ID: 1128927748

View in Genome Browser
Species Human (GRCh38)
Location 15:71674261-71674283
Sequence CCAGCTCTGCCCATTGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128927744_1128927748 8 Left 1128927744 15:71674230-71674252 CCAGTTCTTGGCCTTGTCTTCCA 0: 1
1: 0
2: 1
3: 29
4: 275
Right 1128927748 15:71674261-71674283 CCAGCTCTGCCCATTGAAATTGG 0: 1
1: 0
2: 1
3: 18
4: 151
1128927745_1128927748 -3 Left 1128927745 15:71674241-71674263 CCTTGTCTTCCATTTACAGTCCA 0: 1
1: 0
2: 1
3: 13
4: 236
Right 1128927748 15:71674261-71674283 CCAGCTCTGCCCATTGAAATTGG 0: 1
1: 0
2: 1
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128927748 Original CRISPR CCAGCTCTGCCCATTGAAAT TGG Intronic
901468304 1:9437787-9437809 CCAGCTCTGCCCTTTAGAAGAGG - Intergenic
904345392 1:29864853-29864875 ACAGCTCTGGCCAATGAAATGGG - Intergenic
904498244 1:30899678-30899700 CCAGCTCTGCCATTAGAAGTGGG - Intronic
905857427 1:41323177-41323199 CCAGGACTGCCCAGAGAAATAGG - Intergenic
910604584 1:89068882-89068904 CCACCTCTGCCCATTCGAAGGGG + Intergenic
911185492 1:94900031-94900053 CCAGCTCTGTCCAAGGACATGGG - Intronic
911895449 1:103428179-103428201 GTAGCTCTGACCAGTGAAATAGG - Intergenic
914921895 1:151852941-151852963 CCAGCTCTGCCCACTGCTGTGGG + Intronic
918653214 1:186991562-186991584 CCAGCTGTGCTCATTGCTATTGG - Intergenic
918954204 1:191183837-191183859 CCAGCTGTTGCCATGGAAATGGG - Intergenic
919966741 1:202534419-202534441 CTAGCTCTGTCCACTGAAAGGGG - Intronic
920323660 1:205144205-205144227 CAAGCTCTGGCCATTAAAAATGG + Exonic
920359020 1:205399450-205399472 CTAGCTCTGTCCACTGAAAAGGG + Intronic
923694511 1:236234088-236234110 CCTGCTATCTCCATTGAAATTGG - Intronic
924474333 1:244369957-244369979 GCAGCTGTGCCCATAGAAAAGGG - Intronic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1065006760 10:21387488-21387510 ACAGCTGTGCCCATAGAAAAGGG + Intergenic
1068658369 10:59596995-59597017 CCAGCTCTGTCCATAGAGAAGGG + Intergenic
1068681872 10:59828802-59828824 TCAGCTCTGCTCTTAGAAATTGG - Intronic
1069054351 10:63829362-63829384 CCAGCTGTGACCTTTGCAATCGG - Intergenic
1069847948 10:71385632-71385654 CTAGCTCTGGCCAGGGAAATGGG + Intergenic
1072741209 10:97911063-97911085 CCACCTCTGCCCATTAAAAGAGG + Intronic
1072904273 10:99437080-99437102 CCAGCTCTGCCATGTGAAGTTGG + Intergenic
1073218143 10:101848144-101848166 CTGGCCCTGGCCATTGAAATTGG - Intronic
1074043938 10:109819724-109819746 CCAGCTCTGCCTATAGACATAGG - Intergenic
1075226543 10:120634598-120634620 CCAGCTATGCTCCTAGAAATTGG - Intergenic
1083720250 11:64600351-64600373 CCATCTCTACCCACAGAAATGGG + Exonic
1085045882 11:73353124-73353146 CCAGATCTGACCATAGAACTTGG + Intronic
1085454081 11:76656049-76656071 CCAGCCCTACCCCATGAAATAGG + Intergenic
1088816356 11:113423691-113423713 CCAGCTCTGCACCTCAAAATGGG - Intronic
1088938319 11:114426620-114426642 CAAGTTCTGACCACTGAAATGGG + Intronic
1090668236 11:128929445-128929467 CCACCTCTCCCCCTTTAAATCGG + Intergenic
1092004410 12:5057091-5057113 CAAGCTCTGCCCCTTCAAAATGG + Intergenic
1092812139 12:12281415-12281437 CTAGCTCTGCTCATTGCTATTGG - Intergenic
1093081855 12:14821780-14821802 TCAGCTCTTCCCATTGCAACTGG + Intronic
1097403271 12:59156543-59156565 TCAGCTGTGCACTTTGAAATGGG - Intergenic
1097884039 12:64711164-64711186 CCAGCTATTCCCACTGAAACTGG - Intergenic
1098110159 12:67113201-67113223 GCAGTTCTGCACATGGAAATGGG + Intergenic
1100711897 12:97266162-97266184 CCAGGTCTGCCCATTGAGTATGG - Intergenic
1101973734 12:109336779-109336801 CCATCTCTGACCATAGTAATTGG - Intergenic
1103462386 12:121115344-121115366 CCAGCTCTGCCCCTTCATCTTGG - Intergenic
1107769923 13:43778818-43778840 CCTGCCCTGCCCATTGGACTTGG - Intronic
1111792604 13:92877828-92877850 CCACCTATGCCAAATGAAATGGG + Intergenic
1112853184 13:103732400-103732422 CTAGCTCTGCCCACTGGAAAAGG - Intergenic
1114335501 14:21685390-21685412 CAAGAACTGCCCATTGAATTTGG - Intergenic
1118424589 14:65646207-65646229 GAAGCTCTTCCCATTGAACTAGG + Intronic
1119540783 14:75436850-75436872 CCAGCTCTGCCCAACCAAAAAGG - Intronic
1120821368 14:88914697-88914719 ACAGCTCTGCCCATAGCAACAGG + Intergenic
1121253631 14:92516454-92516476 CCAGCTCTGTCCCTTGACCTTGG + Intronic
1121322169 14:92998328-92998350 CCAGCTGTGCCCATGGAAGGGGG + Intronic
1121906574 14:97751641-97751663 CCAACTATGCCCATTGAAATTGG - Exonic
1122327074 14:100888875-100888897 CAAGCTCTGCAGGTTGAAATTGG + Intergenic
1122999314 14:105283856-105283878 CCAGCTCTGCCCATTGCTTGTGG - Intronic
1124089679 15:26586616-26586638 CCATCTCAGCTCACTGAAATGGG - Intronic
1124173465 15:27399300-27399322 TCAGTTCTGGCCATTGAAACAGG + Intronic
1124653116 15:31487297-31487319 CCAGCTCAGACCATTTCAATAGG - Intronic
1126069503 15:44853356-44853378 CCACCTCTCCACCTTGAAATGGG - Intergenic
1128927748 15:71674261-71674283 CCAGCTCTGCCCATTGAAATTGG + Intronic
1129373812 15:75115023-75115045 CCAGCCCTGCACATTTGAATTGG + Intronic
1131283543 15:91039814-91039836 TCAGCACTGCCCATGGAAACAGG - Intergenic
1131525265 15:93147565-93147587 ACAGCACTGCCCAATGAACTGGG - Intergenic
1131626479 15:94125918-94125940 CCACCTCTGCACATTGAGCTGGG + Intergenic
1132017610 15:98332740-98332762 CCAGCCCAGCCCATTCTAATTGG + Intergenic
1134758537 16:16691865-16691887 CCAGATATGGCCTTTGAAATGGG + Intergenic
1134987535 16:18667313-18667335 CCAGATATGGCCTTTGAAATGGG - Intergenic
1137353521 16:47735418-47735440 CCAGCTCAGCCCATTGGAAAGGG - Intergenic
1139255810 16:65541271-65541293 CCAGCTGTGCCCATTGTTATTGG + Intergenic
1139741845 16:69042060-69042082 ACAGTTCTGGCCAATGAAATAGG - Intronic
1140838859 16:78820488-78820510 CCAACTCTACTCATGGAAATGGG - Intronic
1141134358 16:81456014-81456036 GCAGGTCTGCCCATTGGAAAGGG + Intronic
1141421429 16:83920419-83920441 CCAGCTCTGCCCATTGGACAGGG - Exonic
1144343174 17:14327386-14327408 CCATCTCCCCCCATTGAACTTGG - Intronic
1147157779 17:38552900-38552922 CCAGCCCAGCCCCCTGAAATTGG + Intronic
1148064599 17:44859842-44859864 GCAGCTCTGCCCATTCAGCTGGG + Intronic
1148070369 17:44905203-44905225 CCAGACCTGCCCATGAAAATGGG - Exonic
1151193299 17:72414062-72414084 GCAGGACTGCCCATTGATATGGG + Intergenic
1152263364 17:79279061-79279083 CCAGCTCTGCCACTAGTAATTGG - Intronic
1153129150 18:1834682-1834704 CCAGCTCTGGCCAATGGAATAGG - Intergenic
1157789996 18:50523259-50523281 CCAGCTCTGACAGTAGAAATAGG - Intergenic
1161826693 19:6572312-6572334 CAAGCCCTGACCACTGAAATGGG + Intergenic
1165225137 19:34349413-34349435 CCTGCTCTTCCCACAGAAATGGG - Intronic
927306508 2:21579639-21579661 ACAGTTCTGACCAATGAAATAGG - Intergenic
930015625 2:46968544-46968566 CCAGTTCTGCCCATAAAAAGGGG - Intronic
932296410 2:70626838-70626860 CCCGCCCTGCCCATGGAAACTGG - Intronic
934142508 2:89061456-89061478 TCAGCTCTGCACATTAAACTTGG + Intergenic
934226731 2:90139098-90139120 TCAGCTCTGCACATTAAACTTGG - Intergenic
938007916 2:127803623-127803645 CTAGCTCTGTCCACTGAAAAGGG + Intronic
938730022 2:134140174-134140196 TCAGCTCTCCCCCTGGAAATAGG + Intronic
942438502 2:176006221-176006243 CCAGCTCTGGCCACAGAGATTGG - Intergenic
946790306 2:223293964-223293986 CCAGCTCATCTCATTGAGATTGG - Intergenic
946921116 2:224583480-224583502 CCAGCTCTGCCCAATTATAAGGG + Intronic
947156535 2:227167429-227167451 CCAGCTCACCCACTTGAAATAGG + Intronic
1169770560 20:9195591-9195613 CCTGCTCTGCCCTTGGACATCGG + Intronic
1172838525 20:37888184-37888206 CAAGCCCTGCCCATTGAACCCGG - Intergenic
1175142313 20:56870131-56870153 CCAGTTCTGCCCTTTGACATAGG + Intergenic
1176932737 21:14832405-14832427 CCAGCTATGGCCAGAGAAATAGG - Intergenic
1177087066 21:16718983-16719005 CCAAGTCTCCCCATTGAATTCGG - Intergenic
1177872542 21:26590960-26590982 CAAGCTCTGAGCATTGCAATTGG - Intergenic
1178107582 21:29337300-29337322 CTAGCTCTGTCCACTGAAAAAGG - Intronic
1179953672 21:44725956-44725978 CCATCTCAGCCCAGTGAAAATGG + Intergenic
1184414975 22:44346947-44346969 CCATCTCAGCCCATTCAACTCGG + Intergenic
949489133 3:4571144-4571166 CCGGCTCTGCCCCTTGACTTTGG - Intronic
950158224 3:10739793-10739815 CCACCGCTGCCCATAGACATTGG + Intergenic
951550296 3:23870457-23870479 GCTGCTCTGCCCATAGCAATAGG - Intronic
952934541 3:38385863-38385885 CCAGCTCAGCCCACTGAAAGGGG - Intronic
952934549 3:38385909-38385931 CCAGCTCAGCCCACTGAAAGGGG - Intronic
954438780 3:50510266-50510288 CCAGCTCTGCCCACTGTGTTAGG + Intergenic
960494978 3:118362621-118362643 CCAATTATTCCCATTGAAATTGG + Intergenic
961338289 3:126198867-126198889 CCAGCTCTGCAATATGAAATGGG + Intergenic
961659283 3:128459815-128459837 CCAGCTCTGCATCTGGAAATGGG + Intergenic
962494199 3:135923210-135923232 CCACCTCTGCCCATTGTATCAGG + Intergenic
966693304 3:182763068-182763090 CCTGCTCTGTCCCTTCAAATTGG + Intergenic
968931630 4:3582412-3582434 CCTGCTCTGCCCATTGGTCTGGG - Intronic
969307584 4:6334749-6334771 CCAGCTGTCCCCATGGAAACCGG + Intronic
972841638 4:42937217-42937239 CCAGCTTTGGTCATTGAAATTGG + Intronic
976832637 4:89332326-89332348 CCAGCCCTGCACATTGTAAGTGG - Intergenic
979805386 4:124963930-124963952 ATAGTTCTACCCATTGAAATAGG - Intergenic
985728006 5:1525682-1525704 GCAGCTCTCCCCATTGAATCTGG - Intergenic
986332018 5:6724259-6724281 CCATCTCTGCCCATTCACAGAGG - Intronic
988476218 5:31588254-31588276 CCAGCTGTGCCAATAGAAAAGGG - Intergenic
991055283 5:62313694-62313716 CCTAGTCTGCCAATTGAAATTGG + Intronic
991288325 5:65005490-65005512 CCTGCCCTGCCCATTGCTATGGG - Intronic
995923105 5:117337571-117337593 CATGCTCTGCCCATTGATAGGGG - Intergenic
1001349564 5:170946100-170946122 ACAGCTCTGCACTTTTAAATAGG + Intronic
1001775381 5:174325677-174325699 CGAGCTCTGCCCATGGAGTTAGG + Intergenic
1002329087 5:178429221-178429243 CCAGCTCTGCCCTGTGACCTTGG - Intronic
1004866859 6:19861425-19861447 GCAGCTCTTCCCAGTGGAATTGG - Intergenic
1005023603 6:21441364-21441386 CCTGCTCTGCTCATTGAGCTTGG + Intergenic
1005102888 6:22192331-22192353 CTAGCTCTGTTCACTGAAATAGG + Intergenic
1006420988 6:33934040-33934062 CCAGCTCTGACAACTGAAGTGGG - Intergenic
1006715714 6:36118719-36118741 ACAGCTCTGCCCAGTGAGACAGG + Intergenic
1006841161 6:37028578-37028600 CCAACTCAGCCCATTTAAATCGG - Exonic
1009208860 6:60837574-60837596 CCCACTCTTCCCATTCAAATAGG - Intergenic
1011913361 6:92470047-92470069 TCAGCTCTGCTCAGAGAAATTGG + Intergenic
1016894478 6:149038659-149038681 CCAGGTCTTCCCCTGGAAATGGG - Intronic
1018211283 6:161484489-161484511 CCATCTTTGCCCTGTGAAATAGG + Intronic
1019299990 7:298021-298043 CCAGCTCTCCCCACCGAAAGGGG + Intergenic
1019840478 7:3437653-3437675 CTAGCCCTGCCCCCTGAAATAGG - Intronic
1027337563 7:77169915-77169937 CCAGCTCTGTCCACTGAGAGGGG - Intronic
1029382456 7:100222587-100222609 GCAGCCCTACCCATTGAAGTAGG + Intronic
1029986812 7:104930262-104930284 CCAGCTGTGCCCCCTGAAATTGG + Intergenic
1033391239 7:140929776-140929798 TTAGCTCTGCCCATTGAAAGGGG + Intergenic
1033462872 7:141563273-141563295 CCATCTCTGTCCTTTCAAATGGG + Intronic
1034258966 7:149742287-149742309 CCAGCTCTCCCCTCCGAAATAGG - Intergenic
1036792974 8:11735497-11735519 CCACCTCTGCCCCTGGAGATGGG + Intronic
1038263250 8:26016523-26016545 CCTCCTCTGCACTTTGAAATTGG - Intronic
1038439221 8:27560037-27560059 CCAGCTCAGCCCAGTGAACTTGG + Intergenic
1039426107 8:37487601-37487623 CCAGCTATGCCCATTTACAGAGG + Intergenic
1039668287 8:39562045-39562067 CCAGCTCTGTCAATTCAAATTGG + Intergenic
1040095606 8:43439583-43439605 GCAGCTCTGCCAATAGAAAAGGG + Intergenic
1041323406 8:56637658-56637680 CCAGCTCTTCTCATTGAGACTGG - Intergenic
1041939190 8:63368182-63368204 ACAGGTGAGCCCATTGAAATGGG + Intergenic
1042092417 8:65173120-65173142 CCAGCTCTGCCCACTCCAAGGGG - Intergenic
1046260946 8:111766419-111766441 CCAGTTCCTCCTATTGAAATGGG - Intergenic
1047339403 8:123966210-123966232 CCAGTTGTGACCATTGAGATTGG + Exonic
1049585851 8:143432089-143432111 CCAGCTCTGCCCAGAGGAGTGGG - Intergenic
1052450586 9:28625146-28625168 CAAGTTCTGACCATTGAGATAGG + Intronic
1059376711 9:113887647-113887669 CCAGCTCTGCCCACTATAAAAGG - Intronic
1060942331 9:127550069-127550091 CCATCACTGGCCAGTGAAATGGG + Intronic
1062669317 9:137697412-137697434 CCTGCTCTGCCCACTGGGATCGG + Intronic
1185851458 X:3492701-3492723 CCTGCTCTGCCCATGGCATTTGG - Intergenic
1187966333 X:24615958-24615980 CCAGCTCTACCCAGTCAACTAGG + Intronic
1189494862 X:41499801-41499823 CCAGCTCTGCCCATTGCCTTCGG - Intergenic
1191241711 X:58195147-58195169 CCAACCCTACACATTGAAATGGG + Intergenic
1193079254 X:77390004-77390026 CCAGCTCAGCTCATTGGGATTGG + Intergenic
1193236437 X:79113192-79113214 GAAGATCTGCCCATTGAAAGAGG + Intergenic
1193387227 X:80886002-80886024 CAAGTTCTTCCAATTGAAATGGG - Intergenic
1193746028 X:85282469-85282491 ACATCTCTGTCCATTGAAATAGG - Intronic
1194929484 X:99868391-99868413 CCAGCTCACCCCATGCAAATTGG - Intergenic
1202302354 Y:23430187-23430209 CTAGCTCTGTCCACTGAAAGGGG - Intergenic
1202568457 Y:26240411-26240433 CTAGCTCTGTCCACTGAAAGGGG + Intergenic