ID: 1128952424

View in Genome Browser
Species Human (GRCh38)
Location 15:71900142-71900164
Sequence ATAAGTTTTCTGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2013
Summary {0: 1, 1: 3, 2: 37, 3: 320, 4: 1652}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128952424 Original CRISPR ATAAGTTTTCTGGCCAGGTG CGG Intronic
Too many off-targets to display for this crispr