATGTAATAAAAATGG + Intergenic
1136945004 16:34638989-34639011 ATGATCTAATGTAATAAAAATGG - Intergenic
1136955327 16:34778021-34778043 ATGATCTAATGTAATAAAAATGG - Intergenic
1136959056 16:34824521-34824543 ATGATCTAATGTAATAAAAATGG - Intergenic
1136963086 16:34873626-34873648 ATGATCTAATGTAATAAAAATGG - Intergenic
1137092232 16:36208097-36208119 ATGATCTAATGTAATAAAAATGG - Intergenic
1137221599 16:46457506-46457528 ATGATCTAATGTAATAAAAATGG + Intergenic
1140052239 16:71492347-71492369 CTTTTTTAATGTTTTAGAGATGG + Intronic
1140724396 16:77799116-77799138 CAGTTTTTATGTATTAAGGAAGG + Intronic
1203124725 16_KI270728v1_random:1563235-1563257 ATGATCTAATGTAATAAAAATGG + Intergenic
1145324078 17:21784311-21784333 ATGATCTAATGTAATAAAAATGG + Intergenic
1147749221 17:42718332-42718354 CTGTTCTAACGTTTTACAAAGGG - Intronic
1149083567 17:52686852-52686874 CTCTTCTAGTTTATTGAAGAAGG - Intergenic
1150698775 17:67429183-67429205 CTATTCTATTTTATCAAAGAAGG + Intronic
1203182787 17_KI270729v1_random:79619-79641 ATGATCTAATGTAATAAAAATGG - Intergenic
1154516486 18:15172698-15172720 ATGATCTAATGTAATAAAAATGG + Intergenic
1154941829 18:21120962-21120984 ATATTTTGATGTATTAAAGAAGG + Intergenic
1156856351 18:41786033-41786055 ATGTTCTAATGTCTTTAGGATGG + Intergenic
1158376359 18:56873700-56873722 CTATTCTAATGTACTGAAGCAGG - Intronic
1159326500 18:66926563-66926585 CTGCTCTATTGCATTAAAAATGG + Intergenic
1159326565 18:66927740-66927762 CCGTTCTTATGCAATAAAGATGG - Intergenic
1160545470 18:79650286-79650308 CTGTTTTTATGTTTTAAAGGAGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164766918 19:30779312-30779334 GTGTTCTAATTAATTAGAGAAGG + Intergenic
1164774387 19:30841307-30841329 CTGTTCTAATGTATACAAAGGGG - Intergenic
1165987673 19:39784985-39785007 CTGTTCTTGTGTATTCAGGATGG + Intronic
925520781 2:4742511-4742533 ATGTGATAATGGATTAAAGATGG + Intergenic
927771090 2:25862432-25862454 GCCGTCTAATGTATTAAAGATGG - Intronic
928399575 2:30968162-30968184 CTGTTCTAGTGATGTAAAGATGG - Intronic
928969086 2:37008047-37008069 CTGTTATGATGGATTAAGGAAGG + Intronic
929851498 2:45595041-45595063 GTGTTCTAATGAATTAAGCAGGG - Intronic
930815405 2:55591825-55591847 CTGTTCCAATATATTTATGAAGG + Intronic
932708022 2:74041843-74041865 CTGTGCAAATAAATTAAAGATGG - Intronic
936876476 2:117195688-117195710 CTATTCTAAAGTTTTACAGAAGG - Intergenic
937843257 2:126548483-126548505 ATGTGTTAATGTAGTAAAGACGG - Intergenic
938516807 2:132017692-132017714 ATGATCTAATGTAATAAAAATGG + Intergenic
939260303 2:139799480-139799502 CTGTTCTAAGATTTTTAAGAAGG + Intergenic
939264686 2:139856015-139856037 CTGTTCTAAGGTGTTAGAGAAGG - Intergenic
940584236 2:155624180-155624202 ATGTTCTGATTTATTAAAGATGG + Intergenic
941386772 2:164862179-164862201 TTGTTCTAAAGTATGAAAAAAGG + Intergenic
942007897 2:171725766-171725788 CTTTTATTATGTATTAAAGTAGG + Intronic
942677575 2:178444734-178444756 GTGTTATAATGTTTCAAAGAAGG - Intronic
942966775 2:181903938-181903960 CTCTGCTATTGTATTAAACAAGG - Intronic
943078280 2:183225093-183225115 TTCTTCTAATGTATTCAAGTTGG + Intergenic
943151653 2:184121605-184121627 ATTTTCTAGGGTATTAAAGAGGG + Intergenic
945553142 2:211246654-211246676 TTGTTTTAAAGTACTAAAGATGG + Intergenic
946768592 2:223063582-223063604 CTGTTCTAAAATATAAAAGTTGG - Intronic
947040472 2:225913019-225913041 TTGTTTAAATTTATTAAAGAAGG + Intergenic
1172200235 20:33120971-33120993 CTGTGGTAATTTTTTAAAGAAGG - Intergenic
1176584765 21:8570915-8570937 ATGATCTAATGTAATAAAAATGG - Intergenic
1176964496 21:15196267-15196289 GTTTTCTAATGTATTAAGGGAGG + Intergenic
1177593103 21:23199080-23199102 GTATTTTAATGTATTAAAGCAGG - Intergenic
1177740902 21:25152625-25152647 CTTTTCTAATGAATTTCAGAAGG + Intergenic
1177753613 21:25317332-25317354 CTATTCTGATATATTAAAGATGG - Intergenic
1179324419 21:40326352-40326374 ATTTTCTAATGAATAAAAGAGGG - Intronic
1180267576 22:10547817-10547839 ATGATCTAATGTAATAAAAATGG - Intergenic
1180704410 22:17800336-17800358 CTGTTCTAGTGCAATAAAGCAGG + Intronic
949235547 3:1805107-1805129 CTCATCAAATGTATTAAATAAGG - Intergenic
949239078 3:1848213-1848235 CTGTTCTATCTTTTTAAAGAAGG + Intergenic
949338600 3:3004516-3004538 TTCTTCTAATGTATTATAGAGGG + Intronic
950087899 3:10273583-10273605 TTTTTTTAATGTAATAAAGATGG - Intronic
950245530 3:11413766-11413788 CTTTTCTAAAGAATTAAAGATGG - Intronic
951277038 3:20700231-20700253 ATTTTCTCATGTATGAAAGAGGG - Intergenic
951600743 3:24372111-24372133 GTGTTCTCATGTATTAAATATGG - Intronic
952088151 3:29851724-29851746 CTGTTCTAATATTTTGAAAAAGG + Intronic
952161094 3:30693959-30693981 CTGTACTCATGTATTAAAATAGG + Exonic
955448851 3:59045343-59045365 ATGTTCTAATGAATGAAAGAAGG + Intronic
955568435 3:60275715-60275737 TTGTTCTATAGTATTACAGAGGG + Intronic
956541528 3:70345119-70345141 CTGTGGTAATGGATTAGAGATGG - Intergenic
960966294 3:123107071-123107093 GTGTTCAAATGCATTAAATAAGG - Intronic
961463175 3:127065940-127065962 CTGTTCAAATGGCTTGAAGATGG - Intergenic
961627639 3:128274836-128274858 CTGTTCTTACTTATTTAAGAAGG - Intronic
964463340 3:156961814-156961836 CTATTCTAATGTATTAAGGTAGG - Intronic
965419129 3:168435408-168435430 CTGTTGTAATGTAATGAAAATGG + Intergenic
966653424 3:182326529-182326551 CTGTTCTAATGAATTTAAATGGG - Intergenic
967003697 3:185362802-185362824 GAGTTCTAATGAATAAAAGATGG + Intronic
970052707 4:11933317-11933339 CTCTTAGAATGTAGTAAAGAAGG + Intergenic
970091960 4:12419826-12419848 CTTTTCTAATCTGTTAAAAATGG - Intergenic
972036213 4:34525036-34525058 CTGTTCAAATGTATTTAATCTGG + Intergenic
972395826 4:38658889-38658911 CTTTTGTAATGTTTTAGAGATGG + Intergenic
973766383 4:54167050-54167072 CTGATTTCATGTGTTAAAGAAGG + Intronic
975299395 4:72772074-72772096 TTGTTCTAAAGTGTTAAACAGGG - Intergenic
975809185 4:78148083-78148105 CTGTTCTCATGTTTTGTAGAAGG - Intronic
976274086 4:83258383-83258405 CTTTTCTAATGTCTTGAATATGG + Intergenic
976298019 4:83491168-83491190 CTGTTATAATGTGTTAAAATAGG + Intronic
978385100 4:108170162-108170184 CTGTTCTGAAGTTTTACAGATGG - Intergenic
978640373 4:110863993-110864015 ATGTTATAATGTTTTAAAGTAGG + Intergenic
980599606 4:135004206-135004228 CTATGATAATGTATTAAAGAGGG + Intergenic
980782834 4:137514006-137514028 ATGTTCTTAAGTATTAAAGCAGG - Intergenic
980797851 4:137708698-137708720 CTGTTCTAATGAGATTAAGATGG + Intergenic
980821361 4:138021954-138021976 TTGTGCTAATGTATTTAACATGG + Intergenic
981097000 4:140792291-140792313 CTGTTTTAAAGTATGAAAAAGGG + Intergenic
982913892 4:161180623-161180645 CTGTTCAAATGTAATCAGGAAGG + Intergenic
983246126 4:165289624-165289646 CTTTCCTAGTGTATCAAAGAAGG - Intronic
984384758 4:179041901-179041923 CTTTTCTAAAATATTAATGAGGG + Intergenic
984661756 4:182382048-182382070 CTGATAGAATGTATTAAAGAGGG + Intronic
985066104 4:186123982-186124004 ATTTTCTAATGTGTGAAAGAAGG + Intronic
986075928 5:4338183-4338205 GTGTTCTACTGTATTGCAGAAGG - Intergenic
987996409 5:25286964-25286986 CTGTTATATTTTATTAAGGATGG - Intergenic
989191837 5:38677856-38677878 CTGTTCTCATGTATTCAAAACGG - Intergenic
991146583 5:63313225-63313247 CACTTCAGATGTATTAAAGAAGG - Intergenic
992697123 5:79301015-79301037 CTGTTCCAATGTGTTTAAGAGGG - Intronic
993393275 5:87348978-87349000 CTATTTTTATGTATTAAAGCTGG + Intronic
993478572 5:88395064-88395086 CTGTTTTGATGTGTTAAAGACGG + Intergenic
994435161 5:99720317-99720339 CTGTTTTAATTTATAAGAGAAGG + Intergenic
994664929 5:102694854-102694876 CTTTTCTACTTTATTAAATATGG + Intergenic
995098628 5:108271233-108271255 CTCTTCCAGTCTATTAAAGAAGG + Intronic
996000648 5:118359035-118359057 TTCTTTTCATGTATTAAAGATGG - Intergenic
996229726 5:121047010-121047032 CTGTGATAATGTCTTAAGGATGG + Intergenic
996534220 5:124559865-124559887 CTGTTCTAATGGATGAAAAATGG - Intergenic
998974659 5:147631420-147631442 CAGATCTACTGTATGAAAGAAGG - Exonic
999912734 5:156222914-156222936 CTGATTTATTGTTTTAAAGATGG + Intronic
1000949485 5:167463267-167463289 CTAGTCTAATGTCATAAAGATGG + Intronic
1002292343 5:178208648-178208670 CTGGTCTAATTTATTTAAGCAGG + Exonic
1003271003 6:4607836-4607858 CTGTTTTAATCTTTTAAAAACGG + Intergenic
1004641724 6:17522241-17522263 CTGCTCTACTGTATTTAAGTTGG + Intronic
1004672249 6:17808501-17808523 CAGTTTTATTGTTTTAAAGAAGG + Intronic
1004828103 6:19446055-19446077 CTATTCAAAGGAATTAAAGATGG + Intergenic
1007960716 6:45956590-45956612 AGGTTCTAATGTATGAAAGAAGG - Intronic
1010976520 6:82321419-82321441 CTGATCTAAGGTATTAAATAAGG + Intergenic
1011869607 6:91876282-91876304 CTGTGCTAATGTGTCAAATAAGG - Intergenic
1012183198 6:96181311-96181333 GTGTTCTAATGTGAAAAAGAGGG - Intronic
1012557945 6:100539067-100539089 CTCTTCTAATGAATTGAACAAGG - Intronic
1012764226 6:103344515-103344537 ATTTCCTAATATATTAAAGAAGG + Intergenic
1014562062 6:122902958-122902980 CTGTTCTAAGGTGGTAATGATGG - Intergenic
1014929617 6:127319683-127319705 CTGCTCTAATGTATAAAAGCTGG + Intronic
1014984697 6:127989608-127989630 CTGTTTTATTGATTTAAAGAAGG + Intronic
1016545501 6:145218703-145218725 TTTTTCTAATCTATTATAGAAGG + Intergenic
1017365968 6:153638279-153638301 CTTTTCTAATGTATTGAACTTGG + Intergenic
1020674224 7:11161333-11161355 CTGTCATATTCTATTAAAGAAGG + Intronic
1023513945 7:40981713-40981735 ATGTTCTAATGTTTTGTAGAAGG - Intergenic
1023675517 7:42625418-42625440 CTGTTCTAATGTTAGAAACATGG - Intergenic
1024394177 7:48847289-48847311 CTGTTTTCATGCAGTAAAGAAGG - Intergenic
1024401060 7:48925125-48925147 CTGTTTTCATGCAGTAAAGAAGG + Intergenic
1025489197 7:61090985-61091007 ATGATCTAATGTAATAAAAATGG + Intergenic
1025554245 7:62284410-62284432 ATGATCTAATGTAATAAAAATGG + Intergenic
1025560536 7:62368864-62368886 ATGATCTAATGTAATAAAAATGG - Intergenic
1025564622 7:62418170-62418192 ATGATCTAATGTAATAAAAATGG - Intergenic
1025875710 7:65478326-65478348 CTGTTTTAATGTGAAAAAGAAGG + Intergenic
1025974311 7:66357461-66357483 TTGTTTTAATGTATTATGGATGG + Intronic
1030440720 7:109585318-109585340 CTTTTCTAATTTATTGATGAAGG - Intergenic
1030575796 7:111284362-111284384 CTGTAGTAATGTAGTAATGAAGG - Intronic
1031414056 7:121474795-121474817 CTTTTCAAATGTATTACACAAGG - Intergenic
1032141865 7:129338596-129338618 CTGTTCTGATGGATGAAAGGTGG + Intronic
1032729789 7:134629044-134629066 ATGTTTTAAGATATTAAAGATGG - Intergenic
1033039610 7:137905933-137905955 CTGTTACAATGTCTTACAGAAGG + Intronic
1033790682 7:144789595-144789617 ATATTCTAATTTATTAAAAATGG - Intronic
1035896003 8:3402968-3402990 CTGTTCTAATGGTTTCCAGATGG + Intronic
1036597956 8:10231085-10231107 CTGTTCTGTAGTTTTAAAGAAGG + Intronic
1037073385 8:14681325-14681347 CATATCTAATGTATTAAAGGGGG + Intronic
1038026026 8:23591501-23591523 CTTTTCTTCTGAATTAAAGATGG + Intergenic
1038309640 8:26436427-26436449 CTGCTCTGATGGATTAAAGCAGG + Intronic
1038917962 8:32048081-32048103 CTATTCAACTGTAATAAAGAAGG - Intronic
1039932301 8:42004553-42004575 CTAGTCTATTGAATTAAAGAAGG - Intronic
1039932946 8:42011365-42011387 CTAGTCTATTGAATTAAAGAAGG - Intronic
1042792467 8:72623778-72623800 ATCTTCTCATGTATTAAATAAGG - Intronic
1044708238 8:95029199-95029221 AGGTTCCAATGTATTAAAGTAGG + Intronic
1045627635 8:104074318-104074340 CTTTTTTAATCTATTAAACAAGG + Intronic
1045852003 8:106712427-106712449 TTTTTCTAATTTATAAAAGAAGG - Intronic
1046110669 8:109719728-109719750 AGGTGATAATGTATTAAAGAAGG + Intergenic
1046194575 8:110843349-110843371 CTGTTCTATTTTACTAAACAAGG + Intergenic
1047684526 8:127291341-127291363 CTTCTATAATATATTAAAGATGG + Intergenic
1049975170 9:854513-854535 GTTTTCTAATGTTGTAAAGAAGG + Intronic
1050213679 9:3295448-3295470 CAGTCTTAATATATTAAAGAAGG + Intronic
1050737929 9:8785857-8785879 CTCCTGTAATGTATTACAGATGG + Intronic
1050859018 9:10400188-10400210 CTCTTCTCATTTATAAAAGAAGG + Intronic
1052038511 9:23710723-23710745 CTGTTCATATTTTTTAAAGATGG + Intronic
1052214027 9:25943666-25943688 CTGTTCTAACCTATTCAATAAGG + Intergenic
1052581090 9:30355212-30355234 ATGTTCTAATATAGTTAAGAGGG - Intergenic
1052910959 9:33881289-33881311 CTGCACTAATGTATTAATTAAGG + Intronic
1055188562 9:73488790-73488812 CTGTTTTATAGTATAAAAGAAGG - Intergenic
1055696271 9:78888451-78888473 CTCTGCAAATGTATTAAAAATGG + Intergenic
1056413000 9:86350675-86350697 CTGTTGTAATATATCAAAAATGG - Intronic
1057610793 9:96541825-96541847 CTGTTTTCATGCAGTAAAGAAGG - Exonic
1059347738 9:113641918-113641940 CTGTTCAAATATGTTAAAAATGG + Intergenic
1059411627 9:114136183-114136205 TTGGTCTACTCTATTAAAGATGG + Intergenic
1059816763 9:117925132-117925154 CTTTTCAAATGCATGAAAGAGGG - Intergenic
1203614670 Un_KI270749v1:48434-48456 ATGATCTAATGTAATAAAAATGG - Intergenic
1186664881 X:11706662-11706684 ATGTTCTAATATTTTAAACAAGG - Intergenic
1187015015 X:15318045-15318067 ATGTTCAAATATAGTAAAGATGG - Intergenic
1187561170 X:20404949-20404971 ATGTCATAATGTATTCAAGAAGG - Intergenic
1187755079 X:22515771-22515793 TTTTTCTAATGGATTAAAAACGG - Intergenic
1188227380 X:27617066-27617088 TTCTTCTAATCTATTAAAGGAGG - Intronic
1192024210 X:67431322-67431344 CTTTTCTACTGTTTTAAAGTTGG + Intergenic
1193247069 X:79241766-79241788 CTGTTCTCATATTTTAAAAATGG + Intergenic
1193371799 X:80707776-80707798 TGTTTCTAATGTATTTAAGAGGG - Intronic
1194548565 X:95269183-95269205 CTCTACTAAGGTAGTAAAGAAGG - Intergenic
1194705143 X:97166377-97166399 CCATTCTGATGCATTAAAGATGG + Intronic
1195386156 X:104315070-104315092 CTGGTCTGAAGTATTAATGAAGG - Intergenic
1197115215 X:122824063-122824085 CTGTTCTACTGTATTTTAGCGGG - Intergenic
1197271708 X:124431606-124431628 TTCTTCAAATGTATAAAAGAGGG + Intronic
1197443228 X:126515297-126515319 CTGTTCAAGAGTATTTAAGAAGG + Intergenic