ID: 1128946596

View in Genome Browser
Species Human (GRCh38)
Location 15:71827121-71827143
Sequence TGTTCACACATGAAATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128946591_1128946596 16 Left 1128946591 15:71827082-71827104 CCCTCTAAAGCAAATCATCATAT 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1128946596 15:71827121-71827143 TGTTCACACATGAAATTGGGTGG 0: 1
1: 0
2: 3
3: 24
4: 298
1128946592_1128946596 15 Left 1128946592 15:71827083-71827105 CCTCTAAAGCAAATCATCATATA 0: 1
1: 0
2: 1
3: 24
4: 260
Right 1128946596 15:71827121-71827143 TGTTCACACATGAAATTGGGTGG 0: 1
1: 0
2: 3
3: 24
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128946596 Original CRISPR TGTTCACACATGAAATTGGG TGG Intronic
900720898 1:4175115-4175137 TTTTCACATATGAATTTTGGAGG - Intergenic
902675445 1:18005460-18005482 TGGTCAGACAGGAAATTGGCAGG + Intergenic
902737326 1:18409727-18409749 TGTTCATACATGAATTCAGGTGG - Intergenic
903655196 1:24944605-24944627 TCCTCACACATGGAATAGGGAGG + Intronic
906560277 1:46751516-46751538 TTTCAACACATGAATTTGGGAGG + Intergenic
908970010 1:69816392-69816414 TTTCAACACATGAACTTGGGAGG + Intronic
909428305 1:75553959-75553981 TGCTCCCCCATGAAACTGGGCGG + Intronic
911062123 1:93757684-93757706 TGTACACCCAAGAGATTGGGAGG - Intronic
912033943 1:105287081-105287103 TGTTCCAACTTGAAATTTGGAGG - Intergenic
912406004 1:109438167-109438189 TTTTAATACATGAAATTTGGAGG + Intergenic
913124055 1:115769017-115769039 TGTACACGCATGAAATAAGGAGG + Intergenic
916234801 1:162575966-162575988 TGTTAAAACATAAAATTGGCTGG - Intronic
917832528 1:178908158-178908180 TGTTCTCACTTGTAAGTGGGAGG - Intronic
918971230 1:191422104-191422126 TTTTCATGAATGAAATTGGGAGG - Intergenic
919138494 1:193540628-193540650 TTTCAACACATGAATTTGGGGGG - Intergenic
919350175 1:196441730-196441752 TGTATACAAATGAAAGTGGGAGG + Intronic
919359619 1:196575719-196575741 GGTTCACACCTGTACTTGGGAGG + Intronic
920149666 1:203894733-203894755 TGTTCAAACCAGAAATTGAGAGG + Intergenic
923130602 1:231071551-231071573 TGTTGACACATGGCATGGGGTGG - Intergenic
923891107 1:238215659-238215681 TGTTCATAAAAGAAATGGGGAGG + Intergenic
924413670 1:243834424-243834446 TGTTCTCACGTGTAAATGGGAGG + Intronic
1063185666 10:3648884-3648906 TGTTCACACATGTATGTGTGTGG - Intergenic
1063786863 10:9394510-9394532 TTTCCACACAGGAATTTGGGAGG + Intergenic
1065146576 10:22774749-22774771 TGGTCAAACATGAATTTGGAGGG - Intergenic
1071493190 10:86150658-86150680 TTTTAACACATGAATTTTGGGGG - Intronic
1073001176 10:100287123-100287145 TGTTAACTCAGGACATTGGGAGG - Intergenic
1073312762 10:102555997-102556019 TGTTCTCACGTGCAAATGGGTGG - Intronic
1075222366 10:120596216-120596238 TTTTGACATATGAATTTGGGAGG + Intergenic
1075286257 10:121189090-121189112 GGTTCTCACATGAAAGAGGGAGG + Intergenic
1075825395 10:125352995-125353017 TTCTAACACATGAACTTGGGAGG + Intergenic
1076762936 10:132614685-132614707 TGTTAACACAGGAATGTGGGAGG - Intronic
1078314738 11:10284877-10284899 GGCTCACACCTGTAATTGGGAGG - Intronic
1080861556 11:36154473-36154495 TGTGGTCACATGAATTTGGGAGG + Intronic
1081114159 11:39177453-39177475 TTTTCACATATGAATTTTGGGGG - Intergenic
1081445552 11:43128624-43128646 TTTTAACACATGAATTTTGGAGG - Intergenic
1082896879 11:58201165-58201187 TTTTAACACATGAATTTTGGGGG + Intergenic
1085182746 11:74549588-74549610 TGTTCTGAAATGAAATTGGCTGG - Intronic
1085226214 11:74923475-74923497 TGTTCACACATGAGTATGAGGGG - Intronic
1088519877 11:110684842-110684864 TGTTCTCACATATAAGTGGGAGG + Intronic
1089718155 11:120383918-120383940 TGTTGAGACATGAAATTAGTTGG + Intronic
1090171519 11:124610274-124610296 TGTCCACACATGCAATTCTGAGG - Intergenic
1090474738 11:127009628-127009650 TTTCAACACATGCAATTGGGGGG + Intergenic
1090705708 11:129334478-129334500 TTTCCACACATGAACTTTGGGGG - Intergenic
1090949178 11:131457724-131457746 TTTTAACACATAAATTTGGGGGG - Intronic
1090956812 11:131520529-131520551 TGTTCATAAATCAAATTGCGTGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1091941055 12:4482407-4482429 TGTTCACACATGCCATTAGAAGG + Intergenic
1092275351 12:7056704-7056726 TGTTCAAATTTGAAAATGGGAGG + Intronic
1094443441 12:30504467-30504489 TTTAAACACATGAATTTGGGGGG + Intergenic
1095513876 12:42984556-42984578 TGTTCTCACTTGTAAGTGGGAGG + Intergenic
1095627881 12:44339219-44339241 TGTTTACCCATGAAATTTGGAGG - Intronic
1098453664 12:70648638-70648660 TGGTCACACAGAAAATTAGGGGG + Intronic
1098671966 12:73242000-73242022 TATTAACATATGAATTTGGGGGG + Intergenic
1099531240 12:83784102-83784124 TGTTAATACAAGAAATTTGGGGG + Intergenic
1099717087 12:86309635-86309657 TGTCCAAACATGAATTTTGGGGG + Intronic
1100246061 12:92758023-92758045 TGTTTTCAAATGAAAGTGGGGGG - Intronic
1100813258 12:98361315-98361337 TGTTCACACATGTGGTGGGGAGG + Intergenic
1101402783 12:104402820-104402842 TTTTGACACATGAATTTGAGGGG + Intergenic
1102915393 12:116748648-116748670 TGGTCACAGCTGACATTGGGTGG - Intronic
1103265599 12:119627701-119627723 CGTTTACACATGAGATTTGGAGG + Intronic
1104100618 12:125605247-125605269 TGCTCACACATGTGAGTGGGTGG + Intronic
1104164231 12:126211364-126211386 TGATAAGAAATGAAATTGGGTGG + Intergenic
1104240426 12:126984136-126984158 TGTGAAGACATGAAATTTGGAGG - Intergenic
1105050317 12:133044016-133044038 GGCTCACACCTGTAATTGGGAGG - Intronic
1105234561 13:18536680-18536702 TTTTGACATATGAATTTGGGTGG + Intergenic
1105639408 13:22246710-22246732 TTTCAACACATGAATTTGGGGGG + Intergenic
1106426743 13:29637575-29637597 TGTTCTCACTTGTAAGTGGGAGG + Intergenic
1106619481 13:31359631-31359653 TGTTCTCACTTGTAAGTGGGAGG - Intergenic
1106912559 13:34478603-34478625 TGTTTACCCATCAAATTGGCAGG - Intergenic
1108241971 13:48474380-48474402 TTATCACACATGAAATTCGAAGG + Intronic
1109332716 13:60949881-60949903 TTCTAACACATGAAATTTGGAGG - Intergenic
1109894387 13:68664892-68664914 TTTCCACACATGAATTTAGGGGG + Intergenic
1110718041 13:78730307-78730329 TGTTGACATATGAAATTTAGGGG + Intergenic
1110743102 13:79019930-79019952 AGATCACACATGAGATTGGATGG - Intergenic
1114171491 14:20277290-20277312 TTTTAACATATGAAATTCGGTGG + Intronic
1114354602 14:21893446-21893468 TGTTAACTCAGAAAATTGGGAGG - Intergenic
1116302150 14:43196549-43196571 TGTTCTCACTTGTAAGTGGGAGG + Intergenic
1116924785 14:50623334-50623356 TGTACACACATGCAATGAGGTGG + Intronic
1117472732 14:56062729-56062751 TTTTAACACATGAACTTTGGGGG + Intergenic
1118397718 14:65351785-65351807 TTCTAACACATGAAATTTGGGGG - Intergenic
1119444888 14:74654859-74654881 TGAACACCCATGAAATTGGTTGG - Intronic
1119993032 14:79220974-79220996 TGTTCTCACTTGTAAGTGGGAGG - Intronic
1124695719 15:31862766-31862788 TGTGAAGACATGAAATTTGGAGG - Intronic
1125354813 15:38805815-38805837 TTGTCACACATCAAATTGGTTGG - Intergenic
1126411957 15:48381185-48381207 TGTTCACATATGAATTTATGTGG - Intergenic
1127875011 15:63104539-63104561 TTTTAACACAGGAATTTGGGAGG - Intergenic
1127955314 15:63847928-63847950 TGTGAAGACATGAAATTTGGAGG + Intergenic
1128720901 15:69947611-69947633 TGTGCTCACATGAATGTGGGTGG + Intergenic
1128763606 15:70236652-70236674 TTCTCACACATGAAGTGGGGAGG + Intergenic
1128946596 15:71827121-71827143 TGTTCACACATGAAATTGGGTGG + Intronic
1130754224 15:86745645-86745667 TCTTCACAGATAAAATCGGGAGG - Intronic
1133257391 16:4525592-4525614 TGGTCCCACATGGACTTGGGTGG - Intronic
1134297119 16:12956642-12956664 TGTTCTCACTTGTAAGTGGGAGG + Intronic
1134331866 16:13258921-13258943 TGTGAAGACATGAGATTGGGAGG - Intergenic
1136987678 16:35125805-35125827 GGCTCACACATGGCATTGGGTGG - Intergenic
1137857156 16:51806442-51806464 TCTTCACTCTTGAAATTGGGAGG + Intergenic
1138305316 16:55969222-55969244 TTTTTACACATGAAATTGGCTGG - Intergenic
1139213071 16:65100116-65100138 TGATCACACATTAACTTTGGAGG - Intronic
1140356259 16:74309527-74309549 GGCTCACACCTGTAATTGGGAGG + Intergenic
1140451076 16:75071354-75071376 GGTTCACACCCGTAATTGGGAGG - Intronic
1141773360 16:86105102-86105124 TGTTCACCCCTGAAACTGGGAGG + Intergenic
1143632816 17:8148566-8148588 TGGCCAGACATGAATTTGGGAGG - Intronic
1144845212 17:18214189-18214211 TGTGCACACCTGAGGTTGGGAGG - Intergenic
1145036385 17:19543607-19543629 TGTCCAAACTTAAAATTGGGAGG + Intronic
1145799737 17:27675275-27675297 TATTCAGAAATGAAATTGGATGG + Intergenic
1145830164 17:27909650-27909672 GGCTCACACTTGTAATTGGGAGG + Intergenic
1149237193 17:54606291-54606313 TTTTCAGAGATGAAATTGGGAGG - Intergenic
1150898367 17:69239960-69239982 TATTTATACATGACATTGGGTGG + Intronic
1150907943 17:69358725-69358747 TTTCAACACATGAATTTGGGGGG - Intergenic
1152532382 17:80926357-80926379 TCTTCTCACATGAACCTGGGTGG + Intronic
1152941925 17:83177327-83177349 TTTCAACACATGAATTTGGGGGG - Intergenic
1154514981 18:15153178-15153200 TTTTGACATATGAATTTGGGTGG - Intergenic
1155751907 18:29434511-29434533 TGTTTTCACCTAAAATTGGGTGG + Intergenic
1156856550 18:41788950-41788972 TGGTCAGACATGGAAATGGGGGG - Intergenic
1157645027 18:49259709-49259731 TGTTTACACATGAAATTATACGG + Intronic
1158898773 18:61941170-61941192 TGTTTCAACATGAAATTTGGAGG + Intergenic
1159082973 18:63756140-63756162 TGTTTACACATGAACTTTTGAGG + Intronic
1159109648 18:64042111-64042133 TTTTAACATATGAAATTGGTGGG + Intergenic
1160451695 18:78970794-78970816 TGTTCTCACTTGTAAGTGGGAGG - Intergenic
1161181660 19:2887294-2887316 TGTTCACACATAAAACAGGACGG + Intergenic
1165590528 19:36965677-36965699 TGATCACACACAAAACTGGGGGG - Intronic
1166713898 19:44954515-44954537 TGTTCACCCGTGAAATTGGGTGG - Intergenic
1167120986 19:47516358-47516380 TGCTCACACACAAAATTAGGGGG + Intergenic
925575579 2:5356787-5356809 TTTCAACACATGAATTTGGGTGG + Intergenic
925647440 2:6051074-6051096 TGTTCTCACTTGTAAGTGGGAGG + Intergenic
925716168 2:6786226-6786248 TGTTCACACATGGGCTTTGGAGG - Intergenic
926509568 2:13757846-13757868 TTTTAACACATGATTTTGGGGGG + Intergenic
927245337 2:20952917-20952939 GGCTCACACATGAAATTGTCTGG + Intergenic
928354333 2:30595867-30595889 TGTTCTCACTTGTAAGTGGGAGG - Intronic
930032519 2:47067162-47067184 TGCTAACACATGAATTTTGGGGG + Intronic
931724644 2:65097108-65097130 TGATGACACATGGAATTGGAAGG - Intronic
931862699 2:66373077-66373099 TATTTGCACATGAAATTTGGAGG - Intergenic
931984155 2:67725517-67725539 TGTGCACTCATGAATTTGGGAGG + Intergenic
933073737 2:77895431-77895453 TATTCACACATGAGATTATGAGG - Intergenic
934697443 2:96410179-96410201 TGTTAACACATGACATTGACAGG + Intergenic
935250809 2:101258690-101258712 GGCTCACACCTGTAATTGGGAGG + Intronic
937604689 2:123784325-123784347 TGTTCTCACTTAAAAGTGGGAGG - Intergenic
938211010 2:129465566-129465588 TGTTCCCACATGAATTTGGGAGG - Intergenic
938515246 2:131997961-131997983 TTTTGACATATGAATTTGGGTGG - Intergenic
939202021 2:139048240-139048262 TGTCCACACATGATAGAGGGAGG + Intergenic
940515297 2:154677040-154677062 TTCTAACACATGAAATTTGGAGG - Intergenic
940859652 2:158758732-158758754 TTCTAACACATGAAATTTGGGGG - Intergenic
943313829 2:186360928-186360950 TTTTAACATATGAATTTGGGGGG - Intergenic
944203923 2:197137138-197137160 TGTTCAGACATGGACTTGGTGGG - Intronic
946481443 2:220060604-220060626 TGTCAACATATGAATTTGGGGGG - Intergenic
948304352 2:236935633-236935655 TGTTCTCAGAGGAAATGGGGAGG - Intergenic
1169596704 20:7208324-7208346 TGTAAACACATGAAGTTTGGGGG - Intergenic
1170060190 20:12250740-12250762 TGTTCTCACTTGTAAGTGGGAGG - Intergenic
1170152061 20:13236480-13236502 TGTTAGGACATGAAATTTGGAGG - Intronic
1170324815 20:15145180-15145202 TATTCACAGATGACATTTGGTGG + Intronic
1170344021 20:15363235-15363257 TGGTGACACATGAAATCGTGTGG + Intronic
1172137613 20:32697808-32697830 TGGTCACACAGGAAATGGGCTGG + Intergenic
1173131813 20:40400846-40400868 TGTTCTCACTTGTAAGTGGGAGG - Intergenic
1176778549 21:13164966-13164988 TTTTGACATATGAATTTGGGTGG + Intergenic
1176891580 21:14325871-14325893 TGTTGAGATATGAAATAGGGTGG - Intergenic
1177050247 21:16224654-16224676 GCTTCAAACATGAAACTGGGCGG + Intergenic
1177976172 21:27853980-27854002 TTTTGACATATGAATTTGGGTGG + Intergenic
1178110177 21:29362607-29362629 TTCTAACACATGAATTTGGGGGG - Intronic
1178199932 21:30391760-30391782 TGATGACAGCTGAAATTGGGAGG - Intronic
1179612650 21:42562678-42562700 TGTTCACACATGACATGGGGGGG - Intronic
1181419013 22:22784809-22784831 TTTTAACACATGAATTTGAGGGG - Intronic
1184652965 22:45927455-45927477 TGAGCAGACATGAATTTGGGGGG - Intronic
1184948471 22:47821568-47821590 TTCTAACACATGAAATTTGGGGG + Intergenic
950030215 3:9847172-9847194 TGTCAACACATGAGTTTGGGGGG - Intronic
951061671 3:18215685-18215707 TTTTAACATATGAATTTGGGAGG - Intronic
951163298 3:19453119-19453141 TGTTCTCACTTATAATTGGGAGG + Intronic
951372492 3:21867305-21867327 TTTTAACACATGAATTTGGAGGG + Intronic
953751722 3:45614065-45614087 TTTTAACAGAGGAAATTGGGAGG - Intronic
955937866 3:64119976-64119998 TGTTCTCACTTGTAAGTGGGAGG + Intronic
957221054 3:77382641-77382663 TGTTCTCACTTGTAAGTGGGAGG - Intronic
957411305 3:79844505-79844527 TGTTCAGAGATGAGATTGGGAGG - Intergenic
957854807 3:85860756-85860778 TTTCCACATATGAAATTTGGAGG + Intronic
958168349 3:89906183-89906205 TTTTAACACATGAACTTTGGGGG + Intergenic
958606507 3:96364720-96364742 GGCTCACACATGACATTTGGGGG + Intergenic
958631541 3:96689704-96689726 TCTTCAGGCAAGAAATTGGGTGG + Intergenic
958939796 3:100299109-100299131 GGATCTCACATGGAATTGGGAGG - Intronic
959099093 3:101990176-101990198 TTATCACACATGAAATGGGAAGG + Intergenic
959126855 3:102300237-102300259 TTTTAACACATGAATTTTGGGGG + Intronic
960694803 3:120385669-120385691 TTCTGACACATGAAATTTGGGGG + Intergenic
961111685 3:124289275-124289297 TTTCAACACATGAAATTTGGGGG + Intronic
961612415 3:128151740-128151762 TGTCCACATATGAATTTGAGAGG + Intronic
963076985 3:141356026-141356048 TGTTCACCCATGAAACAGAGTGG - Intronic
964810576 3:160659532-160659554 TGCTAACACATGAACCTGGGGGG - Intergenic
964982033 3:162696565-162696587 TTTCAACACATGAAATTTGGGGG - Intergenic
964999056 3:162928369-162928391 TGTTTCCACATGAGATTGGAGGG + Intergenic
967521246 3:190435471-190435493 TTTGAACACATGAAATTGGGTGG + Intronic
967913610 3:194561953-194561975 TTTTCTCACATAAAATTGGAGGG + Intergenic
971151437 4:24036421-24036443 TGTTCATACATGAGCTTCGGTGG - Intergenic
973124178 4:46563341-46563363 CTTTAACATATGAAATTGGGGGG + Intergenic
973963370 4:56134427-56134449 TGTAGACACATGAAATTGCGGGG - Intergenic
974225516 4:59038254-59038276 TTTACACATATGAAATTGGCAGG - Intergenic
974981734 4:68965748-68965770 TGTTAAGACATGAGATTTGGAGG - Intergenic
976021340 4:80631872-80631894 TGTTAACATATGAATTTGGTTGG - Intronic
976371104 4:84289013-84289035 AGTGCACACCTGTAATTGGGAGG + Intergenic
976381964 4:84409459-84409481 TGGTCACACATCAAAATGTGTGG - Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
976967093 4:91056605-91056627 TTTCCACACATGAATTTGGGTGG + Intronic
977503839 4:97877758-97877780 TGTGAAGACATGAGATTGGGAGG - Intronic
978421779 4:108541305-108541327 TGTTTCAACATGAAATTTGGAGG - Intergenic
978774634 4:112493323-112493345 TGTTCTCACTTGTAAGTGGGAGG + Intergenic
979086769 4:116421708-116421730 TTTTAACACATGAAATTTGGGGG + Intergenic
979168256 4:117564520-117564542 TGTTCTCACTTAAAAATGGGAGG - Intergenic
979288314 4:118951462-118951484 TTTTGACACATGAATTTTGGAGG + Intronic
979506497 4:121503004-121503026 TGTTCACACATGTAATATGGAGG + Intergenic
979967815 4:127096673-127096695 TTTTCATCCATGAAATGGGGAGG + Intergenic
980523389 4:133959804-133959826 TGTTTATACATGAAATTGTTTGG + Intergenic
980591331 4:134893291-134893313 TGTATACACATGCATTTGGGGGG - Intergenic
980609888 4:135146108-135146130 GGTTTACAAATGAAATGGGGAGG + Intergenic
980837264 4:138211159-138211181 TGTTCTCACTTATAATTGGGAGG + Intronic
981459036 4:144990753-144990775 TGTTTCAACATGAAATTTGGAGG + Intronic
982676051 4:158376884-158376906 TTTCAACACATGAAATTTGGGGG + Intronic
984003875 4:174284637-174284659 TGTTCACACATAAAATTAAAAGG - Intronic
985173064 4:187172943-187172965 TGATCACACATGAAATTCTCCGG + Intergenic
986051312 5:4092677-4092699 TGTTCACATATTGAATTGGCAGG - Intergenic
986214448 5:5705818-5705840 TCTTAACATATGAATTTGGGAGG + Intergenic
986485884 5:8236427-8236449 TGTTCTCACATATAAGTGGGAGG - Intergenic
988147287 5:27326931-27326953 TGTTCTCACTTAAAAGTGGGAGG + Intergenic
988323713 5:29734849-29734871 TGTTCTCACTTAAAAGTGGGAGG + Intergenic
988786851 5:34573094-34573116 TTTCCACACATGAACTTTGGGGG - Intergenic
989098517 5:37803316-37803338 TTTTAACATATGAATTTGGGAGG - Intergenic
989246770 5:39263971-39263993 TTTTGACACATGAATTTTGGAGG - Intronic
992285281 5:75228876-75228898 TTTTCTCACATGTAATTGGAAGG - Intronic
993310793 5:86329815-86329837 TTTCAACACATGAAATTTGGGGG - Intergenic
993905252 5:93615858-93615880 TGGTGACCCATGAAATTTGGGGG + Intergenic
994585563 5:101704798-101704820 TGTTCTCACTTGTAAGTGGGAGG - Intergenic
995568076 5:113452330-113452352 TTTTAACATATGAATTTGGGGGG - Intronic
995748728 5:115431232-115431254 TGCTTACACATGAACTTGTGAGG - Intergenic
995924261 5:117351297-117351319 TGATAACACCTGAAATTTGGAGG - Intergenic
997976961 5:138446359-138446381 TGTTCCCACATTAAAAAGGGGGG + Exonic
998057811 5:139093977-139093999 GGTTTAAACATGAAATGGGGAGG + Intronic
999527070 5:152418542-152418564 TGTTTGCACATGAAAGTGTGAGG + Intronic
999555394 5:152736971-152736993 TATTCACAAATTAAATTGGTAGG + Intergenic
1000057839 5:157623829-157623851 TGTTAACACAAAAAGTTGGGGGG + Intergenic
1000256368 5:159542311-159542333 TTGTTACACATGAAATTTGGGGG - Intergenic
1002642522 5:180636978-180637000 TGTGCACCCAGGAAAATGGGGGG - Intronic
1002788482 6:421619-421641 TTTCAACACATGAAATTTGGGGG + Intergenic
1004416085 6:15425448-15425470 TTCTAACACATGAAATTTGGGGG - Intronic
1005498184 6:26407053-26407075 TGCTCACACATGATGTGGGGTGG + Intronic
1005748538 6:28862491-28862513 TGTTCACACATGCATGTGTGAGG + Intergenic
1007487461 6:42191370-42191392 GGTTCACACGTGAAAATGTGAGG - Intronic
1008297954 6:49801448-49801470 TGTGAGCACATGAAATTTGGAGG + Intergenic
1009409630 6:63350997-63351019 TTTCCACATATGAATTTGGGTGG - Intergenic
1009532616 6:64839943-64839965 TTTTAACACATGAATTTTGGGGG + Intronic
1010719973 6:79272078-79272100 TGTTAACATATGAATTTTGGGGG - Intergenic
1010995747 6:82530408-82530430 TGTTCTCACTTGTAAGTGGGAGG + Intergenic
1011770253 6:90667740-90667762 TGTTAACACATGAATCTTGGGGG + Intergenic
1013728934 6:113139303-113139325 TTTTCAGACATGAAATTGCTTGG + Intergenic
1013840062 6:114380695-114380717 TGTCAACATATGAATTTGGGGGG + Intergenic
1014274417 6:119370687-119370709 TGTTCAATCAGGATATTGGGGGG - Intergenic
1014766993 6:125418113-125418135 TGTTCTCACTTGTAAGTGGGAGG - Intergenic
1015182829 6:130379147-130379169 TTTTAACACATGAAGTTTGGAGG + Intronic
1015231064 6:130915335-130915357 CCTTCAAACATGAAATTGGGAGG + Intronic
1015338010 6:132063803-132063825 TGTTCTCAGATGACCTTGGGTGG - Intergenic
1016629624 6:146213284-146213306 TGTCCAGAGATGAGATTGGGTGG + Intronic
1016873812 6:148844855-148844877 TGTTCTCACCTGTAAGTGGGAGG - Intronic
1017286438 6:152681919-152681941 TGTTCACACAGAAAAATGGATGG + Intergenic
1017885726 6:158597913-158597935 AGTTTAAACATGAAATTTGGAGG + Intronic
1018481460 6:164195138-164195160 AGTTCCAACATGAAATTTGGAGG + Intergenic
1018744964 6:166754809-166754831 TGGTCAAACATGGCATTGGGAGG - Intronic
1018946080 6:168347377-168347399 TGTTTAAAGATAAAATTGGGTGG - Intergenic
1020962441 7:14822191-14822213 TATTCAAACCTGAAATTGAGAGG + Intronic
1022283153 7:28930709-28930731 TCTTCACCAATGAAATGGGGTGG + Intergenic
1022507943 7:30918452-30918474 TGTTCACACGTGGACATGGGGGG - Intronic
1023339257 7:39202025-39202047 ATTTTACACATGAAATTGTGTGG + Intronic
1024055866 7:45659568-45659590 TGTTCACACATGAGGTGGGGTGG - Intronic
1024225598 7:47324360-47324382 AGTACACAGATGAAATTGGGAGG + Intronic
1024366522 7:48526965-48526987 TATACAAAAATGAAATTGGGAGG - Intronic
1024568551 7:50705086-50705108 TGCTCACGCATGAAATGGGATGG + Intronic
1024829372 7:53431040-53431062 TGTTCTCACATAAAAGTGGGAGG + Intergenic
1025855346 7:65271562-65271584 TGTTCTCACTTATAATTGGGAGG - Intergenic
1028104241 7:86858337-86858359 TTTCAACACATGAAATTTGGAGG - Intronic
1028635478 7:92984502-92984524 TGGCCACATATGAATTTGGGAGG + Intergenic
1029001237 7:97157025-97157047 TGTTCTCACTTAAAAGTGGGAGG - Intronic
1029527397 7:101103438-101103460 GGATCACATATGAAATTGGTGGG - Intergenic
1030295500 7:107921890-107921912 TGTTCTCACTTGTAAGTGGGAGG - Intronic
1032466545 7:132149360-132149382 GGATCACACATGGAAATGGGAGG + Intronic
1032900005 7:136296455-136296477 TGTCAACACATGAAGTTAGGGGG - Intergenic
1033089265 7:138370146-138370168 TGTTCACAGATAAATTTTGGGGG + Intergenic
1035918133 8:3647283-3647305 GGCTCACACATGACATTGGGTGG - Intronic
1036049484 8:5179971-5179993 TTTCAACACATGAAATTTGGGGG - Intergenic
1037029812 8:14091057-14091079 TGTTCTCACTTGTAAGTGGGAGG - Intronic
1037498460 8:19463046-19463068 TGTTCTCACTTGTAAGTGGGAGG - Intronic
1037749666 8:21672969-21672991 TGTCCACATATGAATTTTGGGGG + Intergenic
1038468118 8:27785318-27785340 TTTTCACACATGAACTTTGGGGG + Intronic
1038882049 8:31625750-31625772 TCTTAACATATGAATTTGGGGGG - Intergenic
1039113785 8:34069508-34069530 TGTTCACTCATCAAATATGGAGG + Intergenic
1043546383 8:81320413-81320435 TTTACACACATGAAATTTGTTGG - Intergenic
1045519567 8:102892039-102892061 TGTTCTCAGATGAAAATGGGGGG + Intronic
1046250623 8:111625238-111625260 TTTCAACACATGAAATTTGGGGG + Intergenic
1047170951 8:122491805-122491827 TTTTAACACATGAATTTTGGAGG - Intergenic
1047630403 8:126700256-126700278 TGTTAGCACATGAGATTTGGAGG + Intergenic
1048492740 8:134909634-134909656 TTTTAACACATGAAATTTGGAGG + Intergenic
1050145905 9:2567348-2567370 TCTTCAAACATGAATTTTGGGGG - Intergenic
1050778561 9:9300498-9300520 TTTCAACACATGAATTTGGGGGG - Intronic
1050809122 9:9720903-9720925 TGTTCTCACTTCAAAGTGGGAGG + Intronic
1051078831 9:13272914-13272936 TGTCAACATATGAATTTGGGGGG - Intronic
1052554041 9:29990237-29990259 TGTTAATACATTGAATTGGGAGG + Intergenic
1055438573 9:76317102-76317124 GGCTCACACATGTAACTGGGAGG + Intronic
1055593481 9:77842434-77842456 AGTTCAGACATGCTATTGGGTGG + Intronic
1057816076 9:98296065-98296087 TTTCAACACATGAATTTGGGGGG - Intronic
1057974368 9:99588734-99588756 TTTCAACACATGAATTTGGGGGG - Intergenic
1058138265 9:101331185-101331207 TTTCAACACCTGAAATTGGGAGG + Intergenic
1058213194 9:102199123-102199145 TGTTCTCACATGTAAGTGGGAGG + Intergenic
1058538100 9:105983592-105983614 TGTTCACACATTAACTTGGTAGG + Intergenic
1058541295 9:106015033-106015055 TTTTGACATATGAACTTGGGGGG + Intergenic
1058573010 9:106367469-106367491 TGTTTCCACATGAATTTTGGAGG + Intergenic
1059345004 9:113622008-113622030 TGTTCAAACTTGAAACTGGGTGG - Intergenic
1061231125 9:129316427-129316449 TCATGACACATGAAATTTGGGGG + Intergenic
1062515800 9:136934893-136934915 TTTCAACACAGGAAATTGGGTGG - Intronic
1185968981 X:4640870-4640892 TGTCAACACATGAATTTCGGGGG - Intergenic
1187619039 X:21030055-21030077 TGTGAAGACATGAGATTGGGAGG - Intergenic
1187807734 X:23139439-23139461 TTTTAATACATGAATTTGGGGGG + Intergenic
1188267023 X:28089527-28089549 TGTCCCCACATGAAAATGTGAGG + Intergenic
1189731644 X:44027124-44027146 TGTTAACATATGAATTTTGGGGG - Intergenic
1190469278 X:50761257-50761279 TGTTCTCACTTGTAAGTGGGAGG - Intronic
1191766071 X:64699480-64699502 TGTTCACACTTATAAGTGGGAGG - Intergenic
1192018178 X:67354669-67354691 TTTTAGCACATGAATTTGGGAGG + Intergenic
1192330959 X:70174880-70174902 TGTCTACAAATGAAATTGGCAGG + Intergenic
1194377481 X:93153357-93153379 TATTCACATATGAAATTCTGGGG + Intergenic
1196365135 X:114915211-114915233 TCTTCACACATGAACTTTGGGGG + Intergenic
1197924976 X:131636729-131636751 TGTTAAAACATGAAATTTTGGGG + Intergenic
1198628461 X:138606517-138606539 TGTTCTCACTTGTAAGTGGGAGG - Intergenic
1199311350 X:146324703-146324725 TGCTCACATATGAATTTTGGGGG - Intergenic
1199408935 X:147496678-147496700 TTCTAACACATGAAATTTGGGGG - Intergenic
1201251539 Y:12063372-12063394 TTTTCACACAGAAAATTTGGAGG + Intergenic
1201712499 Y:17008017-17008039 TTTTCACAAATGAATTTTGGAGG - Intergenic