ID: 1128946844

View in Genome Browser
Species Human (GRCh38)
Location 15:71829562-71829584
Sequence CTATAGCCCTAGAGGGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128946844_1128946850 19 Left 1128946844 15:71829562-71829584 CCTAGCACCCTCTAGGGCTATAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1128946850 15:71829604-71829626 TTGCTGTTCCCATGGTCATATGG 0: 1
1: 0
2: 0
3: 19
4: 135
1128946844_1128946849 11 Left 1128946844 15:71829562-71829584 CCTAGCACCCTCTAGGGCTATAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1128946849 15:71829596-71829618 CCATCTAGTTGCTGTTCCCATGG 0: 1
1: 0
2: 0
3: 8
4: 147
1128946844_1128946852 27 Left 1128946844 15:71829562-71829584 CCTAGCACCCTCTAGGGCTATAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1128946852 15:71829612-71829634 CCCATGGTCATATGGATCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128946844 Original CRISPR CTATAGCCCTAGAGGGTGCT AGG (reversed) Intronic
900661779 1:3788287-3788309 CTCCAGCCCTAGAGGAAGCTGGG - Intronic
901827620 1:11872658-11872680 CTATAGCCCCAGAAGCAGCTCGG - Intergenic
901855568 1:12042236-12042258 ATACAGCCCTAGCGGGTGATAGG - Intergenic
904344020 1:29856445-29856467 CTATAGACCTAGGAGGGGCTTGG - Intergenic
909240599 1:73207719-73207741 CTGTAGTCCAAGAGTGTGCTTGG - Intergenic
917783746 1:178429231-178429253 CTGTAGTCCTAGAGGTTGTTAGG - Intronic
924164594 1:241268489-241268511 CTACTGCCCTGCAGGGTGCTTGG + Intronic
1063462642 10:6224254-6224276 CGATAGCCCTAGTGGGTGATGGG + Intronic
1068031395 10:51709605-51709627 CCATAGCCCTTGAGGGGTCTAGG + Intronic
1071276460 10:84059934-84059956 CTCGAGCCCTCTAGGGTGCTGGG - Intergenic
1077802207 11:5551186-5551208 CTATGTCCCTAGTGTGTGCTAGG + Intronic
1080789810 11:35512265-35512287 ATATATCCTTAGTGGGTGCTGGG - Intronic
1081572504 11:44300552-44300574 CTATACCCTTTGAGGGTGCTAGG - Intronic
1086450143 11:86907539-86907561 CTAGAGCCCAAGAGGCTGCAGGG - Intronic
1088029440 11:105228348-105228370 CTTGAGCCCTAGACGTTGCTAGG - Intergenic
1090511812 11:127383561-127383583 GTGTAGACCTAGAGGATGCTTGG + Intergenic
1093741883 12:22698608-22698630 CCAGAGCCCAAGAGGGTTCTTGG + Intergenic
1097277571 12:57823785-57823807 CCAGAGCCCTAGAGGGTGGCTGG + Intronic
1106755808 13:32821726-32821748 CTGGAGCCCTTGAGGGAGCTTGG + Intergenic
1112785573 13:102947778-102947800 CTATAGGGCTGGAGGGTCCTGGG + Intergenic
1114989336 14:28267753-28267775 CTGTGGCCCAAGAGTGTGCTTGG - Intergenic
1116232706 14:42237513-42237535 CTATAGTCCAAGAGTGTGATTGG + Intergenic
1117389325 14:55247999-55248021 CTGTGGCCATAGAGGGTGGTAGG + Intergenic
1119662700 14:76462995-76463017 CCCAAGCCCTTGAGGGTGCTAGG - Intronic
1119772282 14:77227716-77227738 CTGTAGCACTAGAGGTTTCTGGG - Intronic
1122006797 14:98711959-98711981 CTAGGGCCCAAGAGGGTGCCGGG - Intronic
1128613936 15:69094797-69094819 CTGAAGCCCTGGAGGGTGCCTGG + Intergenic
1128946844 15:71829562-71829584 CTATAGCCCTAGAGGGTGCTAGG - Intronic
1130562141 15:84967164-84967186 CTAAAGCCTTGGAGGATGCTGGG + Intergenic
1137768577 16:50996565-50996587 TCATAGCCCTGGAGGGTTCTTGG - Intergenic
1138618525 16:58192570-58192592 CTATAGCCCTCGAGGACTCTTGG + Intronic
1139112244 16:63905103-63905125 CTAGAGCCCTGGAAGGTCCTGGG + Intergenic
1139851441 16:69953176-69953198 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139880418 16:70176088-70176110 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1140372092 16:74419429-74419451 CTAGAGGCCCGGAGGGTGCTCGG + Intronic
1146649594 17:34598464-34598486 TTCCAGTCCTAGAGGGTGCTGGG - Intronic
1148244278 17:46020396-46020418 CTGAAACCCCAGAGGGTGCTTGG - Intronic
1156072103 18:33224560-33224582 CCATAGTCTTAGAGGGTACTTGG - Intronic
1161684658 19:5696816-5696838 CTGTGGCCCTGGAGGGTGCATGG - Intronic
936003676 2:108862044-108862066 CTATGGCCCAAGAGGATTCTTGG + Intronic
940089233 2:149897306-149897328 CTATAGCCTGAGAGGGGCCTGGG - Intergenic
947869021 2:233422160-233422182 GTATTGCCGTAGTGGGTGCTGGG + Intronic
1170397373 20:15941777-15941799 CTAAAGCCCAAGAAGATGCTTGG - Intronic
1172966362 20:38838345-38838367 TTCTGGCCCAAGAGGGTGCTGGG + Intronic
1174384021 20:50176082-50176104 CACCAGCCCTAGAGGGTGCAAGG + Intergenic
1174410447 20:50331599-50331621 CCAGAGCCCTAGAGTGTGATGGG + Intergenic
1178474103 21:32921252-32921274 CTAGAGCCCTTGAAGGTGCCTGG - Intergenic
1179261803 21:39764302-39764324 TTATAGCCCTAAAGGTTTCTGGG - Intronic
952234510 3:31464792-31464814 CTCTGGCCCTGGAAGGTGCTAGG + Intergenic
957915209 3:86680009-86680031 CTGTAGTCCAAGAGTGTGCTTGG + Intergenic
966035044 3:175401551-175401573 CTATAGCCCTGGTGTGTGTTAGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
972268563 4:37486375-37486397 ATATTTCCCTAAAGGGTGCTTGG - Intronic
974062017 4:57043861-57043883 CCATAGCCCTAGAGGAAGCCCGG - Intronic
978291487 4:107146720-107146742 CTATAGCCATAGTGGGTGGCTGG + Intronic
982095474 4:151918212-151918234 CAACAGCCCTAGAGGGGTCTGGG - Intergenic
985881636 5:2642843-2642865 ACACAGCCCTCGAGGGTGCTGGG + Intergenic
988413558 5:30916838-30916860 ATATATCCCTAGAGGGTGGCAGG + Intergenic
990377554 5:55186971-55186993 ATGTAGCCCTAGAGAGTTCTAGG + Intergenic
992391251 5:76332797-76332819 CTAAAGCCCTAAAGAATGCTTGG + Intronic
993451447 5:88075660-88075682 CTGTGGCCCGAGAGTGTGCTTGG - Intergenic
996110392 5:119559160-119559182 CTGTAGTCTGAGAGGGTGCTTGG - Intronic
1002351360 5:178585699-178585721 CTACAGCCCTGGATGGCGCTGGG + Intronic
1003338229 6:5195196-5195218 CTAGAGACCTGGAGGGTGCCAGG + Intronic
1007365425 6:41388552-41388574 CTAGAGCCCAGGAGGGTGTTTGG - Intergenic
1010174979 6:73017647-73017669 TTATAGCCCTGGAGGGAGCCAGG - Intronic
1017564420 6:155668762-155668784 CTAGAGTCCTAGAGGGCACTGGG + Intergenic
1022496959 7:30859389-30859411 CTAGAGCCCAGGATGGTGCTTGG + Intronic
1028068722 7:86421979-86422001 CTCTATCCCTAGAAGGTTCTTGG + Intergenic
1032965825 7:137096040-137096062 CTATAGTCCTAGAGTGTGGTTGG - Intergenic
1047197538 8:122735117-122735139 CTAGATCCCTGGAGGGTGCAAGG - Intergenic
1050677280 9:8070841-8070863 CTGTAGTCCAAGAGTGTGCTTGG + Intergenic
1053060996 9:35031543-35031565 ATATAGCCCTTTTGGGTGCTTGG - Intergenic
1055207361 9:73749014-73749036 CTTTGGCCCAAGAGTGTGCTTGG + Intergenic
1062131832 9:134899904-134899926 ATCCAGCACTAGAGGGTGCTGGG - Intergenic
1187325291 X:18281145-18281167 CTGTGGCCCAAGAGTGTGCTTGG - Intronic
1190984814 X:55490647-55490669 TTATAGCGCTAGATTGTGCTGGG + Intergenic
1191089912 X:56608898-56608920 CTATGGCCTTAGAGGGTGTAAGG - Intergenic
1191763284 X:64667149-64667171 CTGTAGCCCTAGTGTGTGGTTGG - Intergenic
1192142584 X:68658622-68658644 CTCAGGCCCTAGAGGCTGCTGGG - Intronic