ID: 1128955108

View in Genome Browser
Species Human (GRCh38)
Location 15:71932616-71932638
Sequence AACCCCTTCCAGAAATTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128955107_1128955108 9 Left 1128955107 15:71932584-71932606 CCTCAAACAATGGCTAGAGAAGT 0: 1
1: 0
2: 0
3: 17
4: 260
Right 1128955108 15:71932616-71932638 AACCCCTTCCAGAAATTAACTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1128955105_1128955108 15 Left 1128955105 15:71932578-71932600 CCCAATCCTCAAACAATGGCTAG 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1128955108 15:71932616-71932638 AACCCCTTCCAGAAATTAACTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1128955106_1128955108 14 Left 1128955106 15:71932579-71932601 CCAATCCTCAAACAATGGCTAGA 0: 1
1: 0
2: 3
3: 23
4: 182
Right 1128955108 15:71932616-71932638 AACCCCTTCCAGAAATTAACTGG 0: 1
1: 0
2: 1
3: 12
4: 131
1128955103_1128955108 27 Left 1128955103 15:71932566-71932588 CCTAGAGAGGAGCCCAATCCTCA 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1128955108 15:71932616-71932638 AACCCCTTCCAGAAATTAACTGG 0: 1
1: 0
2: 1
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128955108 Original CRISPR AACCCCTTCCAGAAATTAAC TGG Intronic
900787760 1:4659439-4659461 GACCCCTTCCAGGAATTCAAAGG + Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
905410963 1:37767544-37767566 AACCCCTTCCATTAGTTAACTGG - Intergenic
907843453 1:58179645-58179667 ACCACCTTACAGAAATTAAAAGG - Intronic
909355171 1:74700402-74700424 AACTCCTTCCATAAATTCACTGG + Intergenic
909918080 1:81345479-81345501 AATCCCTTCCTCAAAGTAACTGG + Intronic
912056763 1:105609850-105609872 AAACTCTTCCAGTAATAAACTGG + Intergenic
912749409 1:112273325-112273347 CAGACCCTCCAGAAATTAACAGG + Intergenic
914732491 1:150384077-150384099 CACCCCTTCCAGAAACTCATAGG - Intronic
916205241 1:162310167-162310189 GACCCCTTCCAGAGTCTAACGGG - Intronic
917694616 1:177509099-177509121 AGCCCCTTCCAGAAGGTAGCTGG - Intergenic
918274052 1:182933869-182933891 AAACTCTTCCAGAAAATAAAAGG - Intronic
920404314 1:205697519-205697541 AACGCCTTCCAGAAAGTGCCTGG - Intergenic
923378514 1:233391105-233391127 TACCCCTGCCTGAAATTAATTGG - Intergenic
1065430451 10:25649480-25649502 AACCCCTTCCAGAGACCAAATGG + Intergenic
1065818141 10:29500442-29500464 AGCCCCTTCCAGAAACCAGCAGG - Intronic
1067361059 10:45579458-45579480 AACCCCTCCAAAAGATTAACAGG + Intronic
1068920101 10:62474330-62474352 AACTCCATCCAGAAATCAAAAGG - Intronic
1069033395 10:63622478-63622500 GAGTCCTTCCAGAAATTAAGAGG - Exonic
1071183252 10:83011594-83011616 AAGCTCTTCCAGAAATTCCCAGG + Intergenic
1071224304 10:83509818-83509840 ACCCCATTCCAGAAGTTAAGGGG - Intergenic
1071353463 10:84769426-84769448 ACCCCCTTCCAGAAATGCAGTGG - Intergenic
1076928390 10:133507782-133507804 AACCCCTTCCAGGGAGAAACTGG - Intergenic
1078791848 11:14551420-14551442 CACCCCTTCCATCAAATAACAGG - Intronic
1079159566 11:17979309-17979331 CACTGCTTGCAGAAATTAACTGG + Intronic
1082103887 11:48198549-48198571 AACCCCTTCCAGAGAGAAACAGG + Intergenic
1082804718 11:57440445-57440467 AACCCGATACAAAAATTAACTGG - Intergenic
1084886085 11:72207845-72207867 AACCCCTTCCAAAGAGAAACAGG - Intergenic
1087292595 11:96336390-96336412 AACCACTTCAATAAAGTAACAGG - Intronic
1088743302 11:112784581-112784603 AAGCCATTCGAGAAGTTAACGGG - Intergenic
1088802312 11:113317376-113317398 ACCACCATCCAGAAATTTACAGG + Intronic
1092315681 12:7411139-7411161 AATACCTTCCAGACATTAAAAGG + Intronic
1092666712 12:10808650-10808672 AAACCCTTCCAGAAATGGAGAGG + Intergenic
1093963492 12:25301376-25301398 AACCCCTTCCTGATATGAAGAGG + Intergenic
1095264117 12:40133476-40133498 TACCCCTACCAGAAAGTAAGAGG - Intergenic
1097524254 12:60710698-60710720 AATCCCTTCCAGATAGAAACAGG + Intergenic
1098695572 12:73549988-73550010 CACCCCTTTCAGAAATACACAGG + Intergenic
1099902710 12:88732317-88732339 AACACCTTCCATAAATAAATTGG - Intergenic
1100453691 12:94731677-94731699 CACCACTTCCAGCTATTAACAGG + Intergenic
1101418366 12:104528349-104528371 AAGCCCTGCCAGAAATGATCTGG - Intronic
1102540010 12:113611781-113611803 AACCACTTTCAGTGATTAACAGG - Intergenic
1107258100 13:38455318-38455340 CACCCCTTCCACAAAATAGCAGG - Intergenic
1112571956 13:100601324-100601346 AACCCCCTACAAAAATCAACTGG - Intergenic
1112961038 13:105126639-105126661 AACCATTTCCAAAAATTAAATGG - Intergenic
1115287633 14:31733368-31733390 AAATCCTAGCAGAAATTAACAGG - Intronic
1117553685 14:56862451-56862473 AACCCCATCCAAAAATAAAGTGG - Intergenic
1119020651 14:71109462-71109484 GATCCCTTCCAGAATTTGACTGG - Exonic
1119718859 14:76877655-76877677 AACCCCTTCTAGAAATTAGTAGG + Intergenic
1120048065 14:79831010-79831032 AACACGTTCCTGAAATGAACTGG - Intronic
1122050209 14:99053716-99053738 CACCACTTCCAGGCATTAACTGG + Intergenic
1123724560 15:23089137-23089159 AAGCATTTCCAGCAATTAACAGG - Intergenic
1127652831 15:61025445-61025467 AACAGCTCCCAGAAAATAACAGG - Intronic
1128955108 15:71932616-71932638 AACCCCTTCCAGAAATTAACTGG + Intronic
1130514195 15:84613480-84613502 AACCCCATACAAAAATTAGCTGG - Intronic
1132168477 15:99621786-99621808 AACTCCTTTAAGAAATAAACAGG - Intronic
1135837920 16:25844443-25844465 AACCACTAGCAGAAATTAAAAGG - Intronic
1137354700 16:47749687-47749709 ACCCCCTTCCAGGAAATCACTGG - Intergenic
1141978482 16:87534398-87534420 ACCCCCTTCCAGTCATTGACAGG + Intergenic
1155600520 18:27540719-27540741 AATCTTTTCCAGAAATTTACAGG - Intergenic
1156617336 18:38802848-38802870 AATCCCTTTCAGAAATTATGAGG - Intergenic
1159670441 18:71214696-71214718 AACCCCTTCAACCAATTATCAGG - Intergenic
1164877494 19:31701740-31701762 AACACATTCCAAAACTTAACAGG + Intergenic
1166057715 19:40303064-40303086 AACCCCATACAAAAATTAGCCGG + Intergenic
1166426808 19:42686276-42686298 AATACCATCCGGAAATTAACAGG - Intronic
925203366 2:1986929-1986951 CACCCCTTCCAGAACTTCAGAGG + Intronic
925788070 2:7452420-7452442 AACGCCTTCCTGAATTTGACAGG - Intergenic
926943024 2:18157971-18157993 AAACCTTTCCAGAAACTAATAGG - Intronic
928819115 2:35339378-35339400 TACCCCTGCCAGAATTTAATTGG + Intergenic
929250408 2:39748524-39748546 AACCCCATACAAAAATTAGCTGG + Intronic
929910128 2:46082709-46082731 AAACCCTGCCAGAAATTTAGGGG + Intronic
933119234 2:78515576-78515598 GGCCCTTTCCAGAAATAAACAGG + Intergenic
935401187 2:102662309-102662331 TACTCCTTCCACAGATTAACGGG - Intronic
939795559 2:146640322-146640344 AAACTCTTCCAGAAAATAAAAGG + Intergenic
940377974 2:152978805-152978827 AAGCCTTTCCAGATATTAATAGG - Intergenic
943448309 2:188017741-188017763 GATCCCTACCAGAAATTGACTGG + Intergenic
943876702 2:193074940-193074962 AACCCCTTCTGGAAAGAAACAGG + Intergenic
944160664 2:196656014-196656036 AACCCCTTCCAGGCAGAAACTGG + Intronic
946594466 2:221290962-221290984 AACCCCTTCCATAAATTGAAAGG + Intergenic
1169161360 20:3381737-3381759 AATCCTTTTCAGAAATTAACAGG - Intronic
1170945246 20:20885529-20885551 AACCTCTTCCAGAAAACAGCAGG - Intergenic
1171096729 20:22339531-22339553 AGCCCCTGCCCGAAATTCACAGG - Intergenic
1172863364 20:38075108-38075130 AACCACTTCTAGAAATCTACAGG - Intronic
1173773178 20:45681425-45681447 AACCCCTTACAGGGAGTAACAGG + Intergenic
1173878045 20:46388717-46388739 AAACATTTCCAGCAATTAACAGG + Intronic
1173902925 20:46604299-46604321 ACCCCCTTCCTGAAATAATCAGG + Intronic
1182240255 22:28910554-28910576 AACCCTTGCCAGAAAATAAGAGG - Intronic
951180402 3:19652761-19652783 AACCCCTTCCAGAGAGAAAATGG - Intergenic
951513116 3:23526864-23526886 AACTCTGTCCAGAAATTCACAGG + Intronic
954527424 3:51284341-51284363 AACCCCTTCCAGGGAGAAACAGG - Intronic
954643109 3:52114131-52114153 AACCACTTCCAGAACTTAGTTGG - Intronic
955343514 3:58143777-58143799 CATCCCTTCCAGAAATCAGCTGG - Intronic
957319781 3:78614934-78614956 AAACTCTTCCAGCAAATAACAGG + Intronic
962186117 3:133261360-133261382 AAACCAATCCAGAAATTAAAGGG - Intronic
967501964 3:190207881-190207903 AACCCATTCTAAAAATAAACTGG + Intergenic
971016762 4:22496967-22496989 CAGCCATTCAAGAAATTAACTGG + Intronic
971502296 4:27330336-27330358 AACCCCTTCTATCAATTAACAGG - Intergenic
972259433 4:37393338-37393360 AACCCCTTCCAAAAACTTAAGGG - Intronic
978617194 4:110609857-110609879 ATCCCCTGCCAGAAATTCTCAGG + Intergenic
983076423 4:163332200-163332222 ATCCCCATCCAGAAATTCCCCGG + Intronic
987171247 5:15260612-15260634 AACTCCTGCCAGAACATAACAGG - Intergenic
988388541 5:30597982-30598004 ACCCCCTTCCAGGAAACAACTGG + Intergenic
988734289 5:34005467-34005489 AACCCCTGCTAGGAATTAAGAGG - Intronic
991978837 5:72210883-72210905 AAATCCCTCCAGAAATTAAAGGG + Intergenic
995365106 5:111350674-111350696 AAACCTTTCCAGAACTTTACTGG - Intronic
998794520 5:145804051-145804073 AACCCATCCCAGAAACCAACAGG + Intronic
1005248072 6:23911560-23911582 ATACCCTTCCTGCAATTAACTGG + Intergenic
1009590396 6:65662234-65662256 AACCTCTTCCAGAAATTAAGTGG - Intronic
1011285123 6:85715050-85715072 CACCCCTGCCAGAACTTTACTGG + Intergenic
1012137974 6:95582586-95582608 AGCCCTTTCCAGAAATAAGCAGG + Intronic
1013646240 6:112144341-112144363 TACCCCTTCAAGAAATTATCTGG - Intronic
1017034485 6:150254916-150254938 AACTGCTTCTAGAGATTAACTGG - Intergenic
1017629566 6:156383231-156383253 AACCTCTTTCATAAATTACCCGG + Intergenic
1028862420 7:95668088-95668110 AAGCCCTCCCAGAAATTAGAGGG - Intergenic
1030011821 7:105177082-105177104 AACCACTTCCAAAAAGTACCTGG + Intronic
1034381746 7:150701954-150701976 AACCCCTTCCAGGGAGAAACTGG - Intergenic
1035425960 7:158773379-158773401 AACAGCTTTTAGAAATTAACTGG - Exonic
1037067868 8:14605099-14605121 AACCCTTTTAACAAATTAACGGG - Intronic
1037389180 8:18374740-18374762 AACCCATTCCAGGAAGTAACAGG + Intergenic
1038071776 8:24024475-24024497 AAACCCTTCCAAAAAATAAGAGG + Intergenic
1040432333 8:47355846-47355868 AACTCCTTCCGGAATTTAACAGG - Intronic
1040541951 8:48366644-48366666 AATCCCCTCCAGAAAATAAGAGG - Intergenic
1041907804 8:63052710-63052732 AACCCCTACCATATATTATCAGG - Intronic
1043276030 8:78394105-78394127 AATCACTTCCAGAAAGTAATTGG + Intergenic
1046736851 8:117785847-117785869 GAACCCTTCCAGAAAATAAAAGG - Intergenic
1048690796 8:136960874-136960896 GGCCGCTTCCAGAAATTACCCGG - Intergenic
1052010527 9:23403114-23403136 TGCCCCCTCCAGAAATTAAGAGG + Intergenic
1052452250 9:28646447-28646469 AACACCTTTAAGAACTTAACGGG + Intronic
1053228734 9:36386640-36386662 AAGACCTTCCTGATATTAACAGG + Intronic
1056380977 9:86057117-86057139 AAGCGCCACCAGAAATTAACTGG + Intronic
1057583927 9:96312829-96312851 TACCCCTGCCAGAATTTAATTGG - Intergenic
1058663846 9:107290894-107290916 AATTTCTTTCAGAAATTAACTGG - Intronic
1059959433 9:119550898-119550920 TTCCCCTCCCAGAAATTCACAGG + Intergenic
1061640856 9:131953977-131953999 AAACCCTGTCAAAAATTAACCGG - Intronic
1186317996 X:8391462-8391484 AACACCATCAAGAACTTAACAGG + Intergenic
1189562024 X:42201084-42201106 CATCTCTACCAGAAATTAACCGG - Intergenic
1189835403 X:45015818-45015840 AAGCCCTTCCAAAATTTATCTGG - Intronic
1193458303 X:81757989-81758011 AAACCCTTCAAGAAATCAATGGG + Intergenic
1195999435 X:110765376-110765398 AAACCCTTCTAGACATTTACTGG - Intronic
1196246667 X:113407911-113407933 AAACCCTTCCAGACTTTTACTGG + Intergenic
1197355585 X:125434935-125434957 AACACCATCAAGAAATTAACAGG - Intergenic
1198991256 X:142517232-142517254 AACACCTCCCATAAATTGACAGG - Intergenic
1199846982 X:151698730-151698752 AACCACATCTAGAAATTTACAGG - Intronic
1200423290 Y:2995862-2995884 AACCCCGTCCAGAAAGTTAAAGG - Intergenic
1201518681 Y:14847795-14847817 AAACCCTGCCTGAAATTAACAGG + Intergenic
1201565404 Y:15360284-15360306 AACCCCTTGCAGAGAATGACTGG + Intergenic