ID: 1128926013

View in Genome Browser
Species Human (GRCh38)
Location 15:71656894-71656916
Sequence CATGATAATGTTGAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128926011_1128926013 9 Left 1128926011 15:71656862-71656884 CCTAGAAGATAGTAAAGACTGTA 0: 1
1: 1
2: 1
3: 21
4: 230
Right 1128926013 15:71656894-71656916 CATGATAATGTTGAGGAAGATGG 0: 1
1: 1
2: 1
3: 29
4: 376
1128926010_1128926013 16 Left 1128926010 15:71656855-71656877 CCGAGGACCTAGAAGATAGTAAA 0: 1
1: 0
2: 2
3: 29
4: 273
Right 1128926013 15:71656894-71656916 CATGATAATGTTGAGGAAGATGG 0: 1
1: 1
2: 1
3: 29
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128926013 Original CRISPR CATGATAATGTTGAGGAAGA TGG Intronic
900505072 1:3025941-3025963 CATGATGATGGTGAGGATGGTGG + Intergenic
900505122 1:3026323-3026345 CATGATGATGGTGAGGATGGTGG + Intergenic
901218637 1:7569615-7569637 CATGATGATGATGATGAAGATGG - Intronic
901974889 1:12936568-12936590 CATGATGAAGTTGTGGCAGAGGG + Intronic
902010285 1:13265196-13265218 CATGATGAAGTTGTGGCAGAGGG - Intergenic
902102964 1:14008690-14008712 GATGAAAATGTTGATGAGGATGG + Intergenic
904111065 1:28126520-28126542 CAGAATAATGTGGAGGAAGGAGG - Intergenic
904431011 1:30464147-30464169 GATGATGATGGTGAGGATGATGG + Intergenic
906926639 1:50124800-50124822 GATGAAAATGTTGAGGCATAGGG - Intronic
906975844 1:50572077-50572099 GATGATAATGATGAGGGAAAAGG - Intronic
907317384 1:53581155-53581177 CCTGATAATGCCGATGAAGAAGG + Intronic
907560968 1:55387109-55387131 CATAATAATATTGATGATGATGG - Intergenic
908399296 1:63755391-63755413 CATTAGCATGTTGAGGCAGATGG + Intergenic
908440882 1:64152802-64152824 AATGATAATGTTGAGCAGGCAGG + Intronic
908462457 1:64358589-64358611 CATGATGATGGTGATGAAGTAGG - Intergenic
909402310 1:75247795-75247817 CTTAATAATGTTGAGGTCGATGG + Intronic
909725062 1:78824934-78824956 GATGATAATGTTTTGGAACAGGG - Intergenic
910587440 1:88895007-88895029 CATGGTGATGTTGGAGAAGATGG + Intergenic
911287635 1:96016281-96016303 CATCATAATATTGAGGGTGAAGG - Intergenic
914450766 1:147789471-147789493 AATGTTGATGTTGATGAAGAAGG + Intergenic
917675691 1:177317105-177317127 CATGATACCGTTGAGGTACAAGG - Intergenic
919295926 1:195699662-195699684 CATATTCATGTTGAGGAAGTTGG + Intergenic
919653680 1:200176916-200176938 CATGAGAATGATTAGAAAGACGG + Exonic
923116457 1:230944093-230944115 CATGTTATTGTTGAGTAAGTAGG - Intronic
924299337 1:242621404-242621426 GATGATAATGATGATGACGATGG + Intergenic
1062950388 10:1495744-1495766 AATGATAATGATGATGATGATGG - Intronic
1062950411 10:1496263-1496285 GATGATAAAGTTGATGATGATGG - Intronic
1063283735 10:4660749-4660771 CATGCTAATGTTCAGGAGAAAGG - Intergenic
1063444397 10:6100582-6100604 GATGATGATGATGGGGAAGAGGG + Intronic
1063927725 10:10996933-10996955 GATGATACTGTTGACCAAGAAGG - Intergenic
1064835005 10:19516790-19516812 AATGATAATGATGAAGGAGAAGG - Intronic
1064857056 10:19780754-19780776 TATTATAAGGTTAAGGAAGAAGG - Intronic
1065799706 10:29340857-29340879 CCTGTAAATGTTGATGAAGATGG + Intergenic
1066114924 10:32231063-32231085 AATAATAATGATGATGAAGATGG - Intergenic
1066293187 10:34032428-34032450 CATGATGAAGATGATGAAGATGG + Intergenic
1069059396 10:63878704-63878726 CAAAATAATCTTGAGTAAGAAGG - Intergenic
1069792666 10:71033069-71033091 GATGATAATAATGATGAAGATGG + Intergenic
1070995649 10:80777931-80777953 CAAGATAATGTAAAGGCAGAAGG - Intergenic
1071601639 10:86961441-86961463 CATGATGATGATGATGATGATGG - Intronic
1072082263 10:92044173-92044195 GATGATGATGATGATGAAGACGG + Intergenic
1072134149 10:92527391-92527413 TAAGATAATTTTGAGGAACAAGG - Intronic
1072991519 10:100199661-100199683 CAAGAAAATGTTTAGAAAGATGG - Intronic
1073580211 10:104658728-104658750 CATGATGATGATGATGATGATGG + Intronic
1074020783 10:109580348-109580370 CATGATAATGCTGTATAAGAAGG - Intergenic
1076528074 10:131125128-131125150 AGTGATGATGGTGAGGAAGATGG + Intronic
1077546715 11:3174567-3174589 GATGATAATGATGATGATGAAGG - Intergenic
1078953214 11:16159365-16159387 TATGAAAATGTTGAGAAATAAGG - Intronic
1079837707 11:25355034-25355056 CAATAAAATGCTGAGGAAGAAGG + Intergenic
1079898484 11:26151015-26151037 CTTGTTAATGTTTAGGAATATGG - Intergenic
1080573117 11:33575103-33575125 CTAGATTATGCTGAGGAAGAAGG - Intronic
1081919098 11:46756220-46756242 GATGATAATGGTGAAGAGGAAGG - Intronic
1082223019 11:49665026-49665048 CTTGATACTGTTGATGTAGAAGG + Intergenic
1082733771 11:56832440-56832462 AATGATAAGGTTGAGGCACAGGG - Intergenic
1084459989 11:69291603-69291625 GATGATAATGTTGGTGATGATGG - Intergenic
1084460028 11:69291917-69291939 GATGATAATGGTGATGATGATGG - Intergenic
1086238589 11:84662074-84662096 CATGATAATATGGAAGTAGAGGG + Intronic
1087117527 11:94541605-94541627 CATTACAATGCAGAGGAAGAGGG - Intergenic
1087169148 11:95032777-95032799 AATGATAGTTTTGATGAAGAAGG + Intergenic
1087585340 11:100112283-100112305 AATGAACATGTTGAGGAATAAGG + Intronic
1088143498 11:106647601-106647623 CAGCATGATGGTGAGGAAGATGG - Intergenic
1088522625 11:110715517-110715539 CATAATAATGGAGATGAAGATGG - Intergenic
1090329512 11:125920067-125920089 CTTGTTAATGTTGAGAAGGAAGG + Intronic
1090493654 11:127188849-127188871 CATGATAATGATGATGATGATGG + Intergenic
1090794389 11:130122360-130122382 GATGATGAGGATGAGGAAGAAGG + Exonic
1091388819 12:112625-112647 CATGCTATGGTTGAGGAAGCTGG - Intronic
1091517074 12:1195599-1195621 CAAGATAATGTTCAGGAGAAAGG - Intronic
1092020190 12:5195740-5195762 GATGATAATATTGAAGAGGAAGG - Intergenic
1092026506 12:5245266-5245288 GATGATAATGGTGATGATGATGG + Intergenic
1092924531 12:13261351-13261373 CGTGATAAGGGTGAGGAACAGGG + Intergenic
1094072318 12:26431426-26431448 CATGCCAATGTTGAGGAATGAGG - Intronic
1095317414 12:40782244-40782266 GTTGATAATGCTGAGTAAGATGG + Intronic
1095912432 12:47442299-47442321 CATGAAAATGCTGAGGAAGAAGG + Intergenic
1097364018 12:58691212-58691234 CATGATTCTGGTGAGGAACATGG - Intronic
1098045446 12:66396051-66396073 CAGGATATTGTTGATGATGAGGG - Intronic
1098845093 12:75524919-75524941 AATGATATGGTTGAGGAAAATGG - Intergenic
1099237215 12:80095820-80095842 GGTGATCATGTTGAGGAACAGGG - Intergenic
1100204994 12:92339221-92339243 AATGATAATGGTCACGAAGAAGG - Intergenic
1100594904 12:96063283-96063305 TATGACAATGTTGAGGCTGATGG + Intergenic
1100824802 12:98464550-98464572 CATTTTACTGCTGAGGAAGATGG + Intergenic
1101510537 12:105388846-105388868 CATCACACTGTTGAGGACGATGG + Intronic
1101927237 12:108982563-108982585 GATGATAATGGTGAAGATGATGG - Intronic
1101927283 12:108983244-108983266 GATGATGATGGTGAGGATGATGG - Intronic
1102803742 12:115761008-115761030 CATGATAATGTTGGTGAAAATGG + Intergenic
1102986440 12:117282186-117282208 GATGATGATGTTGAGGAGAAAGG - Intronic
1103201255 12:119089733-119089755 GATGATGATATTGAGGATGATGG - Intronic
1103248654 12:119480743-119480765 GATGATGATGGTGAGGATGATGG - Intronic
1104375425 12:128261967-128261989 GATGATAATGGTGATGATGATGG + Intergenic
1104827853 12:131726966-131726988 GATGATGATGATGAAGAAGATGG + Exonic
1105293365 13:19068621-19068643 GATGATAATGAGGAGGATGATGG - Intergenic
1105440502 13:20411714-20411736 GAAGATAATGTAGAGAAAGATGG - Intronic
1105659132 13:22473588-22473610 TATGATAATGATGAGGAGGATGG + Intergenic
1105775908 13:23659933-23659955 CATGAAGATGATGAGGATGAAGG - Intronic
1106005712 13:25768551-25768573 CATGATAAAGTGCAGAAAGAAGG - Intronic
1108447492 13:50524394-50524416 CATGCTAGAGTGGAGGAAGAGGG + Intronic
1108801983 13:54109022-54109044 AATGAAAAAGATGAGGAAGATGG + Intergenic
1109182798 13:59233920-59233942 ATTGATAATGTTGACGTAGAAGG - Intergenic
1109989462 13:70034681-70034703 CATGTGTATTTTGAGGAAGAGGG + Intronic
1111638490 13:90936409-90936431 AATGGTGATGTTGATGAAGAGGG - Intergenic
1111800975 13:92980364-92980386 CATGATCATGTTGCCGAAAAAGG + Intergenic
1112412203 13:99174183-99174205 CATGATCTTCTTAAGGAAGATGG - Intergenic
1112598481 13:100831717-100831739 CATGAGAATGTTCTGGTAGAGGG - Intergenic
1112999349 13:105615166-105615188 GATGAAAATTTTTAGGAAGAAGG + Intergenic
1113210525 13:107974032-107974054 CATAATAATATTTTGGAAGAAGG + Intergenic
1114084152 14:19226793-19226815 CTGCATAATGTTGAGGGAGAAGG - Intergenic
1114959193 14:27862310-27862332 TCTGATGATGTGGAGGAAGATGG + Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1116992413 14:51290331-51290353 GATGATAGTGATGATGAAGATGG + Intergenic
1117185879 14:53240404-53240426 GATGATAATGATGATGATGATGG + Intergenic
1118003718 14:61546508-61546530 AATGATAATGTTGAAGAAGGAGG - Intronic
1118857451 14:69635080-69635102 GATGATAATGTTGATGATGATGG + Intronic
1119115655 14:72018776-72018798 CAGGATCATGGTGAGGGAGAAGG - Intronic
1120628661 14:86861083-86861105 CCAGATAATGTTAAGGCAGAAGG - Intergenic
1120634536 14:86935179-86935201 CATAAAAGTTTTGAGGAAGAAGG - Intergenic
1202895759 14_GL000194v1_random:8641-8663 CTGCATAATGTTGAGGGAGAAGG - Intergenic
1124080609 15:26491344-26491366 GATGATGATGTTGATGATGATGG + Intergenic
1124181117 15:27475500-27475522 GATGATATTGTTGATGATGATGG + Intronic
1124821499 15:33050870-33050892 CATTAAAATAATGAGGAAGAGGG + Intronic
1126061847 15:44790461-44790483 CATGAGAATGGAGAGGGAGAGGG - Intergenic
1127002332 15:54523886-54523908 GATAAAAATGTTGGGGAAGAGGG - Intronic
1127483002 15:59394376-59394398 CAGGATGATGGTGATGAAGATGG + Intronic
1127684878 15:61333648-61333670 TGTGATCATGTTGAGAAAGATGG + Intergenic
1128059529 15:64726116-64726138 CATTAGAGTGTTGGGGAAGATGG - Intergenic
1128498104 15:68209729-68209751 CATGAAGAGGATGAGGAAGAAGG + Exonic
1128926013 15:71656894-71656916 CATGATAATGTTGAGGAAGATGG + Intronic
1129874669 15:78965872-78965894 CATGTTACAGTTGAGGCAGAAGG + Intronic
1130127080 15:81103067-81103089 CATGATGATGATGATGATGATGG + Intronic
1130952080 15:88600078-88600100 CATGAGAATATTGAGGAAACTGG + Intergenic
1131688817 15:94804120-94804142 CATGGTAATGTGCAGTAAGAGGG - Intergenic
1133150952 16:3829731-3829753 GATGATAATGTTGTTGAATATGG - Intronic
1133534927 16:6692813-6692835 GAAGATAATGTTGATGATGATGG - Intronic
1133595731 16:7289616-7289638 CATGATCATGGTGATGATGATGG - Intronic
1133882374 16:9795012-9795034 CATGATGATGATGATGATGACGG + Intronic
1135008964 16:18856063-18856085 TAAGATAAAGATGAGGAAGAAGG - Intronic
1136242715 16:28954406-28954428 CATGATAATATTGGGAAAGGGGG - Intronic
1137986613 16:53114015-53114037 GATGATGATTTTGAGGAAAAGGG + Intronic
1138982694 16:62289477-62289499 CATGAGAATGTAAAGGTAGATGG + Intergenic
1139255908 16:65542433-65542455 CATGATGATGGTAAGGATGAAGG - Intergenic
1140797746 16:78455822-78455844 CATGTTAAAGTTGATGATGACGG + Intronic
1141029663 16:80576435-80576457 GATGATGATGGTGATGAAGATGG + Intergenic
1141029678 16:80576639-80576661 GATGATGATGGTGATGAAGATGG + Intergenic
1141029684 16:80576735-80576757 AATGATAATGGTGATGAAGATGG + Intergenic
1141169277 16:81680952-81680974 CATGAGCATGTTTATGAAGAAGG - Intronic
1141872754 16:86799565-86799587 AATGATGATGGTGATGAAGATGG - Intergenic
1141933790 16:87222579-87222601 GATGATAATGGTGATGATGATGG - Intronic
1142064371 16:88052619-88052641 TATGATAATGGTGAGGATGATGG - Intronic
1143411054 17:6709112-6709134 CATTATAATGTTGATGAGGGAGG - Intronic
1143635376 17:8161474-8161496 TATGATGATGATGAGGATGATGG + Exonic
1143692578 17:8582077-8582099 AATGATGATGATGATGAAGATGG + Intronic
1145302458 17:21650233-21650255 GATGATGATGTTGAGGATGATGG + Intergenic
1146579081 17:34021020-34021042 CTTGATACTGGTGAGGAACATGG - Intronic
1147041137 17:37719983-37720005 CATGATGATGGTGATGATGATGG - Intronic
1149499750 17:57143303-57143325 AATGATAATCTGGAGCAAGAGGG + Intergenic
1149630466 17:58117700-58117722 GATGATGATGGTGAGGATGATGG + Intergenic
1149919822 17:60647053-60647075 CAAGATAATTTTGAAGAAAAAGG - Intronic
1150292961 17:63992380-63992402 GATGATAATGTTCTGAAAGATGG + Intergenic
1151009428 17:70476200-70476222 CATGATCATCTTGAGTAAAAGGG + Intergenic
1151061517 17:71100000-71100022 CATGATATAGTGGAGGCAGAGGG + Intergenic
1151191287 17:72399877-72399899 CATGAGTTTGTTGAGGGAGAAGG - Intergenic
1152371954 17:79894103-79894125 GATGATAATGGTGATGATGATGG - Intergenic
1152658661 17:81531932-81531954 GATGATAATGGTGATGATGATGG + Intronic
1152658664 17:81531968-81531990 GATGATAATGGTGATGATGATGG + Intronic
1152658718 17:81532427-81532449 GATGATAATGGTGATGATGATGG + Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1155265643 18:24090628-24090650 CAAAATAATATTGAGAAAGAAGG + Intronic
1155521010 18:26669133-26669155 CATGAGAATGCAGAGGGAGATGG - Intergenic
1156780983 18:40850464-40850486 CATGTTAATGTTAATGAAGATGG + Intergenic
1157212441 18:45755226-45755248 GCTGAGAATGATGAGGAAGATGG - Intergenic
1157619299 18:49006850-49006872 CATGAGAATCTAGAGGAAGCTGG - Intergenic
1157897100 18:51479513-51479535 CATGGTCATCTTGAGGTAGAAGG - Intergenic
1158419547 18:57280600-57280622 GCTAAGAATGTTGAGGAAGAAGG - Intergenic
1158512857 18:58106893-58106915 CAGGAGAATGATGAGGAAGTGGG + Intronic
1158621944 18:59040720-59040742 TGTGGTAATGCTGAGGAAGAGGG + Intergenic
1160143147 18:76343862-76343884 AATGGTAATGATGAGGACGATGG + Intergenic
1160632295 18:80254988-80255010 CTTGCTAAAATTGAGGAAGATGG - Intergenic
1161899389 19:7106767-7106789 GATGATGATGGTGATGAAGATGG + Intergenic
1161899421 19:7107037-7107059 GATGATGATGGTGATGAAGATGG + Intergenic
1162183125 19:8884325-8884347 CATGATGATAATGAGGATGATGG - Intronic
1162603234 19:11686611-11686633 CATGATGATGATGAGGATGATGG + Intergenic
1164256833 19:23534505-23534527 CACAATAATGATGAGGAGGAAGG + Intronic
1165799332 19:38537951-38537973 CACAATAATGGTGAGGAGGAGGG + Exonic
1168144544 19:54413547-54413569 GATGATAATGATGATGATGATGG - Intergenic
1168322724 19:55519583-55519605 TATGATGATGATGATGAAGATGG + Intergenic
1168369467 19:55820102-55820124 AATGAAAATGTTCTGGAAGAGGG - Intronic
925609972 2:5694128-5694150 GATGATAATGATGATGATGATGG + Exonic
925700472 2:6632090-6632112 CATGATAAAGATGAAGACGATGG + Intergenic
926480989 2:13393957-13393979 CATGATAATGTGTAAGTAGATGG + Intergenic
927665232 2:25027373-25027395 GATGATAATGTTGAGGAAGATGG - Intergenic
929022412 2:37566589-37566611 CATGGTAATTTTGAGCAAGAGGG + Intergenic
929102691 2:38331809-38331831 CATAATAATGATGTGAAAGAGGG - Intronic
929723662 2:44399718-44399740 CATGATAGAATTGAGGAAGACGG + Intronic
931427864 2:62187524-62187546 CATGATTATATTGATGATGATGG + Intergenic
932774879 2:74522318-74522340 GAGGATAGGGTTGAGGAAGAGGG + Intronic
933217697 2:79649372-79649394 CATAATAATGATGATGAACACGG - Intronic
935321210 2:101891071-101891093 CTTGACAGTGTTGAGGATGATGG + Intronic
935411281 2:102766243-102766265 CATGATAATTATGATGGAGATGG + Intronic
937957318 2:127428630-127428652 CTTGATGAAGTTGAGGACGAAGG - Exonic
938680458 2:133684594-133684616 CATGATGATGATGATGATGATGG + Intergenic
938894812 2:135739466-135739488 CATGTGGAGGTTGAGGAAGAAGG - Intergenic
939779941 2:146433554-146433576 CATAATAATCTTGCAGAAGAAGG - Intergenic
940441922 2:153725692-153725714 GATGCTACTTTTGAGGAAGATGG + Intergenic
941487752 2:166103148-166103170 TATTATAATATTGAGGAAGTAGG + Intronic
942070417 2:172311097-172311119 GATGGTAATGTGGATGAAGATGG + Intergenic
942549142 2:177096223-177096245 CATGACTCTGTTGAGGAAGTCGG - Intergenic
943212423 2:184984969-184984991 CATGAAAATGATGAGGATGTAGG + Intergenic
943354760 2:186839052-186839074 AATGAACATGTTGAAGAAGATGG - Exonic
944354477 2:198769645-198769667 CATGATTCTGTTGAGGATAAAGG + Intergenic
944354653 2:198772420-198772442 CAAGATCATTTTTAGGAAGAGGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944948522 2:204718636-204718658 CATAACAATGTTGAGGATGGAGG - Intronic
945609348 2:211979091-211979113 CGTGGTAGTGTTAAGGAAGAGGG - Intronic
947382927 2:229562929-229562951 GATGATGATGTTGATGATGATGG - Intronic
947383042 2:229563662-229563684 GGTGATAATGTTGATGATGATGG - Intronic
947619371 2:231579396-231579418 GATGATGATGTTGATGATGATGG - Intergenic
948076540 2:235169235-235169257 GATGATAATGGTGAAGACGATGG + Intergenic
1169025905 20:2371243-2371265 GATGATAATGGTGGGGAAGAGGG - Intergenic
1169097970 20:2920428-2920450 CATCATAATCTTGGGAAAGAGGG - Intronic
1169976741 20:11337857-11337879 CATGCTAATGGTGATAAAGAAGG + Intergenic
1171124827 20:22592629-22592651 GATGCTAATGTTGAGAAACATGG + Intergenic
1171129331 20:22634536-22634558 CATGACATTGTTGTGGAAGGGGG + Intergenic
1172324374 20:34023118-34023140 CAAGATACAGTAGAGGAAGAAGG + Intronic
1173000708 20:39103474-39103496 GATGATGATGGTGATGAAGATGG + Intergenic
1173072544 20:39783214-39783236 GATGATAATGATGATGATGATGG - Intergenic
1175516335 20:59572499-59572521 AATGATAATGATGAAGAAGATGG + Intergenic
1175671467 20:60906708-60906730 TATGATGATGGTGATGAAGATGG + Intergenic
1175959405 20:62627654-62627676 GATGATTGTGTTGAGGATGATGG - Intergenic
1176615450 21:9024703-9024725 CTGCATAATGTTGAGGGAGAAGG - Intergenic
1176709729 21:10139101-10139123 CTGCATAATGTTGAGGGAGAAGG + Intergenic
1177639027 21:23822230-23822252 CTTGAGAATTTTGAGGAATATGG - Intergenic
1178039012 21:28618602-28618624 CATGGTAATTTTTAAGAAGAAGG - Intergenic
1178204120 21:30443335-30443357 AAGCATCATGTTGAGGAAGATGG - Intergenic
1178689140 21:34736703-34736725 GATGAAAATGTTGTGGAAGTAGG - Intergenic
1180293819 22:10866410-10866432 CTGCATAATGTTGAGGGAGAAGG + Intergenic
1180496626 22:15895825-15895847 CTGCATAATGTTGAGGGAGAAGG + Intergenic
1181566374 22:23741221-23741243 GATGATAACGGTGGGGAAGAGGG + Intergenic
1181879880 22:25969933-25969955 GATGATAATGATGATGATGATGG - Intronic
1182090144 22:27588974-27588996 GATGATAATGGTGAGGATGATGG - Intergenic
1182791112 22:32953837-32953859 TGTGATGATGTTGATGAAGAAGG - Intronic
1183238031 22:36634884-36634906 CATGAGAATTCAGAGGAAGAAGG + Intronic
1183278447 22:36917462-36917484 CATGTTTATTTTGAGTAAGAAGG + Intronic
1184292336 22:43504220-43504242 GATGATAATGGTGATGATGATGG + Intronic
1184534970 22:45080339-45080361 GATGATAATGATGATGATGATGG - Intergenic
949359569 3:3217219-3217241 CATGTTAATGATGAAGAACATGG + Intergenic
951021918 3:17790452-17790474 CATGATTAGTCTGAGGAAGATGG - Intronic
951276266 3:20689919-20689941 GATGATGATGTTGATGATGATGG + Intergenic
951579004 3:24142491-24142513 AATGTTAATGTTGAGGTACAAGG + Intronic
951867647 3:27325567-27325589 CATCCTAACTTTGAGGAAGATGG - Intronic
951893955 3:27593327-27593349 CATAATAATGTTGAAAAAAAAGG - Intergenic
954231307 3:49219844-49219866 CATACTAATGATGAGGAGGAAGG + Intronic
955354122 3:58216348-58216370 CATGTTAAAGGTGAGGAAAAGGG - Intergenic
955579974 3:60408395-60408417 CATGTTAATGTTGTGGACGCAGG - Intronic
956516072 3:70049661-70049683 AATGATAATGATGATGATGATGG - Intergenic
959175723 3:102907217-102907239 CATAAGAAAGTTGAGGGAGAAGG + Intergenic
959384861 3:105690965-105690987 TATGATAATGTTAAGAAAGGAGG + Intronic
959733925 3:109636046-109636068 CATGTTACTGTTGACCAAGAAGG - Intergenic
960312599 3:116134624-116134646 AATGCAAATATTGAGGAAGATGG - Intronic
961626820 3:128269708-128269730 CAAGAAAATGTTGGGGAACAGGG + Intronic
962864698 3:139438179-139438201 GATGATAATATTGATGATGATGG + Intergenic
963213058 3:142715782-142715804 CATGAAAATGTTTGGAAAGACGG + Intergenic
963382063 3:144543104-144543126 CATGATAATATTTGGAAAGAAGG - Intergenic
964207308 3:154188800-154188822 CATGAAGATGTGGAGGAAAAAGG - Intronic
964297292 3:155247683-155247705 CATGAAGATGATGAGGATGAAGG - Intergenic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
965278071 3:166713640-166713662 CATTATTATGTAGAGTAAGAGGG - Intergenic
965900557 3:173635766-173635788 CCTAATCATTTTGAGGAAGAAGG - Intronic
966810642 3:183841062-183841084 CATGTTATAGTTGAGGAAAATGG - Intronic
968187322 3:196642046-196642068 CATGATGAAGTTGAGAAAAATGG - Intronic
968282013 3:197484464-197484486 CATGATCTTGTTGGGGAAGTAGG - Intergenic
969710788 4:8841791-8841813 GATGATGATGATGATGAAGATGG + Intergenic
970326826 4:14934485-14934507 CATGAAAATAATGAGGATGAAGG - Intergenic
971188121 4:24400790-24400812 GATGAAAATGGTGACGAAGATGG + Intergenic
971886584 4:32457143-32457165 CATGCTTATGTAGAGAAAGACGG - Intergenic
972360538 4:38322115-38322137 GATGATAATGGTGATGATGATGG + Intergenic
973963117 4:56132011-56132033 CATGATAATAGTGAAGAATATGG + Intergenic
974522696 4:63005235-63005257 CATGAAAAAATTGAGGGAGATGG - Intergenic
975050514 4:69858330-69858352 AATGATAAGGTTAAGCAAGATGG + Intronic
977215507 4:94278954-94278976 CATGATGCAGTTGAGGAAAATGG + Exonic
977479422 4:97556328-97556350 GATGATTATGATTAGGAAGATGG - Intronic
978083730 4:104624243-104624265 CCTGATCATCTTGAGGAAGTAGG + Intergenic
978915122 4:114116036-114116058 CAAGATAATATAAAGGAAGAAGG - Intergenic
979303118 4:119110209-119110231 GATGATAATGATGATGATGATGG - Intergenic
980309343 4:131104799-131104821 CATGATAGTGTTGATGAATACGG + Intergenic
980521633 4:133943715-133943737 GATGTGAATGTTGAGGAAGCAGG - Intergenic
981679528 4:147380180-147380202 CATGATAGTCCTAAGGAAGAGGG - Intergenic
982417581 4:155154872-155154894 AATGATAATGTTTATGAAGTAGG + Intergenic
983687271 4:170425494-170425516 TAAGAAAATGATGAGGAAGATGG + Intergenic
984359770 4:178713628-178713650 CATAAGTATGTTGAGGTAGATGG + Intergenic
984621124 4:181953276-181953298 CATGATGATGATGATGATGATGG - Intergenic
984876964 4:184377715-184377737 CTTGATAGTGATGAGAAAGAAGG - Intergenic
986943460 5:12985530-12985552 CATGAAGATGATGAGGATGAAGG + Intergenic
988103562 5:26712835-26712857 AATAATAATGTTGAGTAAGTCGG - Intergenic
988104303 5:26723790-26723812 TTTGAGATTGTTGAGGAAGAAGG - Intergenic
988414267 5:30926221-30926243 CATGAAAATTGTGAGGAAGTAGG - Intergenic
989397623 5:40975166-40975188 GATGTTAATATTAAGGAAGATGG - Intronic
991492686 5:67198211-67198233 GATGATTTTGTTGATGAAGATGG - Intergenic
992123015 5:73613949-73613971 CATAATTATATTGAGGCAGAAGG + Intergenic
992732462 5:79687018-79687040 CATAATACTGTAGAGGCAGAGGG - Intergenic
992979767 5:82156723-82156745 CATGACAAACTAGAGGAAGAGGG - Intronic
993109072 5:83633088-83633110 AATGAGATTGTTGAGGGAGAAGG - Intergenic
996271404 5:121608836-121608858 GATGATAATGTGGAGAAACAGGG + Intergenic
998661772 5:144246748-144246770 GATGACAATGATGAAGAAGAAGG - Intronic
1000518185 5:162266195-162266217 TCTGATAATGGTGATGAAGATGG + Intergenic
1003225016 6:4196175-4196197 GATGAGAATGTTGAAGATGAAGG + Intergenic
1003262477 6:4532098-4532120 CATGCTAATGTTGACTAATAAGG - Intergenic
1003430841 6:6036042-6036064 GATGATGATGTTGATGATGATGG - Intergenic
1005350291 6:24927436-24927458 GATGATAATGTTGATGATGGTGG - Intronic
1005361719 6:25037158-25037180 CATTTTAAGGTTGAGGAAGTGGG + Intronic
1006896679 6:37475675-37475697 TATGTTAAGGTTGAGCAAGAGGG + Intronic
1007654817 6:43445687-43445709 CAGGAGGATGTTGAGGATGAAGG - Exonic
1008459534 6:51752126-51752148 CATTCTAAGGTTGAGGAAGATGG - Intronic
1010833996 6:80564709-80564731 GATGATAATGTTGATGATGATGG + Intergenic
1010951472 6:82041715-82041737 CATGAAGATGATGAGGATGAAGG + Intergenic
1011224332 6:85090423-85090445 GATGATAATGATGATGATGATGG - Intergenic
1011371367 6:86640404-86640426 CATGATATCCTTGAGGAGGAAGG - Intergenic
1012095534 6:94954012-94954034 CATGAAAATGTGGTGGCAGATGG - Intergenic
1012503213 6:99913855-99913877 CATGATAATGAAGATGATGAGGG + Intergenic
1012672079 6:102065881-102065903 GATGATAATGATGATGAAGATGG - Intronic
1012952540 6:105534078-105534100 GATGATGATGGTGAGGAAGATGG - Intergenic
1013722712 6:113050036-113050058 CATGAAAATGATTAGGCAGAGGG - Intergenic
1014301225 6:119684039-119684061 CATGCTAATGTGGTAGAAGATGG - Intergenic
1014399905 6:120975470-120975492 CAAGATAAGGTGTAGGAAGATGG - Intergenic
1014457034 6:121647857-121647879 GATGACAATGGTGTGGAAGAAGG + Intergenic
1015610004 6:135006782-135006804 CATGATGATGATGACGATGATGG + Intronic
1016464455 6:144311701-144311723 AATGACAGTGATGAGGAAGAAGG - Intronic
1017608588 6:156159709-156159731 CATGAAGATGATGAGGATGAAGG - Intergenic
1017990875 6:159488875-159488897 CATGATAAGCTTCAGGAAAAGGG - Intergenic
1018224996 6:161620381-161620403 CCTGAGAATGGCGAGGAAGAAGG - Intronic
1018549684 6:164981417-164981439 CATGATCATTATGAGCAAGAAGG + Intergenic
1019353458 7:566332-566354 GATGATAATGGTGATGATGAAGG - Intronic
1021582041 7:22166269-22166291 CATGAAAATTTTAAGGAAAATGG - Intronic
1022227998 7:28383197-28383219 CATGTTAATGGTGAGAAAGATGG + Intronic
1022312710 7:29212281-29212303 CATGTTAGTATTGAGGAAGAGGG - Intronic
1023622846 7:42090494-42090516 GGTGTTTATGTTGAGGAAGAAGG - Intronic
1024884868 7:54129227-54129249 GATGATAGTGTTGATGATGATGG + Intergenic
1024920757 7:54551709-54551731 TATGATAATGTGAAGAAAGAGGG - Intronic
1026625466 7:71988088-71988110 GATGATGATGATGATGAAGATGG - Intronic
1027466157 7:78516876-78516898 AATGATAATTCTGAGGAATATGG + Intronic
1028780345 7:94728584-94728606 CATAGTAATGATGAGGAAGAAGG - Intergenic
1030863222 7:114663829-114663851 CATCATAGTGTTGGGGAACATGG + Intronic
1031446702 7:121863999-121864021 GATGGGAATGTTGAGGAAGAAGG + Intergenic
1031846942 7:126816627-126816649 CATGATGATGATGATGATGATGG + Intronic
1032009617 7:128335922-128335944 GATGATGATGATGAAGAAGATGG - Exonic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1033235274 7:139633307-139633329 CATGAGAGTGGGGAGGAAGAGGG + Intronic
1033279123 7:139993280-139993302 TATGATCATGTTGGGGAATAGGG + Intronic
1034876665 7:154730366-154730388 CATGAGCATGTTGAGGTCGATGG - Intronic
1034969806 7:155411838-155411860 CATGATGATGGTGATGATGATGG - Intergenic
1035731666 8:1857983-1858005 AATAATAATGAAGAGGAAGAGGG + Exonic
1036647954 8:10623824-10623846 CATGATGATGCTGAGGGACAGGG - Intronic
1037385609 8:18337072-18337094 CTTGAGCAAGTTGAGGAAGAAGG - Intergenic
1037693003 8:21198484-21198506 CCTGAGAATGGTAAGGAAGAGGG + Intergenic
1037733924 8:21551751-21551773 GATGATGATGTTGATGATGATGG + Intergenic
1037900012 8:22682615-22682637 CATGATAAGGATCAGGAAGCAGG + Intergenic
1038014370 8:23501189-23501211 CATGGAAATATTGAGGAAAAGGG + Intergenic
1038973490 8:32664636-32664658 GATGATGATGATGATGAAGATGG + Intronic
1041299108 8:56392584-56392606 CAAGAAAATGTTGACCAAGAAGG + Intergenic
1041551997 8:59113540-59113562 CATGATTATGGTGATGATGAAGG + Intronic
1043288172 8:78561395-78561417 CATGATGTTGAGGAGGAAGAAGG - Intronic
1044777913 8:95713019-95713041 GATGATATTGCTGAGGAAAATGG - Intergenic
1044979530 8:97701906-97701928 CATAACAAACTTGAGGAAGATGG - Intronic
1045057093 8:98378672-98378694 CATGATGATGATAAGGAAGCGGG - Intergenic
1045102595 8:98860698-98860720 GAGCATAATGCTGAGGAAGAGGG + Intronic
1045985905 8:108249508-108249530 CATGATTATGGTAAGGAATATGG + Intronic
1046707277 8:117468962-117468984 CAGGATAATGTTGTGGAAAGGGG - Intergenic
1048221478 8:132546176-132546198 AATGATAATGATGATGATGATGG - Intergenic
1048243902 8:132772940-132772962 CTTGATAATGTTCAGAAAAAAGG + Intergenic
1048850222 8:138638030-138638052 AATGATGATGATGAGGATGATGG - Intronic
1050298561 9:4232703-4232725 CATAATAAAGATGAGGAAGTTGG + Intronic
1050856723 9:10366914-10366936 CAGGATAATGATTAGGAAGAAGG + Intronic
1050871834 9:10581433-10581455 CATCATAATGTTGAAAGAGAAGG - Intronic
1051391888 9:16574050-16574072 CATGATATTGCTGAGGCATATGG + Intronic
1051563684 9:18471807-18471829 CATGCTAATGTACAGCAAGATGG - Intergenic
1052123408 9:24746207-24746229 CAGGAGAATTTTGAGGAAGAAGG - Intergenic
1052731646 9:32292660-32292682 GAAGATATTTTTGAGGAAGAAGG - Intergenic
1052845424 9:33331710-33331732 CAGGATAATTTTTACGAAGAGGG + Intronic
1053049397 9:34946647-34946669 TATGATAATGATGATGAAGTTGG + Intergenic
1054327706 9:63722526-63722548 CTGCATAATGTTGAGGGAGAGGG + Intergenic
1058538770 9:105990745-105990767 GATGATGATGTTGATGATGATGG - Intergenic
1058593503 9:106589914-106589936 GATGAAAGTGTTCAGGAAGAAGG - Intergenic
1058710095 9:107671698-107671720 CAAAATGATGTTGTGGAAGAAGG - Intergenic
1058802301 9:108556564-108556586 CATGGTCATGTTCAGCAAGAAGG - Intergenic
1058935421 9:109765425-109765447 CATGATGATGGTGATGAAGACGG - Intronic
1059612187 9:115910527-115910549 CATGATGATGATGATGATGATGG - Intergenic
1202794488 9_KI270719v1_random:108070-108092 CTGCATAATGTTGAGGGAGAAGG + Intergenic
1185683065 X:1904711-1904733 CATGATAATGATGGTGATGATGG + Intergenic
1185683076 X:1904863-1904885 CATGATAATGATGTTGATGATGG + Intergenic
1185689061 X:2138168-2138190 CATGATGATGGTGATGATGATGG - Intergenic
1185739545 X:2520121-2520143 GATGATGATGGTGAGGATGATGG - Intergenic
1185739560 X:2520235-2520257 GATGATGATGGTGAGGATGATGG - Intergenic
1185739604 X:2520604-2520626 GATGATGATGGTGAGGATGATGG - Intergenic
1186168274 X:6850165-6850187 CATGTAAATTTTGAGGAAGTTGG - Intergenic
1186810352 X:13181970-13181992 CCTGACAGTGTTGAGGAAGCTGG + Intergenic
1187214440 X:17262939-17262961 AATGACAATGGTGAGAAAGATGG - Intergenic
1187234603 X:17455374-17455396 CATGATAATGGTGATGATGTTGG - Intronic
1188691379 X:33133042-33133064 CACCATAATGTTGTTGAAGATGG + Intronic
1190443539 X:50499765-50499787 CCTGGGAAGGTTGAGGAAGAGGG + Intergenic
1191149740 X:57208326-57208348 CACACTAATGATGAGGAAGAAGG - Intergenic
1192884645 X:75323900-75323922 CACACTAATGATGAGGAAGAAGG + Intergenic
1194041647 X:88948823-88948845 CATGATGATGATGAGGAGGATGG - Intergenic
1196086340 X:111686552-111686574 CACTATAATGTTGGAGAAGAGGG + Intronic
1196616516 X:117772299-117772321 CATGAAAATGCTGTGCAAGATGG - Intergenic
1196630309 X:117930966-117930988 GATCATAATGTTGAGAAAAAAGG + Intronic
1197401678 X:125999886-125999908 TATGAAAATGTAGAGGAATATGG + Intergenic
1199765569 X:150939157-150939179 GATGATGATGTTGATGATGATGG - Intergenic
1200385190 X:155883248-155883270 AATGAGAAGGTTGAGGAATACGG - Intronic
1200563906 Y:4741053-4741075 GATGATAAGGCTGAGGAAGGAGG + Intergenic
1201614101 Y:15876875-15876897 GATGATAATGATGAAGACGACGG + Intergenic
1201616267 Y:15902902-15902924 GATGATAATGATGAAGACGACGG - Intergenic
1201709986 Y:16980370-16980392 GATGATAATGATGATGATGATGG + Intergenic