ID: 1128956187

View in Genome Browser
Species Human (GRCh38)
Location 15:71948114-71948136
Sequence AGTGACTTGCTTCCAAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 1, 2: 6, 3: 40, 4: 638}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128956187_1128956192 5 Left 1128956187 15:71948114-71948136 CCATTTCTTGGAAGCAAGTCACT 0: 1
1: 1
2: 6
3: 40
4: 638
Right 1128956192 15:71948142-71948164 CAGGACATGCCTTATGAAGGGGG 0: 1
1: 0
2: 1
3: 48
4: 3108
1128956187_1128956194 21 Left 1128956187 15:71948114-71948136 CCATTTCTTGGAAGCAAGTCACT 0: 1
1: 1
2: 6
3: 40
4: 638
Right 1128956194 15:71948158-71948180 AAGGGGGCAGTATCAATTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 124
1128956187_1128956190 3 Left 1128956187 15:71948114-71948136 CCATTTCTTGGAAGCAAGTCACT 0: 1
1: 1
2: 6
3: 40
4: 638
Right 1128956190 15:71948140-71948162 TACAGGACATGCCTTATGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1128956187_1128956191 4 Left 1128956187 15:71948114-71948136 CCATTTCTTGGAAGCAAGTCACT 0: 1
1: 1
2: 6
3: 40
4: 638
Right 1128956191 15:71948141-71948163 ACAGGACATGCCTTATGAAGGGG 0: 1
1: 0
2: 2
3: 8
4: 130
1128956187_1128956189 2 Left 1128956187 15:71948114-71948136 CCATTTCTTGGAAGCAAGTCACT 0: 1
1: 1
2: 6
3: 40
4: 638
Right 1128956189 15:71948139-71948161 GTACAGGACATGCCTTATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128956187 Original CRISPR AGTGACTTGCTTCCAAGAAA TGG (reversed) Intronic
900729541 1:4245908-4245930 AGTGACTTTCTTCACAGAATTGG - Intergenic
901245035 1:7723555-7723577 AGTGACTTAGTTCCAAAGAACGG + Intronic
901514210 1:9734272-9734294 CGAGAGTTGCTTTCAAGAAACGG + Intronic
902105229 1:14029998-14030020 AATGACTTTCTTCAAAGAATTGG - Intergenic
902781379 1:18707052-18707074 AGTGACTCCCTTCCAAGCCAGGG - Intronic
904794567 1:33049629-33049651 AGTCGCCAGCTTCCAAGAAAAGG + Intronic
905525029 1:38630670-38630692 AATGACTTTCTTCCCAGAATTGG - Intergenic
906358805 1:45134134-45134156 AGTGACTTTCTTCACAGAATTGG - Intronic
906756035 1:48316150-48316172 AGTGACTTTCTTCATAGAATTGG + Intronic
907110396 1:51921685-51921707 AGTGTCTTCCTACCAAGAACAGG + Intronic
907568546 1:55460730-55460752 AATGACTTTCTTCCCAGAATTGG + Intergenic
907580004 1:55563346-55563368 AATGACTTTCTTCCCAGAATTGG - Intergenic
907878599 1:58520718-58520740 AGTGATTTTATTGCAAGAAAAGG + Intronic
908177992 1:61574907-61574929 AGTGACTTTCTTCACAGAATTGG - Intergenic
908735846 1:67276036-67276058 AGTGACTTTCTTCACAGAATTGG + Intergenic
908952435 1:69577903-69577925 AATGACTTTCTTCAAAGAATTGG - Intronic
909065056 1:70926203-70926225 AATGACTTGCTTCACAGAATTGG - Intronic
909668502 1:78162558-78162580 AATGACTTTCTTCAAAGAATTGG + Intergenic
909704364 1:78563808-78563830 AGTGACTTTCTTCACAGAATTGG + Intergenic
909807506 1:79890083-79890105 AGTGACTTTCTTCACAGAATTGG - Intergenic
910816126 1:91292670-91292692 AATGACTTTCTTCACAGAAATGG + Intronic
910929834 1:92432284-92432306 ACTGACTTTCTTCAAAGAATTGG - Intergenic
911670257 1:100599761-100599783 AATGACTTTCTTCCCAGAATTGG - Intergenic
911674214 1:100640690-100640712 ATGGTCTTTCTTCCAAGAAAAGG + Intergenic
911760557 1:101609386-101609408 AGTAACTGGCTTCAAACAAATGG + Intergenic
912285004 1:108359841-108359863 AGTGACTTTCTTCACAGAATTGG - Intergenic
912956745 1:114159285-114159307 AGAGCCCTGCTTCCAGGAAAGGG + Intergenic
913310268 1:117483262-117483284 AATGACTTTCTTCACAGAAATGG - Intronic
913418937 1:118642370-118642392 AGTGACTTTCTTCACAGAATTGG + Intergenic
913512937 1:119578808-119578830 ACTGACTTTCTTCAAAGAATTGG + Intergenic
913580353 1:120220523-120220545 AGTGACTTTCTTCACAGAATTGG - Intergenic
913627827 1:120677875-120677897 AGTGACTTTCTTCACAGAATTGG + Intergenic
913715882 1:121533754-121533776 AATGACTTTCTTCCCAGAATTGG - Intergenic
913732793 1:121735020-121735042 AATGACTTTCTTCCCAGAATTGG + Intergenic
914964182 1:152238624-152238646 AGTGACTTTCTTCACAGAATTGG + Intergenic
915750008 1:158198243-158198265 AATGCCTTTCTTCCAAGAACTGG - Intergenic
915763649 1:158340689-158340711 AGTGACTTTCTTCACAGAATTGG + Intergenic
915798522 1:158763190-158763212 AGTGACTTTCTTCACAGAATTGG - Intergenic
915829701 1:159115301-159115323 AGTGACTTTCTTCACAGAATTGG + Intronic
916373186 1:164122491-164122513 AATGACTTGCTTCCCAGAATTGG - Intergenic
916596060 1:166244579-166244601 AATGACTTTCTTCAAAGAATTGG - Intergenic
916642117 1:166741433-166741455 ATTGGATTGCTTCCAAGGAAAGG - Intergenic
916735453 1:167603194-167603216 AGTGACTTGCACCCAAGGGAAGG + Intergenic
916963074 1:169908606-169908628 AGAGACTTGCATTAAAGAAATGG + Intergenic
917042007 1:170815377-170815399 AGTGACTTTCTTCACAGAATTGG + Intergenic
917391347 1:174540817-174540839 AGTGACTTTCTTCACAGAATTGG - Intronic
917658801 1:177156709-177156731 AGTGACTTCCTTCAAAGGAATGG + Intronic
917794674 1:178524334-178524356 AGTGACTTGCTTCTAATGAATGG + Intronic
917932181 1:179830308-179830330 ACAGACTTGCTACCAAGCAATGG + Intergenic
918517606 1:185380125-185380147 AATGACTTTCTTCCCAGAATTGG - Intergenic
918785791 1:188761241-188761263 TGTGACTTGCATCTAACAAAGGG - Intergenic
919189803 1:194201846-194201868 AGTGACTTTCTTCACAGAATTGG - Intergenic
919294139 1:195672343-195672365 AGTGAGTAGCTCCCAATAAAGGG - Intergenic
920041656 1:203101841-203101863 AGGGACTTGCTTCAATGACATGG - Intronic
921320585 1:213934556-213934578 AGCTACTTAGTTCCAAGAAATGG - Intergenic
921776299 1:219104209-219104231 AATGACTTTCTTCAAAGAATTGG - Intergenic
922066639 1:222150291-222150313 AATGACTTTCTTCAAAGAATTGG + Intergenic
922345923 1:224696274-224696296 GGTCACTTCCTTCAAAGAAATGG - Intronic
922393566 1:225172731-225172753 AGTGACTTTCTTCACAGAATTGG + Intronic
923965849 1:239138192-239138214 AGTGAGTTGCTTCTAAAATATGG - Intergenic
924604930 1:245525308-245525330 CGTGACTGACTGCCAAGAAATGG - Intronic
924824962 1:247529847-247529869 ACTGACCTGCTTCCAAAAAGAGG + Intronic
1062773098 10:120431-120453 AGTGACTTTCTTCACAGAATTGG - Intergenic
1063340297 10:5256760-5256782 AATGACTTTCTTCCCAGAATTGG + Intergenic
1063674518 10:8128449-8128471 GGTGACTGGTTTCCAAGAATTGG + Intergenic
1064779406 10:18818392-18818414 AATGACTTTCTTCACAGAAATGG + Intergenic
1064900720 10:20292934-20292956 AATGACTTTCTTCCCAGAATTGG - Intergenic
1065043977 10:21728696-21728718 AGGGTCTTTCTTCCAAGAATGGG + Intronic
1065414779 10:25472486-25472508 AATGACTTTCTTCACAGAAATGG - Intronic
1065427858 10:25624144-25624166 AATGACTTTCTTCCTAGAATTGG + Intergenic
1066019755 10:31286503-31286525 AGTGACTTTCTTCACAGAATTGG + Intergenic
1066077498 10:31894716-31894738 AGTGACTTTCTTCACAGAATTGG + Intronic
1066410991 10:35169121-35169143 AATGACTTTCTTCAGAGAAATGG - Intronic
1068050398 10:51942976-51942998 AATGACTTGCTTCACAGAATTGG - Intronic
1068943317 10:62703114-62703136 AATGACTTTCTTCAAAGAATTGG + Intergenic
1069986396 10:72287123-72287145 AGAGAGTTGGATCCAAGAAATGG + Intergenic
1070378315 10:75856088-75856110 AATGACTTGCTTCACAGAATTGG - Intronic
1071386893 10:85130338-85130360 AATGACTTTCTTCAAAGAATTGG + Intergenic
1071468812 10:85964253-85964275 ATTGACTTTCTTCAAAGAATTGG + Intronic
1071995458 10:91143796-91143818 TGTGACTTGCTTCTGACAAATGG + Intergenic
1072325645 10:94295972-94295994 AATGCCTGGCTTCAAAGAAAAGG - Intronic
1073949875 10:108795163-108795185 AGTGACTTTCTTCACAGAATTGG - Intergenic
1074408857 10:113206310-113206332 AGTGACATTCTTCACAGAAATGG + Intergenic
1074629701 10:115238822-115238844 AATGTTTTCCTTCCAAGAAAAGG - Intronic
1075028310 10:119003438-119003460 AGTGACCTGCTACACAGAAATGG - Intergenic
1077930886 11:6731589-6731611 AATGACTTTCTTCCCAGAATTGG + Intergenic
1077952389 11:6974418-6974440 AATGACTTTCTTCCCAGAATTGG - Intronic
1077986808 11:7360375-7360397 AATGACTTTCTTCCCAGAATTGG - Intronic
1078349336 11:10580024-10580046 AGTGAGTTTCTTACAAGAACAGG - Intronic
1078799586 11:14629691-14629713 AATGACTTTCTTCCCAGAATTGG - Intronic
1078818266 11:14848954-14848976 AATGACTTTCTTCCCAGAATTGG + Intronic
1079864682 11:25720273-25720295 AATGACTTTCTTCACAGAAATGG - Intergenic
1080365182 11:31565896-31565918 AGTGACTTTCTTCACAGAATTGG - Intronic
1080400050 11:31926000-31926022 AGTCACTTGCTTCCTATAGAAGG - Intronic
1082107086 11:48232196-48232218 AGTGACTTTCTTCACAGAATTGG - Intergenic
1082144048 11:48645725-48645747 AGTGACTTTCTTCACAGAATTGG - Intergenic
1082148480 11:48701355-48701377 AGTGACTTTCTTCACAGAATTGG - Intergenic
1082292111 11:50388467-50388489 AGTGACTTTCTTCACAGAATTGG + Intergenic
1082599980 11:55137309-55137331 AATGACTTTCTTCACAGAAATGG + Intergenic
1082677799 11:56129905-56129927 AGTGACTTTCTTCAAAGGACTGG + Intergenic
1082905647 11:58305670-58305692 AATGACTTTCTTCACAGAAATGG - Intergenic
1083099626 11:60289150-60289172 AGTGATTCGTTTCCAAGAAGGGG + Intronic
1083973888 11:66101551-66101573 AGGGACAGGCTTCAAAGAAAGGG + Intronic
1085820749 11:79790739-79790761 AATGACTTTCTTCCCAGAATTGG - Intergenic
1086019380 11:82207943-82207965 AGTTACTTACTAACAAGAAAGGG - Intergenic
1086024812 11:82278002-82278024 AATGACTTTCTTCCCAGAATTGG - Intergenic
1086025166 11:82281946-82281968 AATGACTTTCTTCCCAGAATTGG + Intergenic
1086914792 11:92517099-92517121 ATTGACTTTCTTCAAAGAATTGG + Intronic
1087087437 11:94234047-94234069 AGTGACTTTCTTCACAGAATTGG - Intergenic
1087103610 11:94388791-94388813 AGTGACTTTCTTCACAGAATTGG + Intronic
1087228179 11:95627847-95627869 AATGACTTGCTTCACAGAATTGG - Intergenic
1087547782 11:99606565-99606587 AATGACTTTCTTCAAAGAATTGG + Intronic
1087859579 11:103137750-103137772 AGTGACTTTCTTCACAGAATTGG - Intronic
1087888201 11:103505072-103505094 AGTGACTTTCTTCACAGAATTGG + Intergenic
1088122718 11:106388873-106388895 AGTGACTTTCTTCACAGAATTGG - Intergenic
1088272870 11:108053125-108053147 AGTAAGTTACTTCCATGAAAAGG + Intronic
1088370103 11:109079603-109079625 AATGACTTTCTTCCCAGAATTGG - Intergenic
1089021759 11:115222854-115222876 TGAGAATTGCTTCCAAGACATGG - Intronic
1089068409 11:115679655-115679677 AGTGACTGGATTCAAATAAATGG - Intergenic
1089163133 11:116454926-116454948 AGAGATTTGCTCCCCAGAAAGGG - Intergenic
1090490278 11:127154627-127154649 AGTGAGGTGCTTCCAAGCACAGG + Intergenic
1091694394 12:2618134-2618156 AGTGAGCTGCTCCCAGGAAAGGG + Intronic
1091756668 12:3056836-3056858 AGAGACTTCCTTCCATGGAAAGG + Intergenic
1092473592 12:8799812-8799834 AGTGACTTTCTTCACAGAATTGG + Intergenic
1092691286 12:11113181-11113203 ATTGACTTTCTTCAAAGAATTGG + Intronic
1093256551 12:16874925-16874947 AGTGACTTTCTTCACAGAATTGG - Intergenic
1093463860 12:19430499-19430521 AATGACTTTCTTCATAGAAATGG - Intronic
1093522050 12:20062564-20062586 AGTGACTTGCTTCTAAGGGATGG + Intergenic
1093573833 12:20701715-20701737 AGTGACTTTCTTGGAGGAAAGGG + Intronic
1093961963 12:25283932-25283954 AGTGACTTGCTTTCAAAGTATGG + Intergenic
1093989815 12:25577215-25577237 AGTGACTTTCTTCACAGAATGGG - Intronic
1094378242 12:29814207-29814229 AGTGACTTTCTTCACAGAATTGG + Intergenic
1094469366 12:30789305-30789327 AATGACTTGCTTCTAATACATGG + Intergenic
1094739369 12:33271032-33271054 AATGACTTTCTTCACAGAAATGG + Intergenic
1095069683 12:37825441-37825463 AGTGACTTTCTTCACAGAATTGG + Intergenic
1095086387 12:38061134-38061156 AGTGACTTTCTTCACAGAATTGG - Intergenic
1095167647 12:38992282-38992304 ATTGACTTTCTTCACAGAAATGG + Intergenic
1095695286 12:45137071-45137093 ATTGACTTTCTTCAAAGAATTGG + Intergenic
1098084473 12:66827531-66827553 TGTGACTTGCTTCCAACCAATGG - Intergenic
1098522193 12:71445719-71445741 AGTCATTTGATTTCAAGAAATGG + Intronic
1099522924 12:83686155-83686177 ATTGACTTTCTTCAAAGAATTGG + Intergenic
1099547806 12:84007424-84007446 AGTGACTTTCTTCACAGAATTGG - Intergenic
1099618546 12:84972158-84972180 AGTCACTTGCTCCCGAGGAAAGG + Intergenic
1099637122 12:85227639-85227661 AATGACTTTCTTCACAGAAATGG + Intronic
1100579489 12:95925063-95925085 AGTGACTTTCTTCACAGAATTGG - Intronic
1101557696 12:105825893-105825915 AATGACTTTCTTCAAAGAATTGG + Intergenic
1101622475 12:106402428-106402450 AGTGACTTTCTTCACAGAATTGG + Intronic
1101681952 12:106977260-106977282 AGTGAATCACTTCTAAGAAATGG - Intronic
1104353297 12:128063605-128063627 AGTGACTTGTTTACAACCAATGG + Intergenic
1105641636 13:22270919-22270941 GGTGACTTGCTTCTAACAAATGG + Intergenic
1105925990 13:25008803-25008825 AGTGACTTTCTTCACAGAATTGG - Intergenic
1106348554 13:28904777-28904799 AATGACTTGCTTCACAGAATTGG - Intronic
1106959747 13:34984567-34984589 AGTGACTTTCTTCACAGAATTGG - Intronic
1106980604 13:35274973-35274995 ACTGACTTTCTTCAAAGAATTGG + Intronic
1107327717 13:39263057-39263079 AATGGCTTGCTTTCAAGAGAAGG + Intergenic
1107969111 13:45624233-45624255 AGTGACCTGCCTTCAAGTAAGGG + Intergenic
1108883055 13:55144576-55144598 AGTGATTTTCTTCCTAGAGAAGG - Intergenic
1108985086 13:56576681-56576703 AATGACTTTCTTCCCAGAACTGG + Intergenic
1109216460 13:59595244-59595266 AATGACTTTCTTCACAGAAATGG + Intergenic
1109572620 13:64212579-64212601 AATGACTTTCTTCAAAGAATTGG - Intergenic
1109871506 13:68339715-68339737 AGTGACTTTCTTCACAGAATTGG + Intergenic
1109972474 13:69787127-69787149 AGTGACTTTCTTCACAGAATTGG + Intronic
1110908086 13:80918117-80918139 AGTGACTTTCTTCACAGAATTGG - Intergenic
1111726376 13:92014904-92014926 AGTGCCTTGATTCTTAGAAATGG + Intronic
1112319970 13:98396680-98396702 AGTGGCTTGCTTTCCAGAAAAGG + Intronic
1112554868 13:100457730-100457752 AGTGTCTTGCTCACAAGAAGTGG + Intronic
1112630431 13:101155653-101155675 AGTGACTTGCTTCAAGCCAATGG - Intronic
1113010011 13:105753605-105753627 AATGACTTTCTTCACAGAAATGG + Intergenic
1113651625 13:112037315-112037337 AGAGAGTTGCGTCTAAGAAAGGG - Intergenic
1114002464 14:18273113-18273135 AATGACTTTCTTCCCAGAATTGG - Intergenic
1114034571 14:18610695-18610717 AGTGACTTTCTTCACAGAATTGG + Intergenic
1114048389 14:18897184-18897206 AATGACTTTCTTCCCAGAATTGG + Intergenic
1114114124 14:19504462-19504484 AATGACTTTCTTCCCAGAATTGG - Intergenic
1114115824 14:19622214-19622236 AATGACTTTCTTCCCAGAATTGG - Intergenic
1115038118 14:28885739-28885761 AGTGACTTGCTTCCAACAAAAGG + Intergenic
1115065134 14:29250610-29250632 AGTGACTTTCTTCACAGAATTGG + Intergenic
1115671761 14:35620979-35621001 AGTGACTTTCTTCACAGAATTGG + Intronic
1116461554 14:45180865-45180887 AGTGACTTGCTTCTAAAAAAAGG - Intronic
1117088523 14:52225980-52226002 AGTGACTTTCTTCACAGAATTGG + Intergenic
1117270645 14:54139912-54139934 TGTGACTTGCTTCTAACCAACGG + Intergenic
1117489593 14:56233221-56233243 AGTGACTTTCTTCACAGAATTGG + Intronic
1117491624 14:56253809-56253831 AGTGACTTTCTTCACAGAATTGG + Intronic
1117811900 14:59556083-59556105 AGTGACTTTCTTCACAGAATTGG + Intronic
1118078321 14:62327665-62327687 AGTGACTTTCTTCACAGAATTGG + Intergenic
1118155415 14:63236205-63236227 AGAGACCTTGTTCCAAGAAAAGG - Intronic
1118647803 14:67856755-67856777 AGAGAATTGTTCCCAAGAAAAGG - Intronic
1118714210 14:68547851-68547873 AGTGACTTCATTCCTAAAAAAGG - Intronic
1119700057 14:76748890-76748912 AGTGACTTTCTTCACAGAATTGG + Intergenic
1121541553 14:94731072-94731094 AGTGGCTTGCTTCCAAGTAGTGG + Intergenic
1121920686 14:97878319-97878341 ACTCACTTGCTTCCAAGACCAGG + Intergenic
1121973710 14:98382971-98382993 AGTTCCTTGCTGCCAAGAATAGG - Intergenic
1122482875 14:102058974-102058996 AGTGACATGACTCCAAAAAACGG + Intergenic
1122567068 14:102666936-102666958 AGTGACCTCTTTCCAAAAAAGGG - Intronic
1124141454 15:27080805-27080827 TGGGACTTGCTTCCAACAAGAGG + Intronic
1124479619 15:30066946-30066968 AGTGACTTTCTTCACAGAATTGG + Intergenic
1124668858 15:31619298-31619320 AGTGACTTTCTTCACAGAATTGG - Intronic
1125058173 15:35387365-35387387 AGTGACTTTCTTCACAGAATTGG - Intronic
1125985162 15:44043392-44043414 ACTGACTTGCTTCACAGAATTGG + Intronic
1126317826 15:47389470-47389492 AGTGAGTGGATTCCTAGAAATGG - Intronic
1126390221 15:48141193-48141215 AGTGTGTTGGTTGCAAGAAAAGG + Exonic
1127023490 15:54777224-54777246 AGTGACTTCCTTCAACGAACAGG - Intergenic
1127032199 15:54876304-54876326 AGTGACTTTCTTCATAGAATTGG + Intergenic
1127339953 15:58030999-58031021 AATGACTTTCTTCAAAGAACTGG + Intronic
1127686058 15:61346050-61346072 AGTGACTTTCTTCACAGAATTGG + Intergenic
1128956187 15:71948114-71948136 AGTGACTTGCTTCCAAGAAATGG - Intronic
1129548391 15:76422142-76422164 AGTGACTTTCTTCACAGAATTGG - Intronic
1129617528 15:77110925-77110947 ACTGAATTGCTTCCAAGACTAGG + Exonic
1129621571 15:77152011-77152033 AGTGACTTTCTTCACAGAATTGG - Intronic
1130667565 15:85882739-85882761 AGTGACTTTCTTCACAGAATTGG + Intergenic
1131149369 15:90037266-90037288 AGGGACTTTCTTCCAAGGGAAGG - Intronic
1131556273 15:93402529-93402551 ACTGACTTTCTTCAAAGAACTGG - Intergenic
1132584974 16:702145-702167 AGTGACTTGATTCGCAGAAGAGG - Intronic
1133717751 16:8465763-8465785 AGTGACTTTCTTCCAGGGAAGGG - Intergenic
1134764687 16:16746563-16746585 AATGACTTTCTTCAAAGAATTGG - Intergenic
1134778857 16:16877225-16877247 TGTGACTTGCTTCCCACAGATGG - Intergenic
1134870212 16:17646073-17646095 AGTGACTTGCTTCTAACTAATGG + Intergenic
1135292305 16:21250464-21250486 AGTGAATTGCTTCAAAGACAAGG + Exonic
1135513493 16:23109587-23109609 AGTGACTTACTTCCAAAGACAGG + Intronic
1137318370 16:47351679-47351701 AGTGACTTTCTTCAGAGAATTGG + Intronic
1137370548 16:47901734-47901756 AGTGACTTTTTTCAAAGAATTGG + Intergenic
1137581356 16:49635558-49635580 AGTGCCGTGTTTCCAAGAAGCGG - Intronic
1137824616 16:51480775-51480797 AGTGACTTTCTTCACAGAATTGG - Intergenic
1138325146 16:56159108-56159130 AATGACTTTCTTCAAAGAATTGG + Intergenic
1139213046 16:65099799-65099821 AATGACTTGCCTCCAAGCAGGGG + Intronic
1140115601 16:72038846-72038868 AATGACTTGCTTCTAACATAGGG - Intergenic
1140136796 16:72213307-72213329 AGTGACTTGCTTCTAATACATGG + Intergenic
1140315867 16:73896144-73896166 AATGACTTGCCTCCAATAAATGG + Intergenic
1140574314 16:76147762-76147784 CGTGACTTGCTTCTAAGCCATGG + Intergenic
1140695559 16:77529574-77529596 AATGACTTTCTTCAAAGAATTGG + Intergenic
1140797384 16:78452076-78452098 TTTGACCTGCTTCCAAAAAAGGG - Intronic
1141411125 16:83833839-83833861 AGTGACTTCCTTCCAAAGAGGGG + Intergenic
1144070616 17:11668338-11668360 AATCAGCTGCTTCCAAGAAATGG + Intronic
1144277383 17:13686642-13686664 AGTGACATCCTTCCAAAGAATGG - Intergenic
1145688147 17:26699266-26699288 AATGACTTTCTTCACAGAAATGG + Intergenic
1145761535 17:27428544-27428566 AGTGACTTTCTTCACAGAATTGG - Intergenic
1146300039 17:31680806-31680828 AGTCAGTTACTCCCAAGAAAAGG + Intergenic
1147266821 17:39239508-39239530 AGTGACATGTTGCAAAGAAATGG + Intergenic
1148915458 17:50973410-50973432 AGTCATTTCCTTCCTAGAAATGG - Intronic
1149341824 17:55694794-55694816 AGTGTCTAGTGTCCAAGAAAGGG + Intergenic
1149635315 17:58162811-58162833 AGTAGCTTGCTTCCAAGAGTGGG - Intergenic
1149863813 17:60139413-60139435 ATTTACCTGCTTCCCAGAAACGG + Intergenic
1153317402 18:3738242-3738264 AGTGACTTTCTTCACAGAATTGG + Intronic
1153917928 18:9762165-9762187 AATGACTTGCTCCTAAGAAATGG - Intronic
1154011855 18:10581084-10581106 TCTGACTTGATTGCAAGAAAGGG + Intergenic
1154186247 18:12186235-12186257 AGTGACTTTCTTCACAGAATTGG + Intergenic
1154188079 18:12203969-12203991 AGTGACTTTCTTCACAGAATTGG - Intergenic
1154288166 18:13080160-13080182 AGTGACTTTCTTCACAGAATTGG - Intronic
1155102028 18:22620834-22620856 AATGACTTTCTTCCCAGAATTGG + Intergenic
1155311504 18:24528900-24528922 AGTGACTGGGTTCCTAGAGAAGG - Intergenic
1155466270 18:26139088-26139110 AGTGACTTGCTTTTAAGGAATGG + Intronic
1156144930 18:34163708-34163730 AGTGACTTTCTTCACAGAACTGG + Intronic
1156983805 18:43325134-43325156 AGTGACTTTCTTCACAGAATTGG + Intergenic
1157995674 18:52552281-52552303 AGGACCTTGTTTCCAAGAAAAGG + Intronic
1159483376 18:69020796-69020818 AATGACTTGCTACCAAAAAGAGG + Intronic
1159651552 18:70984647-70984669 AGTGAATTGCTTCTAACTAATGG + Intergenic
1160102338 18:75934689-75934711 AGTGAGTTCCTTCCAAAATACGG - Intergenic
1161517212 19:4703123-4703145 AGTGACTTGAAACCAAGACAAGG + Intronic
1163055252 19:14713183-14713205 AGTGATCTGCTTCCAAAATACGG + Intronic
1164355879 19:27428267-27428289 AATGACTTTCTTCAAAGAATTGG + Intergenic
1164377065 19:27696964-27696986 AATGACTTTCTTCAAAGAATTGG - Intergenic
1164495931 19:28761466-28761488 AATGACTTTCTTCAAAGAATTGG + Intergenic
1165195411 19:34098663-34098685 AGTGACTTCCTTCCAAAAATGGG + Intergenic
1165260935 19:34617208-34617230 AATGACTTTCTTCAAAGAATTGG - Intronic
924989394 2:299090-299112 ATTGACTTTCTTCAAAGAATAGG + Intergenic
927105061 2:19817117-19817139 AGTGGGTTGCTCCCTAGAAAGGG - Intergenic
927221963 2:20720588-20720610 AATGACATGCTTCACAGAAATGG + Intronic
927646780 2:24882380-24882402 ATGGACTTGCTTCCCAGAGACGG - Intronic
928267915 2:29827784-29827806 AATGACTTTCTTCAAAGAATTGG + Intronic
929019180 2:37533484-37533506 AGTTCCTTGCTTCTAACAAATGG - Intergenic
929339472 2:40796863-40796885 AGTGACATGTTCACAAGAAAAGG - Intergenic
929964534 2:46524394-46524416 GGTGACTTGCCTCCAAGTTAAGG - Intronic
930239818 2:48924497-48924519 AGTGACTTTCTTCACAGAATTGG + Intergenic
930294803 2:49541887-49541909 AGTGACATTCTTCACAGAAATGG + Intergenic
931031155 2:58176247-58176269 AGTGACTTTCTTCACAGAATTGG + Intronic
931325604 2:61218947-61218969 AGTGACTTTCTTCCAAGGAATGG - Intronic
931843786 2:66181657-66181679 AGTGACTTTCTTCACAGAATTGG + Intergenic
931846639 2:66210841-66210863 AGTGACTTTCTTCACAGAATTGG + Intergenic
931864568 2:66395603-66395625 AGTGACTTTCTTCACAGAATTGG + Intergenic
932517640 2:72369479-72369501 AATGACTTGCTTCACAGAATTGG + Intronic
932734663 2:74246286-74246308 AGTAACTTGCTACCAACCAAGGG + Intronic
936553577 2:113473009-113473031 AGTGACTTTCTTCACAGAATTGG - Intronic
937719857 2:125081368-125081390 AGTGACTTTCTTCACAGAATTGG + Intergenic
938425755 2:131185691-131185713 AGTGACTTTCTTCACAGAATTGG + Intronic
939137441 2:138314132-138314154 GGTCACTGGCTTTCAAGAAAGGG + Intergenic
939989403 2:148863328-148863350 AGTGACTTGCTTCTAATCAATGG + Intergenic
940550866 2:155154662-155154684 AGGGATGTGCTTGCAAGAAAAGG - Intergenic
940602297 2:155877247-155877269 AATGACTTTCTTCAAAGAATTGG + Intergenic
940620078 2:156101172-156101194 AGTGACTGGTTTCCTAGAGATGG + Intergenic
941149530 2:161896438-161896460 AGTGACTTTCTTCACAGAATTGG - Intronic
941773645 2:169368487-169368509 AATGACTTTCTTCAAAGAATTGG + Intergenic
942108012 2:172652938-172652960 AGTGACTTTCTTCACAGAATTGG + Intergenic
942247569 2:174021949-174021971 AGTGACTTACTTCTAACAAATGG + Intergenic
942435042 2:175962171-175962193 AGTGACTTTCTTCGCAGAATTGG + Intronic
942790295 2:179753461-179753483 AGTGACTTTCTTCACAGAATTGG - Intronic
942863194 2:180640684-180640706 AATGACTTGCTTCACAGAATTGG - Intergenic
943975702 2:194474061-194474083 AATGACTTTCTTCAAAGAATTGG + Intergenic
945448136 2:209962254-209962276 AATGACTTGCTTTGAGGAAAAGG + Intronic
945776389 2:214111652-214111674 AATGACTTTCTTCAAAGAATTGG - Intronic
946584751 2:221172652-221172674 AGTGACTTGTTTCCAGTGAATGG + Intergenic
946653619 2:221920740-221920762 AGGGTCTTGCTTGGAAGAAAAGG + Intergenic
947155822 2:227162289-227162311 AATGACTTGGTTTCAGGAAAAGG + Intronic
947174471 2:227349439-227349461 AGAGAATTCCTTCCCAGAAAAGG - Intronic
948104574 2:235403053-235403075 AGTCACTTCCTTAAAAGAAAAGG - Intergenic
948395925 2:237645038-237645060 AGTGACTTGCTTCCAGAGCAGGG - Intronic
1169428617 20:5515710-5515732 AGTGACTTTCTTCACAGAATTGG - Intergenic
1170051785 20:12154034-12154056 TGTAACTTGCTTCTAACAAATGG - Intergenic
1171167936 20:22989113-22989135 AGTGACTTTCTTCACAGAATTGG - Intergenic
1171515439 20:25728678-25728700 AGTGACTTTCTTCACAGAATTGG + Intergenic
1171755988 20:29110155-29110177 AATGACTTTCTTCACAGAAATGG + Intergenic
1171768735 20:29304416-29304438 AGTGACTTTCTTCACAGAATTGG + Intergenic
1171861971 20:30409243-30409265 AATGACTTTCTTCACAGAAATGG + Intergenic
1172582638 20:36060448-36060470 AGTAACTTGCTTCCAAAGAGTGG + Intergenic
1175390967 20:58627168-58627190 TCTGGCTTCCTTCCAAGAAAAGG - Intergenic
1175613165 20:60369068-60369090 AGTGACTTTCTTCACAGAATTGG - Intergenic
1176918220 21:14652159-14652181 AGTGACATTCTTCACAGAAATGG + Intronic
1176929978 21:14797514-14797536 AATGACTAGCTCCAAAGAAATGG + Intergenic
1177573601 21:22922310-22922332 AATGACTTTCTTCAAAGAATTGG + Intergenic
1178629548 21:34247395-34247417 AGCGACTTGCTTCTAACACATGG + Intergenic
1178813085 21:35902346-35902368 ATTGACTTGCTTCACAGAATTGG + Intronic
1179536482 21:42055943-42055965 TGTTTCTTTCTTCCAAGAAAGGG + Intergenic
1180394683 22:12320271-12320293 AATGACTTTCTTCCCAGAATTGG - Intergenic
1180405060 22:12544477-12544499 AATGACTTTCTTCCCAGAATTGG + Intergenic
1180413029 22:12634026-12634048 AATGACTTTCTTCACAGAAATGG + Intergenic
1182652972 22:31866986-31867008 AGTGATGTGCCTCCAATAAATGG - Intronic
1183703714 22:39464165-39464187 TGGGACTTGCTTCCAGGAAGAGG - Intronic
1185013271 22:48328274-48328296 AGTGACTTGCTTCTAGCAACTGG - Intergenic
949114483 3:303266-303288 AGTGACTTTCTTCACAGAATTGG - Intronic
949207772 3:1460584-1460606 AGTGACTTTCTTCACAGAATTGG - Intergenic
949209612 3:1482083-1482105 AGTGACTTTCTTCACAGAATTGG + Intergenic
949427731 3:3937387-3937409 AGTGACTTTCTTCACAGAATTGG - Intronic
949842474 3:8334981-8335003 AGTGACTTTCTTCACAGAATTGG + Intergenic
951010767 3:17676619-17676641 AATGACTTGCTTCACAGAATTGG + Intronic
951012568 3:17697723-17697745 AATGACTTGCTTCACAGAATTGG + Intronic
951070831 3:18327274-18327296 AATGACTTGCTTCACAGAATTGG - Intronic
951156019 3:19354348-19354370 AGTGACTTTCTTCACAGAATTGG + Intronic
951182747 3:19678203-19678225 AGTGACTTTCTTCACAGAATTGG - Intergenic
951291344 3:20875441-20875463 AATGACTTTCTTCCCAGAATTGG - Intergenic
951413685 3:22396787-22396809 AGTGACTTTCTTCACAGAACTGG - Intergenic
951438104 3:22688635-22688657 AATGACTTGCTTCACAGAATTGG + Intergenic
951833388 3:26955157-26955179 AATGACTTTCTTCACAGAAATGG - Intergenic
952019210 3:28996931-28996953 AGTGACTTTCTTCACAGAATTGG - Intergenic
953523300 3:43663999-43664021 ACTGACTTTCTTCAAAGAATTGG + Intronic
954765799 3:52914987-52915009 AGTGGCTTACTTCCAATAACTGG + Intronic
955642556 3:61101577-61101599 AGTGACTTTCTTCATAGAATTGG - Intronic
955832408 3:63018104-63018126 AGTGACTTTCTTCACAGAATTGG - Intergenic
956615967 3:71172990-71173012 AGTGACTTGCTTCAAATCACAGG + Intronic
956786252 3:72644797-72644819 AATGACTGACTTGCAAGAAATGG + Intergenic
957222855 3:77406765-77406787 TGTGACTTGTCTCCGAGAAATGG - Intronic
957666974 3:83245183-83245205 AGTGACTTTCTTCACAGAACTGG - Intergenic
958058411 3:88444959-88444981 AGTAACTTTCTTCCAGGAAATGG - Intergenic
958074249 3:88656174-88656196 AGTGACTTTCTTCACAGAATTGG - Intergenic
958480136 3:94635250-94635272 AGTGACTTTCTTCACAGAATCGG + Intergenic
958621682 3:96570814-96570836 ACTGACTTTCTTCACAGAAATGG - Intergenic
958902717 3:99906808-99906830 AGTGTCTTGCTTTCAAGTTAGGG - Intronic
959218119 3:103479678-103479700 AGTGACTTTCTTCACAGAATTGG - Intergenic
959313485 3:104771947-104771969 AGCGACTTGCTTCTAATAATGGG - Intergenic
960543876 3:118889872-118889894 AGTCACTCCCTTCCAGGAAAAGG - Intergenic
960643603 3:119853444-119853466 AATGACTTTCTTCACAGAAATGG - Intronic
960693605 3:120374138-120374160 AATGACTTTCTTCAAAGAATTGG - Intergenic
960838677 3:121934286-121934308 AATGACTTTCTTCAAAGAATTGG - Intronic
960859621 3:122138608-122138630 AATGACTTTCTTCAAAGAATTGG - Intergenic
962233342 3:133685817-133685839 AATGACTTGCTTCACAGAATTGG + Intergenic
962697962 3:137969742-137969764 AATGACTTTCTTCACAGAAATGG + Intergenic
963396384 3:144740093-144740115 AGTGACTTTCTTCACAGAACTGG - Intergenic
963505826 3:146183359-146183381 AATGACTTTCTTCAAAGAATTGG + Intergenic
963812033 3:149787096-149787118 AGTGACTTTCTTCACAGAATTGG - Intronic
964185074 3:153932876-153932898 AGTGACTTTCTTCACAGAATTGG + Intergenic
964657691 3:159086440-159086462 AATGACTTTCTTCAAAGAATTGG - Intronic
964721082 3:159767677-159767699 AGACACTTGCTTCCAAGCAGAGG - Intronic
964860067 3:161191833-161191855 AGTGACTTTCTTCACAGAATTGG - Intronic
964962829 3:162449195-162449217 ATTGACTTTCTTCCCAGAATTGG - Intergenic
964963306 3:162456257-162456279 AGTGACTTTCTTCACAGAATTGG + Intergenic
965217452 3:165881543-165881565 AATGACTTTCTTCCCAGAATTGG + Intergenic
966214541 3:177489043-177489065 AGTGATTTGCTTCTAACAAATGG - Intergenic
966366691 3:179195712-179195734 AGTCACTTGCCTCCAATAAATGG - Intronic
967723334 3:192838342-192838364 AGTGACTTGCTTCTAATGCATGG - Intronic
968848805 4:3063630-3063652 GGTGACTCTCTTCCCAGAAATGG - Intergenic
970096222 4:12465907-12465929 AATGACTTTCTTCAAAGAATTGG + Intergenic
970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG + Intergenic
970755303 4:19418665-19418687 AATGACTTTCTTCAAAGAATTGG + Intergenic
971054146 4:22893899-22893921 AGTAACTTGCTTCTAAAAAATGG - Intergenic
971457230 4:26856963-26856985 AGTGTCTTGCATCCAGGATAGGG - Intergenic
971552059 4:27969620-27969642 AGTGTCTTAGTTGCAAGAAAGGG + Intergenic
971770168 4:30885589-30885611 AATGACTTTCTTCAAAGAATTGG + Intronic
971915413 4:32864643-32864665 GGGGTCTTGATTCCAAGAAATGG - Intergenic
971976384 4:33693988-33694010 ACTGACTTGCTTCACAGAATTGG + Intergenic
972725262 4:41741880-41741902 AGTGACTTGTCTCCAGGACAAGG - Intergenic
973965608 4:56159218-56159240 AGAGACCTGTTCCCAAGAAACGG - Intergenic
973998327 4:56482821-56482843 AGTGAACTGCTTTAAAGAAATGG - Intronic
974108761 4:57501615-57501637 AGTGACATGCTTTCGTGAAAGGG - Intergenic
974141689 4:57896261-57896283 AGTGACTTTCTTCACAGAATTGG - Intergenic
974162169 4:58154132-58154154 ATTGACTTTCTTCAAAGAATTGG + Intergenic
975170453 4:71226638-71226660 AGTGATTTGTTCCAAAGAAAGGG - Intronic
975291581 4:72683897-72683919 AATGACTTTCTTCAAAGAATTGG + Intergenic
975467601 4:74726369-74726391 AGTAACTTTCTTCCAAAAATAGG + Intergenic
975959960 4:79890429-79890451 ACTGACTTCCTTCAAAGAATTGG - Intergenic
976011698 4:80496669-80496691 AGAAAATTGGTTCCAAGAAATGG - Intronic
976573313 4:86638296-86638318 AATGACTTTCTTCCCAGAATAGG + Intronic
976585693 4:86794515-86794537 ACTGACTTTCTTCCCAGAATAGG + Intronic
977107837 4:92911743-92911765 AGAGACTTGCTTTCAAGTATTGG + Intronic
977218414 4:94310659-94310681 AGTGACTTTCTTCACAGAATTGG - Intronic
977219383 4:94321286-94321308 AGTGACTTTCTTCACAGAATTGG - Intronic
977741427 4:100488018-100488040 AGTGACTTGCACACATGAAATGG + Intronic
977771316 4:100864330-100864352 ACTGACTTTCTTCCCAGAATTGG - Intronic
978517174 4:109580997-109581019 AATGACTTTCTTCAAAGAATTGG + Intronic
979821528 4:125178787-125178809 AATGACTTTCTTTCAAAAAAAGG + Intergenic
980488497 4:133492431-133492453 AGTGACTTTCTTCACAGAATTGG - Intergenic
980540397 4:134186154-134186176 AATGACTTTCTTCACAGAAATGG + Intergenic
981556355 4:145999277-145999299 AATGACTTGCTTCACAGAATTGG - Intergenic
981606823 4:146548416-146548438 ATTGATTTGCTTCTAATAAATGG + Intergenic
981618535 4:146668094-146668116 AATGACTTGCTTCACAGAATTGG + Intergenic
981879550 4:149592980-149593002 AATGACTTTCTTCAAAGAATTGG - Intergenic
982120840 4:152142139-152142161 AATGACTTTCTTCACAGAAATGG + Intergenic
982536215 4:156609338-156609360 AATGACTTGCTTCTAAGAAATGG + Intergenic
982542070 4:156685841-156685863 TGTGAATTGCTTCAAATAAATGG - Intergenic
982819752 4:159930592-159930614 AGTGACTTTCTTCACAGAATTGG - Intergenic
982836109 4:160121740-160121762 AGTGACTTTCTTCACAGAATTGG - Intergenic
982874269 4:160625785-160625807 AATGACTTGCTTCCCAGAATTGG + Intergenic
983056953 4:163108907-163108929 GGTGAGTTTCTTACAAGAAAAGG + Intergenic
983668702 4:170211722-170211744 AATGACTTTCTTCCCAGAATTGG + Intergenic
983704772 4:170643888-170643910 AATGACTTTCTTCCCAGAATTGG + Intergenic
985494340 5:196264-196286 AGTGACTTTGTGCAAAGAAATGG + Intergenic
986619973 5:9662128-9662150 TGTGACTTGCTTACATCAAAGGG - Intronic
987279322 5:16396505-16396527 AGTGACTTTCTTCACAGAATTGG - Intergenic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
987562808 5:19546036-19546058 AGTGGCATGCAGCCAAGAAATGG + Intronic
987893711 5:23917468-23917490 AGTGACTTTCTTCACAGAATTGG - Intergenic
988397149 5:30709523-30709545 AATGACTTTCTTCAAAGAATTGG + Intergenic
988518784 5:31927850-31927872 AGTGACTTGGGTCCTAGACAAGG - Intronic
989623403 5:43407109-43407131 AGTGACTTTCTTCACAGAATTGG + Intronic
990212752 5:53498249-53498271 AATGACTTTCTTCAAAGAATTGG + Intergenic
990226525 5:53661524-53661546 AATGACTTTCTTCAAAGAATTGG - Intronic
990859970 5:60316010-60316032 AATGACTTTCTTCAAAGAATTGG - Intronic
990870385 5:60425151-60425173 AATGACTTTCTTCACAGAAATGG + Intronic
991102489 5:62808325-62808347 ATTGACTTTCTTCAAAGAATTGG - Intergenic
991108317 5:62867756-62867778 AGTGACTTTCTTCACAGAATTGG + Intergenic
991280426 5:64907190-64907212 AATGACTTTCTTCAAAGAATTGG - Intronic
991321141 5:65374727-65374749 AATGACTTTCTTCACAGAAATGG + Intronic
991323691 5:65405669-65405691 AATGACTTTCTTCAAAGAATTGG - Intronic
991629325 5:68639060-68639082 AGTGACCTGCTTCTAAAGAATGG - Intergenic
992604014 5:78436747-78436769 AGTGACTTTCTTCACAGAATTGG - Intronic
993305051 5:86266568-86266590 AGTGACTTTCTTCACAGAATTGG - Intergenic
993741579 5:91547205-91547227 ACTGACTTCCTTCAAAGAATTGG - Intergenic
994048942 5:95340797-95340819 AGTGACTTTCTTCACAGAATTGG + Intergenic
994161307 5:96559822-96559844 AGTGACTTTCTTCACAGAATTGG + Intronic
994270235 5:97768143-97768165 AGTGACTTTCTTCACAGAATTGG - Intergenic
994280672 5:97898677-97898699 AGTGACTTTCTTCACAGAACTGG - Intergenic
994405552 5:99341138-99341160 AATGACTTTCTTCATAGAAATGG - Intergenic
994442707 5:99830478-99830500 AATGACTTTCTTCACAGAAATGG - Intergenic
994645938 5:102469185-102469207 AATGACTTGCTTCACAGAATTGG - Intronic
994758329 5:103821759-103821781 AATGACTTGCTTCTAACAAAGGG - Intergenic
995152443 5:108864881-108864903 AATGACTTTCTTCAAAGAATTGG - Intronic
995302233 5:110597481-110597503 AGTGACTTTCTTCACAGAATTGG + Intronic
995644153 5:114292715-114292737 AATGACTTTCTTCCCAGAATTGG - Intergenic
995692419 5:114842409-114842431 AGTGACTTTCTTCACAGAATTGG + Intergenic
995715185 5:115075609-115075631 AGTGACTTTCTTCACAGAACTGG + Intergenic
995750267 5:115446668-115446690 AATGACTTTCTTCAAAGAATTGG + Intergenic
995814374 5:116150380-116150402 AGTGACTTTCTTCACAGAATTGG - Intronic
996186769 5:120487170-120487192 AGTGACTTTCTTCACAGAATTGG - Intronic
996611806 5:125391428-125391450 TGTGACTTGCTTCTAACCAATGG + Intergenic
996788426 5:127266444-127266466 AATGACTTTCTTCAAAGAATTGG - Intergenic
996830521 5:127735451-127735473 AATGACTTTCTTCAAAGAATTGG - Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997396489 5:133564156-133564178 AGTGAGGTCCTTACAAGAAAAGG - Intronic
998185666 5:139977561-139977583 AGTGACTTTCTTCACAGAATTGG + Intronic
999072040 5:148753788-148753810 ACTGACTTTCTTCAAAGAAGTGG - Intergenic
999471855 5:151861898-151861920 AATGACTTTCTTCAAAGAACTGG + Intronic
999483772 5:151972587-151972609 AGTGACTTGCTTGCAATAAATGG + Intergenic
999523429 5:152376678-152376700 AGTGAAGTGATTCCAAGAAAAGG + Intergenic
1001016429 5:168145703-168145725 AGTGACTTTCTTCACAGAATTGG - Intronic
1001354355 5:171005211-171005233 AGTGACTTTCTTCACAGAATTGG + Intronic
1001708584 5:173760119-173760141 AGTGACTTGCTTCTGATGAATGG - Intergenic
1003437145 6:6101204-6101226 AGTGACTTTCTTCACAGAATTGG - Intergenic
1003441048 6:6142455-6142477 AGTGACTTTCTTCACAGAATTGG - Intergenic
1003446184 6:6186747-6186769 AGTGACTTTCTTCACAGAATTGG - Intronic
1003449320 6:6216144-6216166 AGTGACTTTCTTCACAGAATTGG + Intronic
1003457447 6:6296269-6296291 AGTGACTTTCTTCACAGAATTGG - Intronic
1004644075 6:17542634-17542656 ACTGACTTGCTTCCAAGAAGTGG + Intronic
1004844344 6:19622989-19623011 AATGACTTTCTTCAAAGAATTGG + Intergenic
1004855446 6:19744981-19745003 AATGACTTTCTTCACAGAAATGG + Intergenic
1004946211 6:20616304-20616326 AGTGACTTTCTTCACAGAATTGG - Intronic
1005892105 6:30148366-30148388 TGTGACTTGCTTCTAATGAATGG + Exonic
1006237642 6:32649250-32649272 AGTGACTTTCTTCACAGAATTGG + Intergenic
1007315849 6:40988305-40988327 AGTGACTTGATTCTAACAAATGG - Intergenic
1008873709 6:56303253-56303275 TGTGACTTGCTTCACAGAATTGG - Intronic
1009277184 6:61697986-61698008 AGTCACTTCTTTTCAAGAAATGG - Intronic
1009278866 6:61721302-61721324 AGTGACTTTCTTCACAGAATTGG - Intronic
1009283020 6:61775760-61775782 AGTGACTTTCTTCATAGAATTGG + Intronic
1009342988 6:62581179-62581201 AATGATTTGCTGCCGAGAAATGG - Intergenic
1009543443 6:64995544-64995566 GGTGATATCCTTCCAAGAAATGG - Intronic
1009636299 6:66269063-66269085 AGGGAATTGCATCCAAGAAAAGG - Intergenic
1009743811 6:67785773-67785795 AGTGACTTTCTTCACAGAATTGG + Intergenic
1009867216 6:69412592-69412614 AGTGACTTTCTTCACAGAATTGG - Intergenic
1010307233 6:74339274-74339296 AGTGACTTTCTTCACAGAACTGG - Intergenic
1010503009 6:76624357-76624379 AATGACTTTCTTCAAAGAATTGG - Intergenic
1010563293 6:77377471-77377493 AGTGACTTTATTCTAAGAAAAGG - Intergenic
1010598017 6:77788871-77788893 AGTGACTTTCTTCACAGAATTGG + Intronic
1010661083 6:78571248-78571270 AGTGACTTTCTTCACAGAATTGG + Intergenic
1010728653 6:79364417-79364439 AGTGACTTTCTTCATAGAATTGG - Intergenic
1010861084 6:80912654-80912676 AATGACTTTCTTCAAAGAATTGG + Intergenic
1010996950 6:82544532-82544554 AATGACTTTCTTCAAAGAATTGG - Intergenic
1011477212 6:87759888-87759910 AATGACATGCTTCCAGGACAAGG - Intergenic
1011479178 6:87777075-87777097 AGTGACTTGAATCCCTGAAATGG + Intergenic
1011752926 6:90471613-90471635 AGTCACGTGCTTCCAAGCCAAGG - Intergenic
1012088111 6:94855611-94855633 AATGACTTTCTTCCCAGAATTGG + Intergenic
1012678176 6:102143442-102143464 AGTGACTTTCTTCACAGAATTGG - Intergenic
1013710727 6:112894664-112894686 AGTGACTGTGTTCCAAGAACTGG + Intergenic
1013984528 6:116174232-116174254 AGTGACTTGCTTTCAAAAAACGG - Intronic
1014220978 6:118798361-118798383 AATGACTTGCTTCACAGAATTGG + Intergenic
1014873153 6:126622078-126622100 AGTGATTTTCTACCAAGAGAAGG + Intergenic
1014892784 6:126863049-126863071 AGTGACTTTCTTCACAGAATTGG - Intergenic
1014930044 6:127324985-127325007 AGTAACTTGCTTCCAAGGAGTGG + Intronic
1015045881 6:128775738-128775760 AGTGACTTTCTTCACAGAATTGG - Intergenic
1015080837 6:129223868-129223890 AGTGACTTTCTTCACAGAATTGG - Intronic
1015746465 6:136514927-136514949 AGTGCCTGGCTTCGAAGAACAGG - Intronic
1016018904 6:139215095-139215117 AATGACTTTCTTCAAAGAATTGG + Intergenic
1016128718 6:140438413-140438435 AGAGAGAAGCTTCCAAGAAAAGG + Intergenic
1016255053 6:142094675-142094697 AATGACTTTCTTCAAAGAATTGG - Intergenic
1016594133 6:145780169-145780191 AGTGACTTGCTTCTCACCAATGG - Intergenic
1016774201 6:147886534-147886556 TGTGACTTGCTTCTAACCAACGG + Intergenic
1016777232 6:147918082-147918104 AATGACTTTCTTCAAAGAATTGG - Intergenic
1020092219 7:5348181-5348203 AGACACTTGCTTCCAAGGACGGG + Intronic
1021069684 7:16220912-16220934 AGTGACTTTCTTCACAGAATTGG + Intronic
1021261851 7:18468174-18468196 AGTGACTTGCTTCTAAAGAGTGG - Intronic
1021611631 7:22463423-22463445 AATGACTTGCTTCACAGAATTGG + Intronic
1022387842 7:29918217-29918239 AGAGACGTGCTTCCTAGAGAGGG + Intergenic
1023161371 7:37299791-37299813 AGTGACTTTCTTCACAGAATTGG - Intronic
1023670933 7:42575878-42575900 AGAGAGATTCTTCCAAGAAAGGG + Intergenic
1024666660 7:51553658-51553680 AATGACTTTCTTCAAAGAATTGG - Intergenic
1024718224 7:52105099-52105121 AATGACTTTCTTCAAAGAATTGG + Intergenic
1024738517 7:52331355-52331377 AATGACTTTCTTCAAAGAATTGG + Intergenic
1025183725 7:56839933-56839955 AGTGACTTTCTTCACAGAATTGG - Intergenic
1025688201 7:63737054-63737076 AGTGACTTTCTTCACAGAATTGG + Intergenic
1027509881 7:79067131-79067153 ATTGACTTGCTTCACAGAATTGG - Intronic
1027777738 7:82487566-82487588 ATTGACTTTCTTCCCAGAATTGG - Intergenic
1028055181 7:86232124-86232146 AATGACTTTCTTCAAAGAATTGG + Intergenic
1028215133 7:88122358-88122380 TGTAACTTGCTTCCAACCAATGG - Intronic
1029922572 7:104281144-104281166 AATGACTTTCTTCAAAGAATTGG + Intergenic
1029938886 7:104458639-104458661 AATGACTTTCTTCAAAGAATTGG - Intronic
1030451999 7:109723723-109723745 AGTGACTTTCTTCACAGAATTGG + Intergenic
1031135093 7:117875365-117875387 AGGGATTTGCTTCCCAGAGATGG - Intergenic
1031379552 7:121068638-121068660 AATGACTTTCTTCAAAGAATTGG - Intronic
1031394178 7:121251931-121251953 AATGACTTTCTTCAAAGAATTGG + Intronic
1031547399 7:123067827-123067849 AGGAACTTGCTTCCCTGAAAGGG + Intergenic
1031612142 7:123840510-123840532 AATGACTTTCTTCAAAGAATTGG - Intronic
1031641759 7:124173226-124173248 ACTGACTTTCTTCACAGAAATGG - Intergenic
1031864867 7:127027358-127027380 ACTGACTTTCTTCAAAGAATTGG - Intronic
1034408095 7:150919495-150919517 AGGGACTTGCTTCCAAAGAACGG - Intergenic
1034718997 7:153270748-153270770 AATGACTTTCTTCAAAGAATTGG + Intergenic
1035034082 7:155884063-155884085 AGGGACGCGCTTTCAAGAAAGGG + Intergenic
1035055976 7:156036966-156036988 CATGAATTTCTTCCAAGAAATGG - Intergenic
1035640994 8:1185041-1185063 AGTGACTCGTTTCCCAGGAAAGG + Intergenic
1035884012 8:3272454-3272476 AATGACTTTCTTCCCAGAATTGG - Intronic
1035893052 8:3366889-3366911 CGTGACTTGATTCCAACTAATGG - Intronic
1035990663 8:4486728-4486750 AGTGGCTTTCTTCCATGAAGGGG - Intronic
1036624076 8:10451449-10451471 AATGACTTTCTTCAAAGAATTGG - Intergenic
1037056026 8:14443278-14443300 AGTGACTTTCTTCACAGAATTGG + Intronic
1037133051 8:15429493-15429515 AGTGACTTTCTTCACAGAATTGG - Intronic
1037665201 8:20963079-20963101 GGTGACTTGCATCAAAGATACGG - Intergenic
1038220670 8:25604140-25604162 AGTGACTTGCATCTCACAAACGG - Intergenic
1038846297 8:31232787-31232809 AATGACTTGCTTCACAGAATTGG - Intergenic
1038870214 8:31485646-31485668 AATGACTTGCTTCACAGAATTGG - Intergenic
1038872906 8:31515660-31515682 AATGACTTGCTTCACAGAATTGG - Intergenic
1039639217 8:39201147-39201169 AATGACTTTCTTCACAGAAATGG - Intronic
1039926592 8:41939243-41939265 AGTGACTTCCTTCCAGTAAAGGG + Intronic
1040321545 8:46310829-46310851 AATGACTTTCTTCAAAGAATTGG - Intergenic
1040458700 8:47625855-47625877 AGTGACTTTCTTCACAGAATTGG + Intronic
1040748086 8:50670660-50670682 AATGACTTTCTTCAAAGAATTGG + Intronic
1041128373 8:54668493-54668515 AATGACTTTCTTCACAGAAATGG + Intergenic
1041184453 8:55284731-55284753 CGTGACTTGCTTCTAATGAATGG - Intronic
1041423959 8:57699714-57699736 AGTGACTTTCTTCACAGAACTGG + Intergenic
1041478173 8:58288485-58288507 AATGACTTGCTTCACAGAATTGG - Intergenic
1041547006 8:59056827-59056849 TCTGACTTGCTGCCAAGAAAGGG - Intronic
1041961120 8:63616984-63617006 AGTGACTTTCTTCACAGAATTGG - Intergenic
1041973144 8:63766573-63766595 AGTGACTTTCTTCACAGAATTGG - Intergenic
1042362533 8:67898869-67898891 AGTGACTTTCTTCACAGAATTGG + Intergenic
1042541530 8:69912150-69912172 AGTGACTTTCTTCACAGAATTGG + Intergenic
1042720788 8:71824863-71824885 AATGACTTTCTTCACAGAAATGG + Intergenic
1042750079 8:72148968-72148990 AATGACTTTCTTCACAGAAATGG - Intergenic
1042784573 8:72534354-72534376 AGTACCCTGCTTCCCAGAAATGG + Intergenic
1043003312 8:74786341-74786363 ATTGACTGGTTTCCAAGATACGG - Intronic
1043030827 8:75131355-75131377 AGTTAGTTGCTTCCAAGATGGGG - Intergenic
1043495197 8:80792501-80792523 AGTGACCTGCTTCTAGCAAAGGG + Intronic
1044042718 8:87389719-87389741 AATGACTTTCTTCACAGAAATGG + Intronic
1044140579 8:88646654-88646676 AGTGACTTTCTTCACAGAATTGG - Intergenic
1044165330 8:88975619-88975641 ACTGACTTCCTTCAAAGAACTGG + Intergenic
1044353116 8:91189822-91189844 AGTGACTTAATTCAGAGAAATGG + Intronic
1044830630 8:96244485-96244507 AATCACTTGAATCCAAGAAACGG - Intronic
1045083588 8:98654952-98654974 AGTGACTTTCTTCACAGAATTGG + Intronic
1045844555 8:106618106-106618128 AGTGAGCTGCTTTCAAGAAGAGG - Intronic
1045882811 8:107061206-107061228 AGTGACTTTCTTCACAGAATTGG - Intergenic
1045898380 8:107245083-107245105 AATGACTTTCTTCCCAGAATTGG + Intergenic
1045933119 8:107649721-107649743 ACTGACTTTCTTCCCAGAATTGG - Intergenic
1045949333 8:107833824-107833846 AATGACTTTCTTCCCAGAATTGG - Intergenic
1046046513 8:108972057-108972079 AAAGCCTTTCTTCCAAGAAATGG - Intergenic
1046292961 8:112186494-112186516 AGTGACTTTCTTCACAGAATTGG + Intergenic
1046879910 8:119296638-119296660 AATGACTTTCTTCCCAGAATTGG + Intergenic
1047008453 8:120645687-120645709 AATGACTTGCTTCACAGAATTGG - Intronic
1047473022 8:125197714-125197736 AATGACTTTCTTCAAAGAATTGG - Intronic
1047494826 8:125402061-125402083 AGTGACTCGCTGCCAAAAATAGG - Intergenic
1048540727 8:135339995-135340017 AGTGACTTTCTTCCCAGAATTGG + Intergenic
1050189686 9:3011569-3011591 AATCACTGGGTTCCAAGAAATGG + Intergenic
1050505137 9:6340470-6340492 AATGACTTTCTTCAAAGAATTGG + Intergenic
1050597706 9:7220595-7220617 AGTGACTTTCTTCACAGAATTGG + Intergenic
1050887385 9:10782885-10782907 AATGACTTTCTTCAAAGAACTGG + Intergenic
1050901201 9:10951111-10951133 AATGACTTTCTTCAAAGAACTGG + Intergenic
1051519829 9:17973688-17973710 AGTGACTTTCTTCACAGAATTGG - Intergenic
1051741752 9:20259124-20259146 TGTGAATTGTTTCCAAGAATTGG + Intergenic
1053225193 9:36348936-36348958 AGTGCCTGGCTTCAAAGAACAGG + Intronic
1054997774 9:71411715-71411737 AGTGACTTTCTTCACAGAATTGG + Intronic
1055556540 9:77479546-77479568 AATGACTTTCTTCAAAGAATTGG - Intronic
1055754938 9:79548186-79548208 AATGACTTTCTTCAAAGAATTGG + Intergenic
1055767490 9:79680140-79680162 AATGACTTTCTTCAAAGAATTGG - Intronic
1056972683 9:91220688-91220710 CCTGGCTTGCTTCCAAGTAAAGG - Intronic
1057096898 9:92319097-92319119 TGTTAATTGCCTCCAAGAAAGGG + Intronic
1058004125 9:99897191-99897213 AGTTACTGGCTTTAAAGAAAAGG + Intergenic
1058012432 9:99993131-99993153 AGTGACTTTCTTCACAGAATTGG + Intronic
1058088689 9:100779757-100779779 AGTGACTTTCTTCACAGAATTGG + Intergenic
1058090457 9:100800149-100800171 AGTGACTTTCTTCACAGAATTGG + Intergenic
1058284470 9:103158919-103158941 AGAGATTTGCTTCAAAGAATTGG + Intergenic
1058305404 9:103435113-103435135 AGTGACTTTCTTCACAGAATTGG - Intergenic
1058499785 9:105601352-105601374 AGTGACTTGCTTTCAGATAATGG + Intronic
1058557264 9:106183143-106183165 AATGACTTGCTTCACAGAATTGG - Intergenic
1058572649 9:106364247-106364269 AGTTATATGCTTCCAAAAAATGG + Intergenic
1059880407 9:118683141-118683163 GGTGACTGGATTCCAAGACAGGG - Intergenic
1059952746 9:119483721-119483743 AGTGATTTGCTTCTAACAAATGG + Intergenic
1060121031 9:120989894-120989916 GTTGACTTGCTTCTCAGAAACGG + Intronic
1061508216 9:131044554-131044576 AGTGACTTGCTTCTAATGACTGG + Intronic
1202802510 9_KI270720v1_random:13126-13148 AATGACTTTCTTCACAGAAATGG - Intergenic
1203410714 Un_KI270581v1:6392-6414 AATGACTTTCTTCCCAGAATTGG + Intergenic
1186133182 X:6491676-6491698 AATGACTTCCTTCTAATAAATGG + Intergenic
1186354635 X:8777563-8777585 ACTGACTTTCTTCAAAGAAATGG + Intergenic
1186442926 X:9601452-9601474 AGTGACTGGCTTCCAGGAGCAGG - Intronic
1186577813 X:10785434-10785456 AATGACTTTCTTCAAAGAATTGG + Intronic
1186782516 X:12927366-12927388 AATGACTTTCTTCAAAGAATTGG + Intergenic
1187182439 X:16955721-16955743 TGTGACTTGCTTCTAACTAATGG - Intronic
1187571927 X:20513133-20513155 AGCTACTTGCTTCAAATAAAAGG - Intergenic
1188291969 X:28400655-28400677 AATGACTTTCTTCCCAGAATTGG + Intergenic
1188778962 X:34256373-34256395 TGTGACTTGCTTCCAACCAAAGG - Intergenic
1188906270 X:35795812-35795834 CGTGACTTTATTGCAAGAAAAGG + Intergenic
1189539026 X:41966951-41966973 AGTGACTTGCTTGTAACCAATGG + Intergenic
1190274681 X:48892154-48892176 AGGGACTGGCTTGCAAGAAAGGG + Intergenic
1190539472 X:51462161-51462183 ATTGACATGGCTCCAAGAAATGG - Intergenic
1190590246 X:51992827-51992849 AGTGACTTTCTTCACAGAATTGG - Intergenic
1191003117 X:55682679-55682701 AGTGACTTTCTTCACAGAATTGG - Intergenic
1191794411 X:65005199-65005221 ATTGACTTTCTTCAAAGAATTGG + Intronic
1191964453 X:66741901-66741923 AATGACTTTCTTCAAAGAATTGG - Intergenic
1191998514 X:67122917-67122939 AATGACTTTCTTCAAAGAATTGG - Intergenic
1192258239 X:69484347-69484369 ACTGACTTTCTTCAAAGAATTGG - Intergenic
1192389015 X:70705319-70705341 AGTGACTTTCTTCACAGAATTGG - Intronic
1192389616 X:70712313-70712335 AGTGACTTTCTTCACAGAATTGG - Intronic
1192951330 X:76020320-76020342 AGTGACTTTCTTCACAGAATTGG + Intergenic
1193025947 X:76846175-76846197 AGTGACTTGCTTCACAGAATTGG + Intergenic
1193367756 X:80655185-80655207 AATGACTTTCTTCAAAGAACTGG + Intergenic
1193419496 X:81266729-81266751 ACTGACTTTCTTCAAAGAATTGG - Intronic
1193522466 X:82548061-82548083 AGTGACTTTCTTCACAGAATTGG - Intergenic
1193581181 X:83265017-83265039 AGTGACATTCTTCAAAGAACTGG + Intergenic
1193957531 X:87880583-87880605 AATGACATTCTTCAAAGAAATGG - Intergenic
1194519205 X:94897507-94897529 AGTGACTTTCTTCACAGAATTGG - Intergenic
1195338994 X:103886434-103886456 AGTGACTTTCTTCACAGAATTGG - Intergenic
1195389142 X:104342867-104342889 TGTCACTTGCCTCAAAGAAATGG - Intergenic
1195749227 X:108147474-108147496 AGTGACTGGCCTCCAACAAAAGG - Intronic
1195921828 X:109991293-109991315 AGTGACTTACTTGCCAGACAGGG + Intergenic
1196293251 X:113968382-113968404 AATGACTTTCTTCATAGAAATGG + Intergenic
1196617126 X:117779065-117779087 AATGACTTTCTTCACAGAAATGG - Intergenic
1196941636 X:120782547-120782569 AAGGACTTGCTTTTAAGAAATGG + Intergenic
1197991166 X:132319033-132319055 AATGACTTTCTTCACAGAAATGG + Intergenic
1198113144 X:133520580-133520602 AGTGACTTGTTTCTAATGAATGG - Intergenic
1198592822 X:138202890-138202912 AATGACTTGCTTCACAGAATTGG + Intergenic
1199004387 X:142677775-142677797 ATTGAGTGCCTTCCAAGAAATGG - Intergenic
1199154625 X:144532927-144532949 AGTGACTTTTTTCCAAAAAGTGG + Intergenic
1200551431 Y:4583341-4583363 AGTGACTTTATTGGAAGAAAAGG + Intergenic
1200565214 Y:4756469-4756491 AGTGACTTGCTTCACAGAATTGG + Intergenic
1201124551 Y:10901178-10901200 AGTGAGATCCTTCCAAAAAAAGG - Intergenic
1201249874 Y:12046193-12046215 AATGACTTTCTTCTAAGAATTGG + Intergenic
1201421870 Y:13808250-13808272 ATTGACTTTCTTCAAAGAACTGG - Intergenic
1201527073 Y:14948249-14948271 AATGACTTTCTTCAAAGAATTGG - Intergenic
1201768013 Y:17590961-17590983 AGTGACTTTCTTCACAGAATTGG + Intergenic
1201778318 Y:17690878-17690900 AGTGACTTTCTTCACAGAATTGG - Intergenic
1201823238 Y:18215114-18215136 AGTGACTTTCTTCACAGAATTGG + Intergenic
1201833540 Y:18315024-18315046 AGTGACTTTCTTCACAGAATTGG - Intergenic
1202058959 Y:20866163-20866185 AATGACTTTCTTCCCAGAATTGG - Intergenic
1202350219 Y:23981836-23981858 AGTGACTTTCTTCACAGAATTGG - Intergenic
1202383087 Y:24295944-24295966 AATGACTTGCTTCACAGAATTGG - Intergenic
1202487697 Y:25374177-25374199 AATGACTTGCTTCACAGAATTGG + Intergenic
1202520560 Y:25688285-25688307 AGTGACTTTCTTCACAGAATTGG + Intergenic