ID: 1128947098

View in Genome Browser
Species Human (GRCh38)
Location 15:71832577-71832599
Sequence CTGTATATAACAATCAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128947098_1128947100 0 Left 1128947098 15:71832577-71832599 CCAAGCTTGATTGTTATATACAG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1128947100 15:71832600-71832622 AAAATAATTTTCAGGAATGAAGG 0: 1
1: 1
2: 31
3: 259
4: 1444
1128947098_1128947099 -8 Left 1128947098 15:71832577-71832599 CCAAGCTTGATTGTTATATACAG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1128947099 15:71832592-71832614 ATATACAGAAAATAATTTTCAGG 0: 1
1: 0
2: 8
3: 152
4: 1184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128947098 Original CRISPR CTGTATATAACAATCAAGCT TGG (reversed) Intronic
901499851 1:9645314-9645336 CTAAATTTAACATTCAAGCTGGG - Intergenic
907452601 1:54556041-54556063 CTGTATAAAAAAATCAGGCCAGG - Intronic
908375772 1:63538882-63538904 CTGTATATTACACTGAAGTTTGG + Intronic
912328028 1:108787263-108787285 GTGTATATAAAAATCCAGCTAGG - Intronic
919202696 1:194377831-194377853 CTGTATGTAACCAACCAGCTGGG - Intergenic
919524821 1:198634288-198634310 CTGTCCATACAAATCAAGCTGGG - Intergenic
921021902 1:211243443-211243465 CTTTATATAGCATTTAAGCTAGG - Intergenic
921895507 1:220395641-220395663 CTGTAGATAAAAATAAAGCAGGG - Intergenic
923308028 1:232706307-232706329 CTGGAAAAAACAATGAAGCTCGG + Intergenic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1070683494 10:78465341-78465363 CTGTAAATAACACACAAGCAGGG + Intergenic
1073495669 10:103888847-103888869 CTGTACATAAGATTCAACCTTGG - Intronic
1077165318 11:1132326-1132348 CTGTATATACCATCCAACCTGGG + Intergenic
1079145122 11:17844336-17844358 CTTTTTATAAAAATAAAGCTTGG + Intronic
1079546658 11:21641585-21641607 CTTTATGTAACAATTAAGATTGG + Intergenic
1085838379 11:79981101-79981123 CTGTGAATAACAATGAAGCCTGG + Intergenic
1085877628 11:80427789-80427811 CTGTATATAAAACTCAAATTTGG + Intergenic
1088212551 11:107472784-107472806 CTATATATAACAAATTAGCTAGG + Intergenic
1095150555 12:38790174-38790196 CTGTTTACAACAGTCAAGATTGG + Intronic
1097251497 12:57635187-57635209 CTGTATAAAAGAAACAGGCTGGG + Intergenic
1097764110 12:63503979-63504001 CTAAATATAAAATTCAAGCTTGG + Intergenic
1110044002 13:70805728-70805750 CTGGATATAAAAATCTAGGTTGG + Intergenic
1110230851 13:73165788-73165810 CTGTATCTAAAAATAAGGCTAGG - Intergenic
1115600261 14:34949190-34949212 TTGTAAATAAGAATCTAGCTGGG - Intergenic
1116200879 14:41793662-41793684 CTGTATATAATAGTGATGCTTGG - Intronic
1120181725 14:81350263-81350285 CAGTGTATAATAATCAAGTTAGG - Intronic
1121057594 14:90872522-90872544 CTGTTTATATCAAACTAGCTAGG + Intronic
1124659749 15:31537622-31537644 GTGTTTATAACAACCAGGCTGGG + Intronic
1127998016 15:64165653-64165675 TTGTAATTAACAATCTAGCTAGG - Exonic
1128947098 15:71832577-71832599 CTGTATATAACAATCAAGCTTGG - Intronic
1132439677 15:101847740-101847762 CTGTGGATAACAATTAAGCAAGG - Intergenic
1134420119 16:14079050-14079072 CTGTATTTAACAAACAAGCCTGG - Intronic
1135101152 16:19607172-19607194 ATGTATGTCAAAATCAAGCTTGG + Intronic
1137968107 16:52956809-52956831 CTGTATATAAAATTCTAGGTTGG - Intergenic
1142424936 16:89997092-89997114 TTGTATTTAAAAATCAAGATAGG - Intergenic
1150749275 17:67845036-67845058 ATGTAAAAAACAATCAGGCTGGG - Intronic
1153497688 18:5716922-5716944 CTGTATATAACAACCTTGCCTGG - Intergenic
1153817153 18:8800450-8800472 CTGCATATACCGATCAACCTTGG + Intronic
1159233684 18:65642860-65642882 CTGTATATAACAGAAAACCTAGG - Intergenic
1165701894 19:37944591-37944613 CTGTACTTAACAAACATGCTAGG - Intronic
1167626351 19:50592263-50592285 CTCTCTATAAAAAGCAAGCTAGG - Intergenic
1167957889 19:53082507-53082529 CTCTACAAAAAAATCAAGCTGGG + Intronic
927044825 2:19266513-19266535 CTGTGTATAATTCTCAAGCTAGG - Intergenic
929433991 2:41913238-41913260 GTGCCTATGACAATCAAGCTGGG - Intergenic
931837563 2:66114814-66114836 GTGAAGATAACAATCAAGGTGGG - Intergenic
932107767 2:68962474-68962496 ATGTATAAAAAAATCAGGCTGGG - Intergenic
932169612 2:69541756-69541778 CTGCATTTAACAAGCATGCTAGG + Intronic
933681968 2:85109941-85109963 CTGGATATAAAAATCAACATGGG - Intergenic
933707823 2:85304810-85304832 CTGTATATCACACTGAAGCTAGG + Intronic
935535792 2:104293069-104293091 CTGTATATAGAATTCAAGGTTGG + Intergenic
936024663 2:109022066-109022088 CCAGATATAACAAGCAAGCTGGG - Intergenic
939691243 2:145264223-145264245 CTGTATATAAATATCAAACCTGG + Intergenic
940278119 2:151960959-151960981 CTGTATTTAAAAATCAACTTTGG - Intronic
943148084 2:184071515-184071537 CTCAATATAAAGATCAAGCTTGG - Intergenic
944087708 2:195868751-195868773 CTGTATTTAACAAGCAAACCAGG + Intronic
945039974 2:205735618-205735640 GTGTAGATAACAACCAAACTGGG + Intronic
947487891 2:230569294-230569316 CTGTAGATAACAATCATGAATGG + Intergenic
1170833655 20:19864922-19864944 CTTTCTATAGCATTCAAGCTAGG + Intergenic
1177909875 21:27017863-27017885 CTGTATCTCACCAACAAGCTTGG + Intergenic
1177935205 21:27336648-27336670 CTTTATATAAAAATCAACCCAGG + Intergenic
949490109 3:4580932-4580954 CTGTAAATACCAATCACGTTAGG + Intronic
950068088 3:10129656-10129678 CTGTCTTTAAAAATTAAGCTTGG + Intergenic
951649872 3:24939473-24939495 TTGTATATTACAATAAAGCCAGG + Intergenic
954396862 3:50297673-50297695 CTGTAGATAACAGCCATGCTGGG + Intronic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
959171164 3:102846240-102846262 CTAAAGATAACAGTCAAGCTGGG + Intergenic
959305599 3:104661695-104661717 CTCTCTATAACTAACAAGCTGGG - Intergenic
960630281 3:119723530-119723552 CTGTATATATCAGTACAGCTAGG + Intronic
960917620 3:122712909-122712931 CTTTATATAACAAGCAATTTTGG + Intronic
961072933 3:123953202-123953224 CTGTATATACCAAAAAAGCAAGG + Intronic
964742351 3:159980074-159980096 CTGTATAAAACAATAAAAATGGG + Intergenic
965627180 3:170693006-170693028 ATTTATATATCAATCAAGATAGG + Intronic
967184939 3:186936636-186936658 CTGATTATAAAAATAAAGCTAGG + Intronic
971244470 4:24915599-24915621 CGGTATTTAAAAATAAAGCTGGG + Intronic
973028711 4:45308403-45308425 CTGAATATATAAATCAAGTTGGG + Intergenic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977536074 4:98258553-98258575 CTGCATATAACAATCAGTATTGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978087949 4:104677607-104677629 CTGTATGTAACACTCAGGATAGG + Intergenic
980179838 4:129390117-129390139 CTGTAAATACCAATCAATATTGG + Intergenic
980555919 4:134404600-134404622 ATGTATATAAAAATATAGCTGGG - Intergenic
980607777 4:135114769-135114791 CTGTATATCACAATAATGATGGG - Intergenic
981352015 4:143742178-143742200 TTGTATATAAAAACTAAGCTTGG - Intergenic
981597867 4:146447402-146447424 CTATATTTTAAAATCAAGCTGGG - Intronic
981862365 4:149372172-149372194 ATGTAGGTAACAGTCAAGCTTGG - Intergenic
982473293 4:155820129-155820151 GTGTAGAAAAAAATCAAGCTTGG - Intergenic
984557808 4:181236144-181236166 CTGTATATTTCTATCAAGGTGGG - Intergenic
991568214 5:68027245-68027267 CTGTATTTAAAAAGCAAGATTGG - Intergenic
993247596 5:85470417-85470439 CTGGATATAAAATTCTAGCTTGG - Intergenic
993487370 5:88503302-88503324 CTCTAAAAAACAATCAAGCAAGG + Intergenic
993814532 5:92525267-92525289 CTTTTTAAAAGAATCAAGCTTGG + Intergenic
994332216 5:98520036-98520058 CTGTTTTTAACAAACATGCTAGG + Intergenic
1000936727 5:167310735-167310757 TTGTATGTAACAACCAAGCCTGG - Intronic
1003680841 6:8253685-8253707 ATGTATATGAAAATCAGGCTGGG + Intergenic
1005979054 6:30822255-30822277 CTGTGTATAAAAAGCCAGCTAGG - Intergenic
1009569915 6:65371393-65371415 CTGTATATAACATTTTAGATTGG + Intronic
1010989578 6:82465306-82465328 CTGTATCTAAAAACCAATCTTGG + Intergenic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1014709976 6:124795536-124795558 CTATAAATATCAATCAAACTGGG - Intronic
1015577472 6:134688392-134688414 CAGTATATAACAATCGAGTAAGG - Intergenic
1015989308 6:138919751-138919773 CTGTGAATAAAAATAAAGCTGGG - Intronic
1017078874 6:150647260-150647282 CTGCATATAAAAAGCAAGATTGG + Intronic
1017339186 6:153300763-153300785 CTGTAAATAACAATAAAGTTTGG - Intergenic
1021022722 7:15623666-15623688 CTTAAATTAACAATCAAGCTGGG - Intronic
1024292150 7:47812419-47812441 CTGTTTGGAACAAACAAGCTGGG + Intronic
1027691908 7:81358184-81358206 TTTTATCTAACAAACAAGCTAGG + Intergenic
1037523682 8:19704103-19704125 ATGTAATTAACCATCAAGCTTGG - Intronic
1040650222 8:49439968-49439990 CTGTATCTAGAAATCAATCTTGG - Intergenic
1043752991 8:83964198-83964220 CTGTATAAAACATTCATGCATGG + Intergenic
1044047420 8:87453955-87453977 TTGTAGATAACACTCTAGCTTGG + Intronic
1045605742 8:103772588-103772610 CTGTATATATAAATCAAATTGGG - Intronic
1046344746 8:112908239-112908261 CTGTATTTAATATTCAATCTGGG + Intronic
1046737696 8:117794568-117794590 CTCTATAAAACAATCTATCTTGG + Exonic
1046759706 8:118008545-118008567 CTGTATATAAAATGCAGGCTGGG - Intronic
1046970371 8:120216453-120216475 TTGTATATAACAATGCAGATGGG + Exonic
1047677292 8:127216779-127216801 CAGTAGATAGCAACCAAGCTGGG + Intergenic
1051985356 9:23078882-23078904 CTGTATATTACAAACAAAATTGG + Intergenic
1055225889 9:73994777-73994799 CTGCAAATAAAAATCAAGATTGG - Intergenic
1186713549 X:12226482-12226504 CTAAATATAAAAATCAAGATCGG + Intronic
1187724760 X:22190896-22190918 CTGTATGTAAGAAAGAAGCTTGG + Intronic
1188246431 X:27840820-27840842 CTGTACTTAACAATCATGCCTGG - Intergenic
1195118778 X:101728140-101728162 CTGTATATAACAATAATTTTTGG + Intergenic
1196138787 X:112238380-112238402 CTGTATATATCAATCATCATGGG - Intergenic
1198989687 X:142497482-142497504 CAATATATAATAATCAAACTAGG - Intergenic