ID: 1128921872

View in Genome Browser
Species Human (GRCh38)
Location 15:71618304-71618326
Sequence ACTTCCAGGTATACACTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128921867_1128921872 -3 Left 1128921867 15:71618284-71618306 CCATAAAAGTAAGCAATCCCACT 0: 1
1: 0
2: 2
3: 92
4: 896
Right 1128921872 15:71618304-71618326 ACTTCCAGGTATACACTTTAGGG 0: 1
1: 0
2: 0
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128921872 Original CRISPR ACTTCCAGGTATACACTTTA GGG Intronic
902576803 1:17383214-17383236 ACTTCCTGGTCTACACTCTGGGG + Intronic
902938235 1:19780249-19780271 TCTTCCAGGTCCACACTGTATGG - Intronic
903896746 1:26611373-26611395 ACAACCAAGTCTACACTTTAGGG - Intergenic
904717569 1:32480445-32480467 ACTTCAAGGTATGAATTTTAGGG + Intronic
905191119 1:36235703-36235725 ACTTCAAGGAACACACCTTAAGG + Intronic
905763054 1:40576651-40576673 ACTTCTAGGTATTCATTCTAGGG + Intergenic
908366605 1:63430401-63430423 ACTCCCAGGTATACACATAAGGG - Intronic
908385871 1:63641048-63641070 AGTTCTAGGTAAAAACTTTAAGG - Intronic
918580074 1:186116176-186116198 ACTTGAAAGTATACACTGTATGG + Intronic
918590115 1:186231656-186231678 CCTTCCAGGAAAACACTTTCTGG + Intergenic
918870415 1:189966100-189966122 ACTTACTGTTATACACTTTGAGG + Intergenic
918932020 1:190865842-190865864 ATTTCCATGTATGAACTTTAGGG + Intergenic
920807920 1:209252398-209252420 GCTTACTGGTATCCACTTTAAGG + Intergenic
1062977472 10:1695428-1695450 ACCTCAAGCTATCCACTTTAGGG + Intronic
1064642548 10:17429207-17429229 ACTGCCAGTTTTTCACTTTAGGG + Intronic
1064743053 10:18452828-18452850 TCTACCAGGTATACTCATTAAGG - Intronic
1066254566 10:33665832-33665854 AGTTCCAGAGATACACCTTAGGG + Intergenic
1071162994 10:82773086-82773108 ATTTCCAGGTATATACATAAAGG - Intronic
1071759863 10:88590411-88590433 ACTGCCAGTTATACATTTTATGG + Intronic
1085654809 11:78304237-78304259 CCTTTCAAGTATACAATTTAGGG + Intronic
1085997924 11:81943965-81943987 CATTCCAGGTATGCAATTTAAGG - Intergenic
1087571331 11:99930353-99930375 ACATCCAGGCATACACAGTAAGG - Intronic
1090456487 11:126854722-126854744 ACTTCCAGGTATATACCCAAAGG - Intronic
1090958191 11:131532566-131532588 ACTTCTGGGTATACACCTAAAGG - Intronic
1092092458 12:5814006-5814028 CCTTCCAGATATACTCTCTACGG + Intronic
1094014037 12:25842606-25842628 ACTCCAAGGTGTACAATTTAAGG - Intergenic
1094614474 12:32023699-32023721 ACTTGCTTGTATACATTTTAGGG + Intergenic
1098461191 12:70734712-70734734 ACTGCCAGGTCTACACTTTCAGG + Intronic
1098508778 12:71286362-71286384 TCTTCCAGTTTTACAGTTTAAGG + Intronic
1099551632 12:84052528-84052550 ACTTCCAGGTATACACCCAAAGG - Intergenic
1099772493 12:87078911-87078933 ACTTCTAGGTATATACTCAAAGG - Intergenic
1100185089 12:92129943-92129965 AATTCCAGGTATACTCATTGCGG - Intronic
1101993290 12:109505119-109505141 ACTTGAAAATATACACTTTAAGG + Intronic
1102286814 12:111664406-111664428 AGATACAGGTAAACACTTTAAGG + Intronic
1105884322 13:24628971-24628993 CCTTCCAAGTTCACACTTTATGG - Intergenic
1107146703 13:37068272-37068294 ACTTCTAGGTATATACTCAAAGG + Intergenic
1107459507 13:40587912-40587934 ACTTCCAGGGGTAAACTTTAAGG + Intronic
1108505402 13:51108271-51108293 ACTTCCACATATACATTTTGAGG + Intergenic
1110384986 13:74899788-74899810 ACTTCAAGGTATATACCCTAGGG + Intergenic
1115295999 14:31827718-31827740 ACTTGTAGGCATACAATTTAGGG - Intronic
1115352851 14:32414258-32414280 ACTCCCTGGTATACACTTTGGGG - Intronic
1116053408 14:39833469-39833491 ATTTTCAGCTATAAACTTTAAGG + Intergenic
1116225172 14:42141488-42141510 ACTTCCACTCATACACTCTATGG + Intergenic
1117287669 14:54302577-54302599 ACTTCCAGGTTGATGCTTTAGGG - Intergenic
1117645824 14:57851597-57851619 ACTTCCTGGCACACATTTTAGGG - Intronic
1120381432 14:83784928-83784950 ACTTCTAGGTATAAACCTAAAGG - Intergenic
1125988938 15:44086205-44086227 ACTTCTAGGAATACACTCAAAGG + Intronic
1126374708 15:47985518-47985540 AATTCCAGGTAGAGACTATAAGG - Intergenic
1128921872 15:71618304-71618326 ACTTCCAGGTATACACTTTAGGG + Intronic
1129129432 15:73479935-73479957 ACTTCCAGGTATATACCCAAAGG - Intronic
1129560928 15:76567391-76567413 ACTTCTAGGTATATACTGTATGG - Intronic
1130637168 15:85633933-85633955 ACTTTAAGGTATACACAATAAGG - Intronic
1130718263 15:86358528-86358550 ACTTCTAGGTATACACTCACAGG - Intronic
1133699764 16:8298110-8298132 ACTTCCACATATACATTTTAGGG - Intergenic
1133738086 16:8630758-8630780 ACTTCCAGGTATACAGACAAGGG - Intronic
1135478623 16:22801716-22801738 ACTGCCACGTGTACACTGTAAGG + Intergenic
1135661918 16:24304263-24304285 ACTTCCTAATATACATTTTAAGG + Intronic
1137292567 16:47061763-47061785 GCTTCCACGTCTACACTCTATGG + Intergenic
1138937188 16:61741588-61741610 ACTTGCAGGTATCCAGTTTATGG + Intronic
1138965101 16:62074641-62074663 ACATCGATGGATACACTTTACGG - Intergenic
1142703225 17:1677158-1677180 ACTTCCAGGTCGACACTCAAAGG - Exonic
1149121424 17:53171063-53171085 ACTGCCAGGTATTCACTATTTGG - Intergenic
1149194167 17:54100149-54100171 ACTTCCAGCAATACAATCTAAGG + Intergenic
1149527922 17:57371796-57371818 ACTTCTAGGTAAACATATTAAGG - Intronic
1157065403 18:44343219-44343241 AATGACAGGGATACACTTTAAGG - Intergenic
1165692569 19:37875013-37875035 ACTGTCAGGTTTACACTTTCAGG + Intergenic
926370588 2:12174965-12174987 ACTTCAATGTATCAACTTTAGGG - Intergenic
926620806 2:15045713-15045735 ATTTCCAGGTATATACCTGAAGG - Intergenic
926946328 2:18191584-18191606 ATTTCAAGGTATAAACTTCAGGG - Intronic
929217531 2:39431495-39431517 ACTTTCAGGGATACAGTTCAGGG - Intronic
929813046 2:45208028-45208050 ACTTAAAGGTATGTACTTTAAGG - Intergenic
932016963 2:68038330-68038352 ACTTCCATGTATGAATTTTAGGG + Intergenic
935704779 2:105846812-105846834 ACTTCTAGGTATACACCCAATGG + Intronic
935887944 2:107644615-107644637 ATTTTCAGGTATAGAATTTATGG + Intergenic
938681934 2:133701066-133701088 ACTTCCATGGATGCAGTTTATGG - Intergenic
940812292 2:158258914-158258936 ACTCCCAGGTATAGACTACACGG + Intronic
941103770 2:161328157-161328179 AATTCCATTTATTCACTTTAGGG + Intronic
941696230 2:168554328-168554350 ACTTCAATGTATACATTTTGGGG - Intronic
942940574 2:181610879-181610901 ACTTCCAGGAATTTACTCTAAGG + Intronic
944135574 2:196395871-196395893 ACTTCTGGGTATACACGTAAAGG + Intronic
944443532 2:199766121-199766143 ACTTCCAGCTTGACATTTTAAGG - Intronic
946790420 2:223295554-223295576 ACTTCCATGAATTCACATTATGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172372857 20:34408784-34408806 ACTTCCAAGCTTACACTGTAAGG - Exonic
1175554934 20:59844301-59844323 ACTTCTAGGTATACACGCAAAGG + Intronic
1179840562 21:44070227-44070249 ACTTCCAAGTATAAAATTAAAGG - Intronic
1182985392 22:34711402-34711424 CCTTTCAGGAATAAACTTTAGGG + Intergenic
1184933200 22:47697145-47697167 ACTTACTGTTATACACTCTATGG + Intergenic
949835269 3:8262127-8262149 ATTTCCAGGTATAAAATTTGTGG + Intergenic
951095335 3:18623055-18623077 ACTTCCTGGTATATACATCAAGG + Intergenic
952921285 3:38285781-38285803 ACCCCCAGGTATATACTCTAGGG - Intronic
955982580 3:64541832-64541854 ACTTACAGTTATAGACATTACGG + Exonic
957633520 3:82750134-82750156 ACTTCCAGGTATTTACTCAAGGG - Intergenic
961129221 3:124450044-124450066 ACTCCCAGGTATGCACATAAGGG - Intronic
962021636 3:131508367-131508389 TCTTCCAGGTAAACACTGTTAGG - Intergenic
962208044 3:133451579-133451601 ACTTCCTGGTATATACAGTAGGG + Intronic
964598448 3:158466237-158466259 ACATTCAGCTATACTCTTTATGG + Intronic
970863296 4:20729597-20729619 AATTCCATTTATATACTTTAAGG - Exonic
971908906 4:32768426-32768448 ACTTTCTGGTATACACTTCCTGG - Intergenic
972341961 4:38159816-38159838 ACTTCCAGGTTTCTGCTTTAGGG - Intergenic
973763985 4:54147272-54147294 ACTTCCAGGTATAATTTCTATGG + Intronic
976336158 4:83889924-83889946 TTTTCCAGGTATAGATTTTATGG + Intergenic
979910650 4:126361744-126361766 GCTTGCATGTATACATTTTAGGG - Intergenic
979917991 4:126462886-126462908 TCTTCTGGGTATACATTTTAGGG + Intergenic
981908309 4:149949446-149949468 ACTGCAAGGTTTACAATTTATGG + Intergenic
982420800 4:155194740-155194762 ATTACCAGGTATACACTCAAAGG - Intergenic
982530379 4:156534099-156534121 AGTTCTAGATATACAGTTTAAGG + Intergenic
984496078 4:180498709-180498731 ACTTCTAGGTATACACCAGAAGG - Intergenic
987313437 5:16701949-16701971 ACTTCAACCTATAGACTTTATGG - Intronic
988248792 5:28726641-28726663 ACTTCTAGAAATACTCTTTAAGG + Intergenic
989220550 5:38956861-38956883 ACTTCCAAGCATACAACTTAAGG - Intronic
990203297 5:53402126-53402148 ACTTCCCTGGATACACTTGAGGG - Intergenic
990614308 5:57491613-57491635 ACTTCTTGGTATAGACTTTAAGG + Intergenic
990752403 5:59031221-59031243 ACTTCTAGGTATACACCCAAAGG + Intronic
990974849 5:61550545-61550567 ACTTCAAGTTTTACAGTTTATGG - Intergenic
994156417 5:96508526-96508548 AATTCCAGAAATTCACTTTATGG - Intergenic
994864485 5:105248688-105248710 ACTTATTGGTATACATTTTAGGG - Intergenic
998918090 5:147038100-147038122 ACTTCCTGGTATAGTTTTTAGGG + Intronic
1007356792 6:41325760-41325782 ACTTCCAGGGGAACAATTTAAGG + Intergenic
1008065760 6:47046217-47046239 CATTCCAATTATACACTTTAAGG + Intergenic
1008294468 6:49758156-49758178 ACATCCAGGTACACTCATTAGGG - Intergenic
1009934975 6:70223517-70223539 ACTTCCAGGTACTAGCTTTAAGG + Intronic
1010527501 6:76921939-76921961 ACTTCTGGGTATATGCTTTAAGG + Intergenic
1010692462 6:78926547-78926569 TTATCCAAGTATACACTTTAAGG + Intronic
1012126304 6:95432819-95432841 ACTTCTAGGTATACACCCAAAGG + Intergenic
1016257553 6:142126409-142126431 ACTTCTAGGTATAAACCTGAAGG - Intergenic
1017332281 6:153213724-153213746 ACTTCAAGGTATATATTTTGCGG + Intergenic
1017585514 6:155918122-155918144 ACTTCTAGGTATTTACTCTAAGG + Intergenic
1018325555 6:162663956-162663978 ACATGCAGGTATACACGTTCTGG + Intronic
1022055290 7:26725413-26725435 ACTTCCAGGTATTTACTTTCTGG - Exonic
1023199038 7:37673660-37673682 TCTTCCAGGTGTAGACTTCAGGG + Intergenic
1028553956 7:92102819-92102841 ATTTCCAGGTAAAGACTTGAAGG + Exonic
1028692386 7:93668036-93668058 ACTTCAACGTATACATTTTGGGG + Intronic
1031132607 7:117849997-117850019 ACTTCCAGGGATACTCATGAAGG + Intronic
1032448135 7:132002346-132002368 ACTTCCATGCAGACACTTTAAGG - Intergenic
1033524886 7:142201420-142201442 ACTTCCAGGAATCTACTCTATGG - Intronic
1033707007 7:143900119-143900141 ACTCCCAGCTATATACTCTAGGG + Intronic
1036500137 8:9306428-9306450 ACTTCTAGGAATGTACTTTAAGG + Intergenic
1040793111 8:51256830-51256852 CCTCCCAGGTATAGAATTTAGGG + Intergenic
1040803913 8:51373055-51373077 ACTTCAACATATACATTTTAGGG - Intronic
1044562024 8:93621817-93621839 ACTTCCAAGTATACATTGTAGGG + Intergenic
1045810860 8:106218211-106218233 AATTCTAAGTATACACTTTGAGG + Intergenic
1046535310 8:115501332-115501354 ACTAGCAGGTATACACCTTGAGG - Intronic
1048873020 8:138814282-138814304 ATATCCAGGTATCCCCTTTAGGG + Intronic
1048925571 8:139267940-139267962 ACTTCCATGTATGCATTTTGGGG - Intergenic
1050669339 9:7978689-7978711 ACTTCCATATATACACATAATGG - Intergenic
1052533679 9:29721383-29721405 ACTTCCCGGTATTCAGTGTAAGG - Intergenic
1057527687 9:95817165-95817187 TCATCCAGGTATACCTTTTATGG + Intergenic
1058462625 9:105197193-105197215 GCTTCCTTTTATACACTTTAGGG + Intergenic
1058728099 9:107823066-107823088 AGTTCAAGGTAGACAGTTTAGGG + Intergenic
1187375900 X:18754396-18754418 ACTCCTAGGTATGCCCTTTAGGG - Intronic
1188812768 X:34672235-34672257 ACTTCCTGGTCTGCACCTTAGGG - Intergenic
1189397106 X:40632789-40632811 ACTTTTAGGTATACAAATTAAGG + Intronic
1189534000 X:41917547-41917569 ATATCCAGGTACACAATTTAGGG + Intronic
1193051779 X:77109273-77109295 ACTTTCAGGTATACATTAAAAGG + Intergenic
1194050700 X:89064274-89064296 ATTTTCAGGTAGACACTTTCAGG + Intergenic
1195470786 X:105227280-105227302 ATTACCAGGTTTACACCTTACGG + Intronic
1195804717 X:108751193-108751215 ACTTCCAGGTATCCACCATTAGG + Intergenic
1195825809 X:108999249-108999271 ATTACCAGGTATATACTTAAAGG - Intergenic
1196256480 X:113525907-113525929 AGATCCAGATATACACTATAGGG + Intergenic
1197081975 X:122429419-122429441 GGTTCCAGGTATACACATAAAGG - Intergenic
1199116005 X:143992876-143992898 ACTTCAATGTAAACATTTTAGGG + Intergenic
1201728162 Y:17177204-17177226 ACTTCAATGTATACATTTTAAGG - Intergenic