ID: 1128944017

View in Genome Browser
Species Human (GRCh38)
Location 15:71809539-71809561
Sequence GAGCTGTGAGGCCGAGTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128944008_1128944017 19 Left 1128944008 15:71809497-71809519 CCTGGGAGCAGCGCAGGGGGCTG 0: 1
1: 0
2: 4
3: 62
4: 472
Right 1128944017 15:71809539-71809561 GAGCTGTGAGGCCGAGTTCGGGG 0: 1
1: 0
2: 0
3: 22
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128944017 Original CRISPR GAGCTGTGAGGCCGAGTTCG GGG Intronic
900013602 1:135160-135182 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
900043670 1:491143-491165 CTGCTGTGAGGCCGAGGCCGAGG + Intergenic
900065108 1:726146-726168 CTGCTGTGAGGCCGAGGCCGAGG + Intergenic
903580752 1:24368780-24368802 GACCTGTGAGGCCCAGATTGTGG - Intronic
904445635 1:30571158-30571180 GAGCTGGGAGGCCAAGATCAAGG - Intergenic
905274094 1:36806014-36806036 GAGCTGTGAGACGGAGTGTGAGG + Intronic
908930155 1:69308312-69308334 GAGTTTTGAGGCTGAGTTGGTGG + Intergenic
914747629 1:150511477-150511499 ATTCTGTGAGGCCGAGTTCTCGG + Exonic
916789983 1:168116558-168116580 GAGCTGTGTGGCCTGGTTTGTGG - Intronic
919856532 1:201709876-201709898 GAGCTGGGAGGCTGAGGTCCAGG - Intronic
921939981 1:220829364-220829386 GTGCTGTGAAGCAGAGTGCGGGG + Intergenic
922100215 1:222472983-222473005 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
923544606 1:234914989-234915011 GAGCTGGGAGGCAGAGGTGGAGG + Intergenic
923922052 1:238577716-238577738 AAGCTGGGAGGCCGAGGTTGTGG + Intergenic
1064297532 10:14092026-14092048 GAGCTGTGAGGTGGGGTTCAGGG - Intronic
1065483928 10:26218172-26218194 GAGCTCCGAGGCCAGGTTCGGGG - Intronic
1065918087 10:30368754-30368776 TAGCAGTGAGGCCAAGTTTGGGG - Intronic
1066697939 10:38095013-38095035 GACCTGTGAGGCCGCGCACGCGG + Intronic
1066733276 10:38451744-38451766 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1066994566 10:42552176-42552198 GACCTGTGAGGCCGCGCACGTGG - Intergenic
1071598111 10:86942623-86942645 GTGCTGCGAGGCCGAGGCCGGGG - Exonic
1073288798 10:102403243-102403265 GAGCTGTGACGCTGAGCCCGGGG + Exonic
1076527554 10:131121821-131121843 GAGCTGTGAGGCCCAGGTGTGGG + Intronic
1076969944 11:127374-127396 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1083172885 11:60933550-60933572 GGCCTGTGATGCCGTGTTCGTGG + Exonic
1083878976 11:65539007-65539029 CAGAAGTGAGGCCGAGCTCGCGG + Exonic
1085891583 11:80585806-80585828 AAGCTGGGAGGCCGAGGTTGTGG + Intergenic
1086674746 11:89591443-89591465 GAGCTGTGAGGTGGAATTTGTGG - Intergenic
1097484207 12:60173787-60173809 GAGCTGGGAGGCAGAGGTTGCGG - Intergenic
1104857662 12:131909546-131909568 GGGCTGGGAGGCCGCGTTCTGGG + Intronic
1108701563 13:52948476-52948498 GTGCTGTGAGGCTGAGGTCAGGG - Intergenic
1119174576 14:72559776-72559798 GAGCGGTGAGGCTGAGCTCCAGG + Intronic
1119370582 14:74138118-74138140 GAGCTGTAAGGCCAAGTTAAAGG - Intronic
1123473006 15:20568712-20568734 TAGCAGTGAGGCCAAGTTTGAGG + Intergenic
1123509422 15:20981613-20981635 GCTCTGTGAGGCTGAGTTCCAGG + Intergenic
1123566645 15:21555352-21555374 GCTCTGTGAGGCTGAGTTCCAGG + Intergenic
1123602905 15:21992645-21992667 GCTCTGTGAGGCTGAGTTCCAGG + Intergenic
1123645000 15:22431641-22431663 TAGCAGTGAGGCCAAGTTTGAGG - Intergenic
1123666292 15:22611417-22611439 TAGCAGTGAGGCCAAGTTTGAGG - Intergenic
1123751440 15:23361078-23361100 TAGCAGTGAGGCCAAGTTTGAGG + Intronic
1124320113 15:28705823-28705845 TAGCAGTGAGGCCAAGTTTGAGG - Intronic
1124373226 15:29115207-29115229 GCTCTGTGAGGCTGAGTGCGTGG + Intronic
1124482399 15:30089594-30089616 TAGCAGTGAGGCCAAGTTTGAGG + Intronic
1124488858 15:30141696-30141718 TAGCAGTGAGGCCAAGTTTGAGG + Intronic
1124521178 15:30407615-30407637 TAGCAGTGAGGCCAAGTTTGAGG - Intronic
1124537484 15:30558605-30558627 TAGCAGTGAGGCCAAGTTTGAGG + Intronic
1124543942 15:30610660-30610682 TAGCAGTGAGGCCAAGTTTGAGG + Intronic
1124563909 15:30798086-30798108 TAGCAGTGAGGCCAAGTTTGGGG + Intergenic
1124754672 15:32396627-32396649 TAGCAGTGAGGCCAAGTTTGAGG - Intronic
1124761172 15:32448982-32449004 TAGCAGTGAGGCCAAGTTTGAGG - Intronic
1124777462 15:32600081-32600103 TAGCAGTGAGGCCAAGTTTGAGG + Intronic
1124969737 15:34475459-34475481 GAGCTGGGAGGCCGAGGTGCCGG - Intergenic
1125989480 15:44092312-44092334 GAGCTGTGAGACCAATTTGGAGG - Intronic
1128944017 15:71809539-71809561 GAGCTGTGAGGCCGAGTTCGGGG + Intronic
1132030762 15:98437035-98437057 CAGCTGTGAGGCCGTGTGCAGGG - Intergenic
1132432995 15:101775610-101775632 TAGCAGTGAGGCCAAGTTCGGGG - Intergenic
1202975006 15_KI270727v1_random:282447-282469 GCTCTGTGAGGCTGAGTTCCAGG + Intergenic
1132760148 16:1505089-1505111 TTGCTGTGAGGCCGACTTCCTGG + Intronic
1136400978 16:30018472-30018494 GACCTGTTAGGCCAGGTTCGGGG - Intronic
1138898922 16:61244679-61244701 CATCTGTGAGGCTGAGTCCGGGG + Intergenic
1139811556 16:69623065-69623087 GACCTGTGAGGCGGAGGTTGTGG + Intronic
1141755997 16:85991380-85991402 GGCCTGAGAGGCCGAGTGCGTGG + Intergenic
1142216174 16:88831211-88831233 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216184 16:88831247-88831269 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216194 16:88831283-88831305 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216204 16:88831319-88831341 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216214 16:88831355-88831377 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216224 16:88831391-88831413 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216234 16:88831427-88831449 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216244 16:88831463-88831485 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216254 16:88831499-88831521 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216264 16:88831535-88831557 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216274 16:88831571-88831593 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216284 16:88831607-88831629 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216294 16:88831643-88831665 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216304 16:88831679-88831701 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216314 16:88831715-88831737 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216324 16:88831751-88831773 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142216334 16:88831787-88831809 GAGCGGTGAGGCCGAGCACGGGG + Intronic
1142450736 16:90171758-90171780 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1142456829 17:61933-61955 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1144660055 17:17062148-17062170 GAGCTGTGAGGTCCTGTTGGTGG + Intronic
1144961376 17:19045961-19045983 GAGGTGTGCTGCTGAGTTCGGGG + Intronic
1144973784 17:19128563-19128585 GAGGTGTGCTGCTGAGTTCGGGG - Intronic
1160646746 19:197292-197314 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
1161684064 19:5694501-5694523 CAGCGGCGAGGCCGAGTCCGTGG - Exonic
1163918619 19:20266113-20266135 AACCTGTGAGGCCGAGGTTGCGG - Intergenic
1168101450 19:54143599-54143621 GAGCTGTGGGCCCCAGTTCCTGG + Intronic
928346122 2:30498178-30498200 CAGCTATGAGGCTGAGTCCGGGG + Intronic
929505239 2:42523168-42523190 GAACTATGAGGCCAAGTTCAAGG - Intronic
934011416 2:87824693-87824715 GAGAGGTGAGGCCGAGGCCGAGG + Intronic
936517638 2:113192514-113192536 GAGGCGTGAGGCCAAGTTCCAGG - Exonic
939459725 2:142484284-142484306 CAGCTGTGAAGCCAAGTTTGTGG - Intergenic
946354589 2:219176949-219176971 GAGCTGCGAGGGCGAGGGCGAGG - Intronic
948776794 2:240293373-240293395 GAGCTGTGGGGCCGTGTCCAGGG + Intergenic
1169171821 20:3471338-3471360 GCCCTGTGAGGCCGAGGCCGCGG + Exonic
1172661784 20:36573622-36573644 GAGCTGTCAGGCCGAGTGTCAGG + Exonic
1172698378 20:36837367-36837389 GAGCAGTGAGGCCAAGCTGGAGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173961081 20:47073143-47073165 GAGCTGGGAGTCAGAGTTCCTGG - Intronic
1181841759 22:25669310-25669332 GGGCTGTGGGGCTGAGTTCCAGG + Intronic
1183444493 22:37844166-37844188 GAGCTCGGAGGGCGAGTGCGCGG - Exonic
1184028108 22:41873117-41873139 AAGCTGGGAGGCAGAGTTTGTGG + Intronic
1184405841 22:44300334-44300356 GAGCTGAGAGCCCAAGTTCAAGG - Intronic
1185206287 22:49541091-49541113 GAGGAGCGAGGCCGGGTTCGGGG - Intronic
953968946 3:47332275-47332297 GAGCTGGGAGGCAGAGGTTGAGG + Intronic
961447554 3:126987964-126987986 GGGCTGTCAGGGCGTGTTCGGGG + Intergenic
965178486 3:165367377-165367399 CATCTGTGAGGCTGAGTTCAGGG + Intergenic
968136004 3:196220032-196220054 AAGCTGCGAGGATGAGTTCGGGG + Intronic
968370935 3:198222230-198222252 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
969664755 4:8550820-8550842 ACGCTGTCAGGCCCAGTTCGGGG + Intergenic
971128152 4:23776874-23776896 GAGCTGTGGGGCTGAGAGCGTGG + Intronic
975710608 4:77157337-77157359 GGGCTGTGAGGCCGAGGCGGCGG + Exonic
979259621 4:118634718-118634740 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
979328752 4:119405906-119405928 CCGCTGTGAGGCCGAGGCCGAGG + Intergenic
979785561 4:124712383-124712405 AAGCTGGGAGGCCGAGGCCGTGG - Intronic
982796201 4:159648133-159648155 GAGCTGGGAGGCAGAGGTTGCGG - Intergenic
982892853 4:160877561-160877583 CAGCTGTGAGGCTGAGTCCGGGG - Intergenic
984456064 4:179970685-179970707 GAGCTGTGAGATCGAGTTAAAGG - Intergenic
1002730173 5:181327786-181327808 CTGCTGTGAGGCCGAGGCCGAGG - Intergenic
1003325039 6:5084966-5084988 GAGCCGTCAGGCCAAGTTCATGG + Exonic
1017073734 6:150599844-150599866 GAGCAGTGGGGCCGAGCCCGAGG + Exonic
1017170797 6:151452517-151452539 GAGCTTTGCGGCCGGGATCGCGG + Exonic
1021711622 7:23421611-23421633 GACCTGGGAGGCAGAGTTTGTGG + Intronic
1026772652 7:73212117-73212139 GAGGTGTGAGGGCGATTTGGTGG + Intergenic
1026803807 7:73417115-73417137 AACCTGTGAGGCCGAGCTTGCGG - Intergenic
1027013516 7:74765517-74765539 GAGGTGTGAGGGCGATTTGGTGG + Intergenic
1027074522 7:75180516-75180538 GAGGTGTGAGGGCGATTTGGTGG - Intergenic
1028987845 7:97021913-97021935 GAGCTGTGGGGCCAATTTCGCGG - Intronic
1029375760 7:100176169-100176191 GAGCTGTGAAGCTGAGTTTGGGG + Intronic
1032133373 7:129250187-129250209 TACCTGGGAGGCTGAGTTCGAGG + Intronic
1036728378 8:11240411-11240433 GAGCTCTGAGGCAGAGCTGGTGG - Intergenic
1037963985 8:23119195-23119217 GAGCTCCGAGGCCGAGTGCATGG - Intergenic
1038272951 8:26090873-26090895 CAGCTATGAGGCTGAGTTTGGGG - Intergenic
1045057581 8:98382694-98382716 GAGCTGTCAGGCCGCTTTCCAGG - Intergenic
1045971209 8:108082091-108082113 GAGATCTGAGGCCGGGTTTGGGG + Intronic
1046127537 8:109928755-109928777 GAACTGGGAGGCAGAGTTTGCGG + Intergenic
1049203705 8:141353718-141353740 GAGCTGTGGGGCCCAGTCCAGGG + Intergenic
1049606799 8:143533290-143533312 CAGCTCTGAGGCCGAGGTGGAGG - Intronic
1050679234 9:8090599-8090621 GAGTTGTCAGGCAGAGTTCTGGG - Intergenic
1056744184 9:89285986-89286008 GAGATGTGATGCCAAGTTGGGGG + Intergenic
1062015589 9:134289584-134289606 GAGCTGGGAGGCAGAGTACCTGG - Intergenic
1062331882 9:136048489-136048511 AAGCTGTGAAGCCCAGATCGAGG + Intronic
1062754584 9:138280300-138280322 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1203578490 Un_KI270745v1:24460-24482 CCGCTGTGAGGCCGAGGCCGAGG - Intergenic
1188756666 X:33970361-33970383 AGGCTGTGAGGCCGAGTGTGTGG + Intergenic
1189337013 X:40176344-40176366 GATCCGTGAGGCCGAGGCCGGGG - Intronic
1191252882 X:58267789-58267811 AAGCGGTGAGGCCGAGGACGAGG - Intergenic
1195668895 X:107452777-107452799 GAGCTGTGTGGCCCAGTTGGGGG + Intergenic
1200212359 X:154352376-154352398 GACCCATGAGGCCGAGATCGTGG - Exonic