ID: 1128925454

View in Genome Browser
Species Human (GRCh38)
Location 15:71651209-71651231
Sequence ATGGCCAACTGGACTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128925454_1128925458 -1 Left 1128925454 15:71651209-71651231 CCATCTTCAGTCCAGTTGGCCAT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1128925458 15:71651231-71651253 TTCCTTCAGCGTGATGTTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 112
1128925454_1128925459 0 Left 1128925454 15:71651209-71651231 CCATCTTCAGTCCAGTTGGCCAT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1128925459 15:71651232-71651254 TCCTTCAGCGTGATGTTGGTGGG 0: 1
1: 0
2: 2
3: 5
4: 77
1128925454_1128925457 -4 Left 1128925454 15:71651209-71651231 CCATCTTCAGTCCAGTTGGCCAT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1128925457 15:71651228-71651250 CCATTCCTTCAGCGTGATGTTGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128925454 Original CRISPR ATGGCCAACTGGACTGAAGA TGG (reversed) Intronic
900498790 1:2989569-2989591 ATGGACAAATGGATGGAAGATGG - Intergenic
901001247 1:6149838-6149860 ATGGACAAATGGACGGATGATGG + Intronic
901001374 1:6150548-6150570 ATGGACAAATGGATTGATGATGG + Intronic
901347638 1:8560481-8560503 ATGGCCTACTGGAAAGAAGATGG + Intronic
901480470 1:9521479-9521501 CTGTCCATCTGGACTCAAGAAGG - Intergenic
903129154 1:21267094-21267116 ATGGCATATGGGACTGAAGAGGG - Intronic
904348949 1:29892590-29892612 TTGTCCATCTGGGCTGAAGAGGG - Intergenic
908805292 1:67924292-67924314 ATGAGCAACTGAACTGAAAAGGG - Intergenic
909964021 1:81884928-81884950 ATGGCAAAATGAACTGAAGGAGG + Intronic
909965653 1:81906230-81906252 AGGTGTAACTGGACTGAAGAGGG - Intronic
911037482 1:93566134-93566156 ATGGCCAACTAGGCTACAGAGGG - Intronic
913165121 1:116178123-116178145 TTGCCCAGCTGGGCTGAAGATGG - Intergenic
917275741 1:173329671-173329693 ATTGCCTATTGAACTGAAGAAGG - Intergenic
917933416 1:179840001-179840023 ATGGCCAACTAATCTGAATAAGG + Exonic
919117918 1:193304551-193304573 ATGGCAGACAGGACTGAAGAGGG - Intergenic
919193702 1:194256566-194256588 ATGCCCACCTGAACTGGAGAGGG - Intergenic
1063801922 10:9589701-9589723 ATGGCCAACATGGCTGAACATGG - Intergenic
1068610337 10:59053053-59053075 ATGGGAATCTGGACTGAAGATGG - Intergenic
1069566095 10:69464439-69464461 ATGGCCCCCTGGCCTGAGGACGG - Intronic
1069761174 10:70812631-70812653 ATTGCCAACTGGAGTGAGCAAGG - Intergenic
1069839489 10:71330259-71330281 AGGGCCAACTGGGCTCAACATGG + Intronic
1071300577 10:84253322-84253344 ATGGTCGACTGTGCTGAAGATGG - Intronic
1074087967 10:110223022-110223044 AAGGCCACCTGCATTGAAGAAGG - Intronic
1074094532 10:110298651-110298673 ATGGCAGTCTGGAGTGAAGATGG - Exonic
1075292164 10:121240123-121240145 ATGGCCAGCTGGCCTGTAGAAGG + Intergenic
1078430550 11:11285003-11285025 AGGGCCCCTTGGACTGAAGATGG + Intronic
1079495763 11:21042339-21042361 ATGGCCCACTGCCCTGAAAATGG - Intronic
1084598067 11:70128962-70128984 GTGACCACCTGGACTGAGGATGG - Intronic
1089373344 11:117977307-117977329 AAGGCCATCTGGGCTGCAGAAGG + Intergenic
1091055107 11:132410693-132410715 TCAGCCAACTGGACGGAAGATGG - Intergenic
1091773872 12:3171748-3171770 GTGTCCTACTGGCCTGAAGAAGG + Intronic
1092502508 12:9063319-9063341 ATGACCAACTGGCCTGAAATGGG + Intergenic
1095470974 12:42536465-42536487 ATGTCCAACTCCGCTGAAGAGGG - Intronic
1097376061 12:58844399-58844421 AAGACCTACTGGAGTGAAGAGGG + Intergenic
1100039920 12:90302981-90303003 ATGCTCATCTGGACTGGAGAGGG + Intergenic
1102330451 12:112024777-112024799 ACGGCCAACAAGACTTAAGAAGG + Intergenic
1105707339 13:22976607-22976629 ATGGCCCTCTGGACTGATGTGGG + Intergenic
1105944131 13:25175413-25175435 CTGGCCAAGTGGTCTGCAGATGG - Intergenic
1107394351 13:39999789-39999811 ATGGACATCTCAACTGAAGAAGG + Intergenic
1110541661 13:76713163-76713185 ATGCCCACCTACACTGAAGAGGG + Intergenic
1112624113 13:101082943-101082965 ATGGCAAAGTGGGCAGAAGAGGG - Intronic
1112975051 13:105307173-105307195 ATGGGCAAATGGACTTAAGTAGG - Intergenic
1113610467 13:111641445-111641467 ATTGCCACCAGGACTTAAGAAGG + Intronic
1114081638 14:19205695-19205717 CTGGCCAACTGGTCTCAATAAGG - Intergenic
1115749789 14:36477646-36477668 ATGGCAAACAGGAGTCAAGAGGG + Intronic
1115950924 14:38720323-38720345 ATGGCCATATGGGATGAAGAGGG - Intergenic
1118902583 14:69999198-69999220 GTGGCCAAATGGCCTGAAGCAGG - Intronic
1123037160 14:105476166-105476188 ATGGGCAGTTGGACTGCAGAAGG - Intronic
1128809130 15:70557286-70557308 TTGGCCAAATGGACTGGAGTAGG - Intergenic
1128925454 15:71651209-71651231 ATGGCCAACTGGACTGAAGATGG - Intronic
1129702357 15:77775171-77775193 ATGGCCAAGGAGACTGGAGAGGG - Intronic
1130041645 15:80410094-80410116 AGAGCCAATTGGACTGAAGCGGG + Intronic
1130878575 15:88035159-88035181 ATGACCAACAGGACTGCAGGGGG + Intronic
1130957168 15:88636006-88636028 ATGCCCAGCAGGACTGGAGATGG + Intergenic
1130960738 15:88657217-88657239 ATGGCCCACTGCACAGATGAGGG + Intergenic
1135244006 16:20838724-20838746 AAGGCTGACAGGACTGAAGAAGG - Intronic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1139503516 16:67387440-67387462 AGGGCAAACTGGACTCAACATGG + Intergenic
1143055920 17:4161738-4161760 AGGGCCACCTGTACTGGAGAGGG - Intronic
1145041829 17:19582785-19582807 ATGGCCAAGTGGATTAAGGACGG + Intergenic
1145042581 17:19587925-19587947 ATGGCCAAGTGGATTAAGGACGG - Intergenic
1148694461 17:49550541-49550563 AAGGCCCACAGGACTGAGGACGG - Intergenic
1155413224 18:25568948-25568970 ATGACTGACTGGACTAAAGAAGG - Intergenic
1155720192 18:29001726-29001748 ATTTCCAAGAGGACTGAAGATGG - Intergenic
1159188297 18:65007971-65007993 ATGGTAAACTAGACTGAACAAGG + Intergenic
926212695 2:10882924-10882946 CTGGCCTACAGGACTGAAAATGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927023552 2:19042276-19042298 CTGGCCAACTTAACTCAAGAAGG + Intergenic
927226153 2:20767603-20767625 ATGGGCCACTGGGCAGAAGAGGG + Intronic
928090924 2:28374704-28374726 CTGCCCAACCAGACTGAAGATGG + Intergenic
928437634 2:31265967-31265989 AAGGCCCACTGGGCTGATGATGG - Intronic
933426410 2:82118332-82118354 ATGGCAAACTGGAAGGAAGATGG + Intergenic
936064525 2:109320306-109320328 GTGGCCACCTGGACTAGAGAGGG + Intronic
938494957 2:131790897-131790919 CTGGCCAACTGGTCTCAATAAGG + Intergenic
946326834 2:218988982-218989004 ATCACCAACTGGACCGAAGAGGG + Intergenic
947230022 2:227875298-227875320 ATTGCCATATAGACTGAAGAGGG - Intronic
1168903189 20:1383184-1383206 CTGGGTAACAGGACTGAAGAAGG + Intronic
1172718689 20:36983046-36983068 ATGGCAGACCGGACTGAACAGGG - Intergenic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1174046890 20:47740185-47740207 ATGGCCCATTTGACAGAAGAGGG + Intronic
1175320709 20:58086011-58086033 ATGGCCAACTGGCCTGCTGTAGG + Intergenic
1179631317 21:42680312-42680334 ATGGCCAAGGGGACTGGAGCAGG - Intronic
1180499137 22:15916975-15916997 CTGGCCAACTGGTCTCAATAAGG + Intergenic
1181484749 22:23223674-23223696 CTTGCCAACTGGAGTGGAGAAGG - Intronic
1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG + Intronic
950415520 3:12867039-12867061 TTGGCCAAGTGGACAGATGAAGG - Intronic
950417092 3:12875014-12875036 TTGGCCAAGTGGACAGATGAAGG - Intergenic
951602035 3:24387389-24387411 AATGCCAACTGGGCTGGAGAGGG - Intronic
951728685 3:25786556-25786578 ATCTCCAACTTGACTGAAGTGGG + Intronic
955169436 3:56549037-56549059 ATGGGGAACTGGATTGCAGATGG - Intergenic
955483050 3:59408652-59408674 AGGGACACCTGGTCTGAAGACGG + Intergenic
956056247 3:65301658-65301680 AAGACCAACTGGACTCAACATGG + Intergenic
957266310 3:77970723-77970745 ATGCCCACCTGTACTGGAGAGGG - Intergenic
960534441 3:118801155-118801177 ATGGTAGACTTGACTGAAGAGGG - Intergenic
961783818 3:129337513-129337535 TTGGCCAAGTGGACAGATGAAGG - Intergenic
966452417 3:180077364-180077386 AGGGCCAACTGTACTGCTGAAGG + Intergenic
970267730 4:14307518-14307540 AAGGCCAACTGGAACAAAGAGGG - Intergenic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
971162497 4:24147561-24147583 TTGGCCAACTGAACTGAAAATGG + Intergenic
971686578 4:29777395-29777417 ATGAACAACTGTGCTGAAGAAGG - Intergenic
974469713 4:62302736-62302758 ATTGCCAACTGAGCTGCAGAAGG + Intergenic
975245281 4:72113403-72113425 ATGGCTAAATGGATTGATGAAGG - Intronic
975504838 4:75126229-75126251 GTGGCCCTCTGGACTTAAGATGG + Intergenic
976373747 4:84320474-84320496 AGGGCCAACGTCACTGAAGAGGG - Intergenic
977368028 4:96097766-96097788 ATGGGCAACTGGCTTGAACAAGG + Intergenic
979035838 4:115716267-115716289 ATAGCCATTTTGACTGAAGAGGG + Intergenic
983924273 4:173381048-173381070 ATGGCCAACTGATTTCAAGAGGG - Intergenic
984451994 4:179914194-179914216 GTGCCCACCTGGACTGAGGATGG - Intergenic
985975713 5:3417815-3417837 CTGGCCAACTTGCCTGTAGAAGG + Intergenic
996259343 5:121446366-121446388 AGGGCCAACTGCACTGAATGGGG + Intergenic
996471536 5:123866987-123867009 ATGGCAAAGTGGAATGTAGAAGG + Intergenic
1001628666 5:173158371-173158393 AGAGGCAACTGGACTGAAGAGGG + Intronic
1001788954 5:174437952-174437974 ATGGACAAATTGACAGAAGAAGG + Intergenic
1013141573 6:107341237-107341259 GTGGCCAACTGGAGGGATGAAGG + Intronic
1013269015 6:108528495-108528517 ATTGGCAACTGGAGTGGAGAGGG + Intergenic
1014918042 6:127177389-127177411 ATGGCCAGCTGGGTTCAAGAAGG - Intronic
1016607139 6:145943118-145943140 AAGGCCACTTGGACTAAAGAGGG - Intronic
1023528912 7:41133560-41133582 ATGGCCAAGTGCACAGAAGAAGG + Intergenic
1028236427 7:88368082-88368104 ATGGCCAACATGTCTGAACAAGG - Intergenic
1032718699 7:134532561-134532583 CTGACCAACTGGAGTGATGATGG + Intronic
1034379211 7:150675192-150675214 ATGGACAACTGGACAGATTATGG - Intergenic
1037706628 8:21321038-21321060 ATGGACAGCAAGACTGAAGATGG - Intergenic
1037893203 8:22635012-22635034 GTGGCCGAGGGGACTGAAGATGG + Intronic
1039426979 8:37494114-37494136 ATGGGCACCTGGACTGAAGAAGG - Intergenic
1040763227 8:50875209-50875231 ATGGACAAATGGACAGAAGTAGG + Intergenic
1041463035 8:58132436-58132458 GTGGCCACAAGGACTGAAGAGGG - Intronic
1041644456 8:60237531-60237553 AGGGTCCACTGGACTAAAGATGG + Intronic
1042964281 8:74334361-74334383 ATGGACAAATAGACTGTAGATGG - Intronic
1043360746 8:79469080-79469102 ATGACCAACTGGACTCAACATGG - Intergenic
1043707656 8:83372651-83372673 ATGGGCAACTGCTCTGAAGAAGG + Intergenic
1047849570 8:128842016-128842038 ATGCCCATCTGCATTGAAGAGGG - Intergenic
1050220846 9:3388143-3388165 ATGGCAAACAGAAGTGAAGATGG + Intronic
1055648595 9:78384731-78384753 ATGGAAAACTGGATTGCAGAGGG + Intergenic
1057475782 9:95399789-95399811 ATGGCTGACAGGCCTGAAGATGG + Intergenic
1057515415 9:95716355-95716377 ATGGCTGGCTGGAGTGAAGATGG - Intergenic
1062166698 9:135111416-135111438 ATGGCCCATTGAACTGGAGAAGG + Intronic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1191607627 X:63079590-63079612 ATGGCAAACTGGAGTGATCAGGG - Intergenic
1191607663 X:63079836-63079858 ATGGCAGACTGGAGTGAATAGGG - Intergenic
1191635697 X:63373668-63373690 ATGACCAACTGGCCTGAAATGGG + Intergenic
1197646268 X:129021027-129021049 ATGGCCAACAGAACTTAGGATGG + Intergenic
1198140871 X:133802004-133802026 ATGGCGAACAGAAATGAAGAGGG - Intronic
1200253529 X:154566735-154566757 ATGGGCACCTGGCTTGAAGAAGG - Intergenic
1200264238 X:154637673-154637695 ATGGGCACCTGGCTTGAAGAAGG + Intergenic
1201730212 Y:17194008-17194030 AGGGGCCACAGGACTGAAGAGGG + Intergenic