ID: 1128943804

View in Genome Browser
Species Human (GRCh38)
Location 15:71808561-71808583
Sequence TTCCCATCTCTTCTGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 298}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128943804_1128943809 -5 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943809 15:71808579-71808601 GGGAAAGAGCGGCTTCGGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 240
1128943804_1128943814 23 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943814 15:71808607-71808629 GTGGCCAGTCAAATCCATGGAGG 0: 1
1: 0
2: 1
3: 12
4: 82
1128943804_1128943808 -9 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943808 15:71808575-71808597 AGATGGGAAAGAGCGGCTTCGGG 0: 1
1: 0
2: 0
3: 17
4: 171
1128943804_1128943810 -2 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943810 15:71808582-71808604 AAAGAGCGGCTTCGGGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1128943804_1128943811 -1 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943811 15:71808583-71808605 AAGAGCGGCTTCGGGAAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 143
1128943804_1128943807 -10 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943807 15:71808574-71808596 GAGATGGGAAAGAGCGGCTTCGG 0: 1
1: 0
2: 1
3: 21
4: 252
1128943804_1128943816 27 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943816 15:71808611-71808633 CCAGTCAAATCCATGGAGGATGG 0: 1
1: 0
2: 0
3: 13
4: 178
1128943804_1128943813 20 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943813 15:71808604-71808626 GGAGTGGCCAGTCAAATCCATGG 0: 1
1: 0
2: 3
3: 17
4: 102
1128943804_1128943812 4 Left 1128943804 15:71808561-71808583 CCGTGTTCCAGAAGAGATGGGAA 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1128943812 15:71808588-71808610 CGGCTTCGGGAAGGAGGGAGTGG 0: 1
1: 0
2: 1
3: 36
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128943804 Original CRISPR TTCCCATCTCTTCTGGAACA CGG (reversed) Intronic
900031800 1:378066-378088 TCCCCATCTCTTCAGGCAGAAGG - Intergenic
900052348 1:606257-606279 TCCCCATCTCTTCAGGCAGAAGG - Intergenic
901078200 1:6568801-6568823 TTTCCTTCTCTTCTGGAAGGAGG + Intronic
901913207 1:12477845-12477867 TTCCCATCTCCTGTGGAACCTGG + Intronic
902097302 1:13957325-13957347 ATCCCTGCTCTTCTGGGACAGGG + Intergenic
902367472 1:15986335-15986357 TTCCCTTCTCTTTTGAGACAGGG + Intergenic
903615473 1:24651520-24651542 TTTCCTTCTTTTCTGGAGCAGGG - Exonic
904943234 1:34179341-34179363 TTGCCATCTGCTCTGGGACAGGG + Intronic
905107995 1:35575314-35575336 TTCCCATCTCTTAGGGAAACAGG - Intronic
906054648 1:42905851-42905873 TTACCTCCTCTTCTGGAAAAGGG - Intergenic
907976092 1:59432811-59432833 TTTCAATCTCTTCTGAAACTAGG - Intronic
910147278 1:84096577-84096599 TTCCCATCTTTTCAGGACCTTGG + Intronic
910801991 1:91156317-91156339 CTCACATCCTTTCTGGAACAAGG - Intergenic
911187146 1:94915666-94915688 TTCCCATCCCTTCCAGATCAAGG + Intronic
911496946 1:98643492-98643514 TTGCCTTCTCCTCTGGAAAAGGG + Intergenic
912573591 1:110643418-110643440 TTTCCATCTCTCCTGGAGAATGG - Intergenic
914708869 1:150194700-150194722 TTCCCAGGGCTGCTGGAACAAGG + Intergenic
915477544 1:156161739-156161761 TTCCTATCCCTTTTGGAACTAGG - Intronic
917205942 1:172571789-172571811 TTCTCCTCACTTCTCGAACAGGG - Intronic
917471101 1:175326604-175326626 TTCCCATCTCTTCCAGATCCTGG + Intronic
917518578 1:175729310-175729332 ATCCCTTCTCTTCTGGAAAGAGG - Intronic
918411897 1:184267967-184267989 TTCTCATCTATTCTGGCATATGG + Intergenic
919701211 1:200632907-200632929 TTCCCATTTCTTCTGAAAGCAGG - Intronic
921427490 1:215021506-215021528 TTGCCCTCTCTTCTGGAGCTGGG + Intronic
922548266 1:226474658-226474680 TTCCCTCCTCCTCTGGAGCAAGG - Intergenic
924598491 1:245467515-245467537 TTCCCCTCTCTGCTGGTAGATGG + Intronic
924639761 1:245822867-245822889 TTCAAATCTCTACTAGAACAGGG + Intronic
1063494003 10:6490087-6490109 TATCCATGTCTTCTTGAACAGGG + Intronic
1067747207 10:48944853-48944875 TTCCAATATCTTTTGGAAAACGG + Intronic
1068749018 10:60570057-60570079 TCCCCATATTTTCTGGAAAAAGG - Intronic
1068852504 10:61760095-61760117 TTCCCAAATCCTCTGGAAGAAGG + Exonic
1069139085 10:64801534-64801556 TTACCTTCTCTACTGGAAAATGG - Intergenic
1069298400 10:66876086-66876108 TTCCTGTTTCTTCTGGAAGAAGG - Intronic
1069392559 10:67951744-67951766 TTTCCAACTCCTCTGAAACACGG + Intronic
1069595430 10:69666904-69666926 TTTCCATTTCTTCTGGGCCATGG - Intergenic
1072869948 10:99107435-99107457 TTCCCATCTAATTTGGAAAATGG + Intronic
1073805649 10:107094944-107094966 TTGCCTGATCTTCTGGAACATGG + Intronic
1074687600 10:115974732-115974754 TCCCCATCTCTGCTGGAGGAGGG + Intergenic
1076535882 10:131177382-131177404 TTCCATTCTTTTCTGGCACACGG - Intronic
1077234562 11:1473674-1473696 GTCCCATCTGTTCTGAAAGATGG + Intronic
1077392829 11:2307949-2307971 TTGCCTTCTTTTCTGAAACAAGG - Intronic
1078056765 11:8015565-8015587 TCTCCATCTCTGCTGCAACAAGG + Intergenic
1078163056 11:8858528-8858550 CTCCCATCTCTTCTGTCTCATGG - Intronic
1079361602 11:19774873-19774895 TTCCAATCTTTGCTGGAAAAAGG - Intronic
1083047236 11:59747969-59747991 TTCCCACCTCTTGGGAAACAGGG - Intronic
1084760011 11:71264619-71264641 TTGCCGTCTCTTCTGGATCTGGG + Intergenic
1085117898 11:73946559-73946581 TGCCCATGGCTTCCGGAACAAGG - Intergenic
1085340611 11:75728843-75728865 TTCCCAACTCTTCTGGCTCCTGG + Exonic
1086345119 11:85888280-85888302 TTCCCACATCTTCAGCAACAGGG + Intronic
1088486587 11:110346736-110346758 ATCCCAGCTCTTCAGGAAGATGG - Intergenic
1089754224 11:120674588-120674610 TTCCCATCCTTTCTAGCACATGG + Intronic
1090631448 11:128652678-128652700 TGCACCACTCTTCTGGAACATGG + Intergenic
1090976959 11:131687190-131687212 TTTCCTTCTCCCCTGGAACATGG - Intronic
1090977562 11:131690346-131690368 TGCCCACCTCTTCTGGTACTGGG - Intronic
1091013844 11:132031400-132031422 ATCCCCTCTCATCTGGAATACGG - Intronic
1091338501 11:134792437-134792459 TGCCCAAGTCTTCTGAAACAGGG + Intergenic
1093292733 12:17348331-17348353 TTCCCATCTTTACTGCTACATGG + Intergenic
1094148251 12:27253500-27253522 TTTCCATATCTCCTGGCACACGG - Intronic
1094222485 12:28009236-28009258 TTTCTCTCTCTTCTGGCACATGG - Intergenic
1095258862 12:40075118-40075140 TTCCCTTTGCTTCTGGCACAAGG - Intronic
1095475726 12:42585656-42585678 TTCCCCTCTCTCCTGAAGCAGGG - Intronic
1097904305 12:64904379-64904401 TCTCCATCTCCTCTGGAACCTGG - Intergenic
1098860027 12:75698651-75698673 TTCCCTCTTCTTCTGGATCATGG - Intergenic
1098882657 12:75932043-75932065 TTCCCATTTCTTCTGAAAAGTGG + Intergenic
1099883768 12:88501562-88501584 TTTCCATCTCTGCTGGTAGAAGG + Intronic
1101056082 12:100915492-100915514 TCCCCATCTTTTCTGTGACATGG + Intronic
1102398209 12:112605739-112605761 TTTCCATCTCCTGTGGAACTGGG + Intronic
1104048008 12:125177044-125177066 CTCACATCTGTTCTGGAACGAGG - Intergenic
1104611934 12:130235858-130235880 CTCCCCTATGTTCTGGAACAAGG + Intergenic
1106607064 13:31238347-31238369 TTCCCTTGTTTTCTGCAACAAGG + Intronic
1108971704 13:56383595-56383617 TTCCTATCTCCTGTGGAAAATGG + Intergenic
1109929049 13:69188318-69188340 TTGCCATCTCAGCTGGAAAAAGG + Intergenic
1111586273 13:90288218-90288240 TTCCGCTCTCTGCTGGATCAAGG + Intergenic
1112345874 13:98589102-98589124 CTTCCATCTCTTCTGGATCTTGG - Intergenic
1114656693 14:24319989-24320011 TTCCCAATTCTTCTTAAACAGGG - Intronic
1117924543 14:60764703-60764725 GTGAAATCTCTTCTGGAACAAGG + Intronic
1118044391 14:61950861-61950883 ATCCCATCTGTTTTGGAAGAGGG + Intergenic
1118529983 14:66693576-66693598 TTCCTCTCTCTTCTGGAGCTGGG - Intronic
1118702081 14:68443238-68443260 ATCCCATCTCTTCTTGGCCAGGG + Intronic
1120328858 14:83061676-83061698 TTCTCTTTTCTTCTGGAAGATGG - Intergenic
1121213019 14:92223253-92223275 GTCACTTCTCTTCTGGAGCAAGG - Intergenic
1123104979 14:105837110-105837132 TTCCCTTCTCTGCAGGTACAGGG + Intergenic
1124208145 15:27740747-27740769 TGCCCAGCTCTGCTGGTACACGG - Intergenic
1124567083 15:30826057-30826079 TTCCTGTCTCTCCTGGAACCTGG - Intergenic
1125925398 15:43558931-43558953 TGCCCATCTCTTTTCAAACAGGG - Exonic
1126670985 15:51114657-51114679 TGCCCACCTCTTCTGGCACATGG - Intergenic
1126751146 15:51877843-51877865 TTCCCAGCTCTGCATGAACATGG + Intronic
1126751253 15:51878822-51878844 CTTCAATCTTTTCTGGAACAAGG + Intronic
1127475782 15:59331462-59331484 CTCCCATCTCATCTGAAATATGG - Intronic
1127642789 15:60931275-60931297 TGCCCTTCACTTCTGGGACAGGG - Intronic
1127644835 15:60947727-60947749 TACCCATGACTTCTGGAAAACGG - Intronic
1128681964 15:69658957-69658979 GTGCCTTCTCTTCTGGGACAGGG - Intergenic
1128809636 15:70561543-70561565 TTCCCATATTTTCTGGAATTGGG - Intergenic
1128864502 15:71104095-71104117 ATTCCATCTTTTCTGGAATAAGG + Intronic
1128943804 15:71808561-71808583 TTCCCATCTCTTCTGGAACACGG - Intronic
1129816511 15:78559203-78559225 TTCCTTGCTCTTCTAGAACATGG - Intergenic
1130759973 15:86808779-86808801 TTCCATTCTCATCTGGATCATGG + Intronic
1130770570 15:86919783-86919805 TTCTCATATCATCTGGCACAAGG - Intronic
1131997191 15:98144133-98144155 TCCCTCTCTCTTCTGGAACTGGG - Intergenic
1133630066 16:7611928-7611950 TACCCATCTCTCCTGGGAGAAGG - Intronic
1134315651 16:13116610-13116632 ATCCCATCATTTCTGGAGCATGG + Intronic
1135020625 16:18959989-18960011 TTCTTATCTTTTCTGGGACAGGG + Intergenic
1135224284 16:20642043-20642065 TGCCCATGGTTTCTGGAACAAGG + Intronic
1137803021 16:51278271-51278293 TTCCCATCTCTTATGGGTCTAGG - Intergenic
1138338408 16:56270578-56270600 TTCCCATATCTCCTGGCATAGGG - Intronic
1138417106 16:56877898-56877920 TTCCTCTCTGTGCTGGAACAGGG + Intronic
1138849054 16:60604903-60604925 TTCCCATTTCAACTGGATCATGG - Intergenic
1140377447 16:74456049-74456071 TACTCATCTGGTCTGGAACATGG - Intronic
1141918102 16:87114390-87114412 TTCCCACCTCCTCTGGAAAGTGG - Intronic
1142815740 17:2423701-2423723 TTCCCATCTCTTCTCACAGAAGG + Intronic
1143836822 17:9699604-9699626 TTCCCATCTCTTCTGTATTGAGG + Intronic
1144642091 17:16943247-16943269 TTCCCTTCTCTTCTTGTATAAGG - Intronic
1146726314 17:35159210-35159232 TGCCCATCTCACCTGGAAAAAGG - Intronic
1147317596 17:39628161-39628183 TTCCCATCCCTAGTGGAGCAGGG + Intronic
1151385246 17:73751280-73751302 TTCCCAGCCTTTCTTGAACATGG - Intergenic
1151577641 17:74960736-74960758 CTCCCTTCTCTTCTGGAGTAGGG + Intronic
1151609839 17:75165693-75165715 TTCACAACTTTTCTGGAACTTGG + Intronic
1152266898 17:79300353-79300375 TTCCCATCTCTACTGGATTCTGG - Intronic
1152773358 17:82184580-82184602 TTCCCATCTCTTAGGGAAACAGG - Intronic
1152947857 17:83207648-83207670 TCCCCATCTCTTCAGGCAGAAGG + Intergenic
1155086918 18:22467724-22467746 AACCCATCGATTCTGGAACATGG - Intergenic
1156852672 18:41746245-41746267 TTACAATCTCTTCTGCAACCAGG - Intergenic
1156901899 18:42309915-42309937 TTCTCATCTCTTGGGGAACAGGG + Intergenic
1158049016 18:53193064-53193086 TTCCTCTCTCTTCTGGACTATGG + Intronic
1159651228 18:70981520-70981542 TTCTCATCTGTGCTGGCACAGGG + Intergenic
1159894660 18:73984820-73984842 CTCCAATGTCATCTGGAACAGGG + Intergenic
1160541542 18:79626598-79626620 TTGCAATCTGTTCTGGAACTAGG + Intergenic
1162525084 19:11202180-11202202 ATCCCCTCTCTCCAGGAACAGGG - Intronic
1162556723 19:11391289-11391311 TTCCCACCTCCTCTGCAGCAAGG - Intronic
1165821439 19:38678851-38678873 TTCTCCTCTCCTGTGGAACAAGG - Intronic
1168636034 19:57997926-57997948 TTCCCATCTCACCTGGACCAGGG + Intronic
925096120 2:1205082-1205104 TTCCCATCTTTTCTAGAATGTGG + Intronic
925661398 2:6207029-6207051 TTCTCATCTCTTTTGAAACACGG + Intergenic
925719631 2:6814364-6814386 TTGCCATCTCTTCTCAAACAGGG - Intergenic
927182014 2:20453450-20453472 TTCTCATCTCTACTGGAACCAGG - Intergenic
927712426 2:25334105-25334127 TTCCCATGTCCTATTGAACAGGG + Intronic
929944498 2:46360364-46360386 TTCCCATTGCATCTGGAACATGG - Intronic
931602954 2:64021658-64021680 TTGGAATCTTTTCTGGAACAAGG - Intergenic
932137931 2:69246911-69246933 CTCAGATCTTTTCTGGAACAAGG + Exonic
933450627 2:82445676-82445698 TTCCCATCTCTTGAGGATTATGG - Intergenic
933722699 2:85408532-85408554 TTCACATCTCAACTGGAGCAAGG + Intronic
934143344 2:89069648-89069670 TTGCCATCTGTTCAGGAAAATGG - Intergenic
934225897 2:90130907-90130929 TTGCCATCTGTTCAGGAAAATGG + Intergenic
935107648 2:100060478-100060500 TTCTCATCCCTTCTGAAAGATGG + Intronic
935113941 2:100118096-100118118 TTTCTATCTTTTCTGGAGCAGGG + Intronic
935185363 2:100726904-100726926 TTTCCATCCCTTCAAGAACATGG + Intergenic
935874524 2:107492463-107492485 TGACCAGCTCTTCTGGAGCATGG - Intergenic
936653077 2:114452389-114452411 TTCCTGTATCTTCTGGAAAATGG - Intronic
937506705 2:122545829-122545851 TTCCCACCTCTTCTAGATCTTGG - Intergenic
941285427 2:163606616-163606638 TGACCATCTATTCTGGAACTTGG - Exonic
942427926 2:175878978-175879000 TTTCCATCTCTTCTGAGAAATGG + Intergenic
943330303 2:186550869-186550891 CTCACTTCTCTTCTGGAAGAGGG - Intergenic
944177226 2:196845542-196845564 TTCACACCTCTTTTTGAACATGG - Intronic
945023267 2:205595263-205595285 TGCCCACCTGTTCTGGAACTAGG - Intronic
947202803 2:227629938-227629960 TGCCCATTTCTTCTTGATCAAGG - Intronic
947363984 2:229375153-229375175 TTCCCATCTCTGATGGAACCTGG - Intronic
947545760 2:231009154-231009176 TTCCCATCTCTTTTGGTAACAGG - Intronic
948266887 2:236641456-236641478 TTACCAACTCTTCTTGCACAAGG + Intergenic
948535866 2:238646329-238646351 ATCCCATCACTTTTGGACCATGG - Intergenic
948840163 2:240644867-240644889 TTCCCATGTCCTCAGGACCACGG - Intergenic
1168868152 20:1106510-1106532 TTCTCATCTCATCTGTAAAATGG - Intergenic
1170837032 20:19893534-19893556 TTCCCATCTGTCCTGGCTCATGG + Intronic
1172024171 20:31936719-31936741 TTCACATCTCTATTGGAAGAAGG + Intronic
1172522472 20:35576889-35576911 TTCCCAACTCTCCTGGAAAAGGG - Intergenic
1172645325 20:36465542-36465564 TTCCCATCTGTTCTGGGAGGAGG + Intronic
1173330800 20:42074773-42074795 TTCCCATCTCTTCTGGAGGTGGG + Exonic
1173804969 20:45918709-45918731 TTTTCATTTCCTCTGGAACAGGG - Intergenic
1173857264 20:46258439-46258461 TTCCCATCTCTCCTGCCGCAGGG + Intronic
1174267823 20:49344732-49344754 TTCCCATTGCTTCTGATACAAGG - Intergenic
1175190597 20:57210119-57210141 TTCTCTTCTCTTCTGAAACTGGG + Intronic
1178056426 21:28804192-28804214 TTCCCATCTCTTCTAGAATCAGG + Intergenic
1178063046 21:28873149-28873171 TTACCACCTCTTCTGGGAAACGG - Exonic
1178194324 21:30325944-30325966 TTCCTCTCTCTTCTGGAGCTGGG - Intergenic
1178221933 21:30669798-30669820 TTCCAATCTCATCTGAGACAAGG - Intergenic
1179014376 21:37582784-37582806 TTCTCATCTCTTCTTGAAATGGG - Intergenic
1181885986 22:26022867-26022889 TTCCCAGCTATGCTGGCACAGGG - Intronic
1183521447 22:38298202-38298224 TTCACATCTCTTCTGGAAAAGGG - Intronic
949359943 3:3221005-3221027 TACCCACCTTTTTTGGAACATGG + Intergenic
950630880 3:14281139-14281161 TTCCTGTATCTTCTGGAGCAGGG + Intergenic
950663668 3:14482219-14482241 GTCCCACCGCTTCAGGAACATGG - Intronic
951055209 3:18139486-18139508 TTGCCATCTCTTCTTGACCTTGG + Intronic
951966210 3:28388459-28388481 TTGCAACCTCTTCTGGAAAAAGG - Intronic
952657715 3:35806733-35806755 ATCCCATCTCTGTTGGAACCAGG - Intergenic
952740091 3:36726448-36726470 CTCACATCTCTCCTGGAACTGGG + Intronic
953130269 3:40131140-40131162 TTCCCATTTGTTTTGGAGCATGG - Intronic
953367556 3:42359147-42359169 TTCCCACCTGTACTGGGACATGG - Intergenic
954219154 3:49142196-49142218 TGCCCCCCTCTTCTGGAACCTGG - Intergenic
955042585 3:55332138-55332160 TTCCCATCTTTTCAGTATCAAGG - Intergenic
956666010 3:71642666-71642688 TTCCCTTCCCTTCTGAGACAAGG + Intergenic
957249159 3:77750757-77750779 TTCCCACCACTTCTAAAACATGG + Intergenic
958491317 3:94777344-94777366 TTCCTCTCTCCTCTGGAAGAGGG - Intergenic
958685052 3:97382329-97382351 TTCCCATCTTTGCTGTAACTTGG + Intronic
958743045 3:98097956-98097978 CTCCCTTCTCTTCTGGATCTTGG + Intergenic
961149660 3:124627082-124627104 ATCCCATCTTTTTTGGAAAATGG - Intronic
963280061 3:143375537-143375559 TTCTCATCTCATCTGGGACCAGG - Intronic
963334182 3:143953536-143953558 TTCCCATCACATCTGGAATATGG - Intergenic
965080335 3:164024488-164024510 TTTCCTTCTCTTCTGGAAGGAGG + Intergenic
965285275 3:166811425-166811447 TTTCCATTTCATCAGGAACATGG - Intergenic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
965990184 3:174808599-174808621 TTCCCATCTTTCCAGGAACCTGG + Intronic
969155327 4:5205086-5205108 TTTCCCTCTCTTCTAGAGCAGGG + Intronic
970371589 4:15412407-15412429 TTCCCACATTTTCTGGCACAGGG + Intronic
970767514 4:19567607-19567629 TTCCCATTTCTTCTGATGCAGGG - Intergenic
971005145 4:22365093-22365115 ATCTCATGTCTTCAGGAACATGG + Intronic
974111300 4:57528668-57528690 TTTCCTTTTCTTCTGGGACAGGG - Intergenic
977227340 4:94408640-94408662 TTCCCATCTATTTAGGTACAAGG + Intergenic
977499063 4:97815669-97815691 TTACCTTCTCTTCTGGGAAAAGG + Intronic
977566073 4:98582037-98582059 GGCCCATCTCTTGTGGGACATGG + Intronic
979609597 4:122675111-122675133 TTCCCACCTCTCTTGGAACTAGG + Intergenic
980280555 4:130713928-130713950 TTCCTATCTTTTCTTGAAGACGG + Intergenic
980431810 4:132709966-132709988 TTCCTATCTCTTCTTGAGCTAGG - Intergenic
981167535 4:141579703-141579725 TAACCATCATTTCTGGAACAAGG + Intergenic
982024501 4:151237941-151237963 TTCCCAGCCCTTCTGAACCAGGG + Intronic
982474602 4:155834790-155834812 TTCTCGTCTCTTCTGGAGCTTGG - Intronic
983268186 4:165530082-165530104 GTCCCATCTCCTCAGAAACAAGG + Intergenic
985846668 5:2354526-2354548 CTCACATCTCCTCTGGACCAGGG - Intergenic
987873682 5:23651731-23651753 TTCCCATCTCTCCTAGAACAGGG - Intergenic
991003644 5:61806973-61806995 TTCCCCTCACCTCTGGGACAAGG + Intergenic
991573056 5:68075634-68075656 ATCCCATCTCTTCTAGATCTTGG - Intergenic
992030378 5:72715173-72715195 TTCCTATTTCTTATGGAAAACGG - Intergenic
992377650 5:76204489-76204511 TTCCCATTTCCACTGGAAGATGG - Intronic
992557011 5:77913790-77913812 TTCTCATTCCTCCTGGAACACGG + Intergenic
992571013 5:78057466-78057488 TTCCCGTCTCTTCTTGAGCTGGG + Intronic
992653034 5:78880097-78880119 GGCCAATCTCTTATGGAACAGGG - Intronic
995372593 5:111435799-111435821 TTCTCACCTTTTCTGAAACATGG + Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995449665 5:112286672-112286694 TTCTCATCTATTCAGGAACATGG + Intronic
995889359 5:116933781-116933803 TTACTGTCTCTTCTAGAACAAGG + Intergenic
997102964 5:130988595-130988617 TTCCCATGTCTTCTGCATCCAGG - Intergenic
998271823 5:140713377-140713399 TTGGCATCTCTTCTAGAGCATGG + Intergenic
998602382 5:143598255-143598277 TTCACATCTTTTCTGGAAATGGG - Intergenic
998661005 5:144237624-144237646 TTTCCAGTTTTTCTGGAACAGGG + Intronic
998670924 5:144352650-144352672 TCTCCATTTCTTCAGGAACAGGG - Intronic
1000807678 5:165816678-165816700 TTCCCATTTCTTTTAGAATAAGG - Intergenic
1001405501 5:171474220-171474242 TTTCCATCTGTACTGGAACGTGG - Intergenic
1001603911 5:172946576-172946598 TCACCATACCTTCTGGAACATGG - Intronic
1002742020 5:181440802-181440824 TCCCCATCTCTTCAGGCAGAAGG + Intergenic
1004755480 6:18606060-18606082 TGCCCATATCTTATGGCACAGGG + Intergenic
1005586572 6:27282305-27282327 TTCCCAGTTCTTCTGGAAAAAGG - Intergenic
1005882128 6:30069884-30069906 TTCTCACCTCTTATGGAAAATGG + Exonic
1006186941 6:32186784-32186806 TGCCCATCTCCTCTCGAATAGGG - Intronic
1007032606 6:38641588-38641610 TTTCCGTTTCTTCTGGAGCAGGG + Intergenic
1007284915 6:40740693-40740715 TTCCCATATGTGCTGGAAAACGG - Intergenic
1007932469 6:45704702-45704724 TTCCCAGCTCTTCTTGCACTCGG - Intergenic
1008877105 6:56341135-56341157 CTCTCTTCTCTTCTGGAGCATGG - Intronic
1011823612 6:91280925-91280947 TTCCCATCTCACCTGGAAACAGG + Intergenic
1013148227 6:107416270-107416292 TTCCCATCTTCTCTGGCTCATGG - Intronic
1015008533 6:128313971-128313993 TACCCATCTCATCTTGAAAAAGG + Intronic
1016612162 6:146002272-146002294 TTCACATCTCTTGTAGGACAGGG - Intergenic
1016989715 6:149920804-149920826 TTTCCATCTCTTCTGGATCTTGG - Intronic
1017310033 6:152965740-152965762 TTCCCCTAACATCTGGAACAAGG + Intergenic
1017791418 6:157802900-157802922 TTTCCCTATATTCTGGAACATGG - Intronic
1019073475 6:169368430-169368452 TCCCCAGCTCCTCTGGAATATGG - Intergenic
1019247157 6:170716540-170716562 TCCCCATCTCTTCAGGCAGAAGG + Intergenic
1020345332 7:7156106-7156128 TTCCCTTTTCTTCTGGATCCTGG - Intergenic
1020788125 7:12593871-12593893 TTTCCTTCTCTTCTGGAAGGAGG + Intronic
1023134459 7:37037429-37037451 TTCCCATCTCCTCTGTCATAGGG - Intronic
1023294202 7:38698346-38698368 TTCCCCTCACTTCAGGAACTTGG + Intergenic
1023838839 7:44084188-44084210 TGCCCATCCCTGCTGGCACAAGG - Intergenic
1024896976 7:54271535-54271557 TTCACATGTCTTCTGTCACAAGG - Intergenic
1027794197 7:82671721-82671743 TTGCCATATCTTCAGAAACAAGG + Intergenic
1029004108 7:97189343-97189365 TTCCTGTCCCTCCTGGAACAGGG + Intergenic
1029234907 7:99107123-99107145 TTCCCATCACCTCTGTAGCAAGG + Intronic
1029448007 7:100625530-100625552 TTGCCTCCTCTACTGGAACAGGG - Intronic
1029876841 7:103763401-103763423 ATCCAGTCTCTTCTGGATCAAGG + Intronic
1030125670 7:106150624-106150646 TTCCCATCTCTCCTGGTCCTTGG + Intergenic
1031460022 7:122037321-122037343 TTCCCATAGCTCCTGGCACAAGG + Intronic
1033085719 7:138339809-138339831 TGCCCATGATTTCTGGAACAAGG + Intergenic
1033570348 7:142621722-142621744 ATCCCATCACCTCTGGAAAATGG - Intergenic
1033596284 7:142861905-142861927 TTCCCATATCTTGTCCAACATGG + Intronic
1034671888 7:152865280-152865302 TTCACATCTCTGCTGTACCAAGG - Intergenic
1035500980 8:91394-91416 TCCCCATCTCTTCAGGCAGAAGG - Intergenic
1035520163 8:269418-269440 TTCAACTCTTTTCTGGAACAGGG - Intergenic
1035846448 8:2870359-2870381 TTCTTATCTCTTATTGAACAGGG + Intergenic
1037421442 8:18707595-18707617 TTGCTGTCTCATCTGGAACATGG - Intronic
1038790341 8:30662873-30662895 TTACCTTCTCTTCTGGGAAAGGG - Intergenic
1039093167 8:33854667-33854689 ATCCCAACTCTACTTGAACATGG - Intergenic
1041215892 8:55599736-55599758 TTCCCTTATCTTCTGTATCATGG - Intergenic
1042813112 8:72847350-72847372 TTCCCATCTCCACTTCAACATGG + Intronic
1043933991 8:86122147-86122169 TTCTCATCTCTTTTGAAACCAGG + Intronic
1045691141 8:104761168-104761190 TCTTCATCTCTTTTGGAACAGGG - Intronic
1046209545 8:111051010-111051032 TTACAATCTCTTCTAGAAAACGG - Intergenic
1046689929 8:117271324-117271346 ATTCAAGCTCTTCTGGAACAAGG - Intergenic
1047768769 8:128013197-128013219 TTTCCATCTCCTCTGTAACATGG + Intergenic
1047986741 8:130243152-130243174 TTCCCATTTCTTCTAGCAAAGGG - Intronic
1048041606 8:130734686-130734708 TTGTCAACTCTTCTAGAACAAGG - Intergenic
1048057946 8:130886588-130886610 TTTCCATCTCTTCTCCAAGACGG - Intronic
1048497077 8:134944153-134944175 CTTCCATCTCTTCTGCAACGAGG - Intergenic
1049201137 8:141341211-141341233 TTCCCATCTCTGCTGACTCATGG - Intergenic
1050470319 9:5981743-5981765 CGTCCATCTCTTCTGGAAAATGG + Intronic
1051277258 9:15408704-15408726 TTCGCATCTTTTCAGGAATAAGG - Intergenic
1051682777 9:19624775-19624797 TTCTTATCTCTTTTGCAACAGGG - Intronic
1053237727 9:36470724-36470746 TTACCTTCTCTGCTCGAACAAGG + Intronic
1053389673 9:37725330-37725352 AGCCCAGCTCTTCTGGTACAAGG + Intronic
1054834409 9:69661395-69661417 TTCCCATCTCTTCCTGCACAGGG - Intronic
1056035355 9:82599203-82599225 TTGCCATTTCTTTTGGAACATGG + Intergenic
1057455067 9:95200604-95200626 TTCTCATCTCATCTATAACATGG + Intronic
1057455427 9:95204821-95204843 TTCCAATCTCCTCTGCCACAGGG + Intronic
1057465950 9:95314846-95314868 TTGCCATCTCATCATGAACATGG - Intronic
1058419426 9:104820129-104820151 TTCTCATCTGTTCTGGGCCAGGG - Intronic
1059165542 9:112073289-112073311 TTCCCATGTCTTCAGTACCAAGG - Intronic
1060022053 9:120140238-120140260 TTCTCATCTCTTCTCTGACATGG - Intergenic
1060804740 9:126567809-126567831 TTGCTCTCTCTTCTGGAGCAGGG - Intergenic
1203607932 Un_KI270748v1:72018-72040 TCCCCATCTCTTCAGGCAGAAGG + Intergenic
1185457044 X:316481-316503 TTCCCAACTCTACTGGAAGCGGG + Intronic
1186489937 X:9963669-9963691 TTTGCATCTTTTCTGGAAAAAGG - Intergenic
1186625998 X:11294729-11294751 TTCTTATCTCTTCTGAAACATGG - Intronic
1187319293 X:18226070-18226092 TTCCCAGCTTTGCTGGGACACGG - Intergenic
1188444873 X:30245954-30245976 ATCACATCACTTCTGGGACAGGG + Intronic
1188752700 X:33923439-33923461 TTCCCATCCCTGCTGGCACATGG - Intergenic
1189065359 X:37802637-37802659 TTCCCTTCTGTTCTGAAATAAGG - Intronic
1191895172 X:65985079-65985101 CCCCCATGTCATCTGGAACAGGG - Intergenic
1191904298 X:66072697-66072719 TTCCCATTTCTTTTTTAACAGGG + Intergenic
1192250726 X:69411381-69411403 TTCCCACCCCTTTTAGAACATGG + Intergenic
1192413895 X:70960030-70960052 TTCCCATCTCTACAGGCACATGG - Intergenic
1193264125 X:79447830-79447852 TTGCCAAATTTTCTGGAACATGG - Intergenic
1194792597 X:98169192-98169214 TTCTCTTCTCCTCTGGAAAATGG - Intergenic
1194870942 X:99130099-99130121 TTTCCTTCTCTTCTGGATAAGGG + Intergenic
1195247977 X:103013779-103013801 TTCTCATCTCATCTGTAAAATGG + Intergenic
1195313318 X:103654885-103654907 TTCCCATCCATACTGGATCAGGG + Intergenic
1197551728 X:127900344-127900366 TTCCCCTGTCTGCTGGCACATGG + Intergenic
1199181741 X:144864920-144864942 TTCCCATAAGATCTGGAACAAGG - Intergenic
1200509901 Y:4064848-4064870 TTGCTATCTCTTCTGGAGCTGGG - Intergenic