ID: 1128957945

View in Genome Browser
Species Human (GRCh38)
Location 15:71969463-71969485
Sequence TATACATTTCGGAGCAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128957945_1128957952 22 Left 1128957945 15:71969463-71969485 CCCCCTCTGCTCCGAAATGTATA 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1128957952 15:71969508-71969530 GATTCCAAGCTCCAAAGCATAGG 0: 1
1: 0
2: 1
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128957945 Original CRISPR TATACATTTCGGAGCAGAGG GGG (reversed) Intronic
903250701 1:22051492-22051514 TATAAATTTGGGGGAAGAGGAGG + Intergenic
903369811 1:22828053-22828075 CAAACATTTCAAAGCAGAGGTGG + Intronic
903720931 1:25405108-25405130 AGTACTTTTCGGAGCCGAGGTGG + Intronic
904487311 1:30835340-30835362 AATACATGTCTGAGCAGATGAGG + Intergenic
907150568 1:52283073-52283095 TATACATTTTGGAACAGACAGGG - Intronic
908673860 1:66578916-66578938 TGTACTTTGGGGAGCAGAGGAGG - Intronic
908836704 1:68235388-68235410 GATGCATTTCAGAGCAGAGGGGG - Intergenic
911163286 1:94702714-94702736 GATACATTCCAGAGCAAAGGAGG - Intergenic
917452175 1:175156322-175156344 TAAACATTCTGGTGCAGAGGAGG - Intergenic
923101714 1:230822526-230822548 TATTCATTTGGCAGGAGAGGTGG - Intergenic
1063742491 10:8839058-8839080 AACACATTCTGGAGCAGAGGGGG + Intergenic
1063862914 10:10331714-10331736 TATAGATTTTGGAGCACAGCTGG - Intergenic
1064518711 10:16177758-16177780 TATATATCTGGGAGGAGAGGGGG + Intergenic
1065695470 10:28375934-28375956 TCAACATTTTGAAGCAGAGGAGG - Intergenic
1067820207 10:49521682-49521704 GATACAGTTCAGTGCAGAGGAGG + Intronic
1069649457 10:70034409-70034431 TAAACACTTTGGAGCAGAGCAGG + Intergenic
1070747710 10:78944773-78944795 TAGACATGAGGGAGCAGAGGAGG + Intergenic
1076259816 10:129056309-129056331 TCTACATTACAGAGAAGAGGGGG - Intergenic
1076468411 10:130701769-130701791 AAGACAATTTGGAGCAGAGGTGG - Intergenic
1077644477 11:3911228-3911250 AATAGACTTCTGAGCAGAGGTGG - Intronic
1082625004 11:55473640-55473662 TACACATCTGGGAGTAGAGGAGG - Intergenic
1086348731 11:85923863-85923885 AAGAGATTTCAGAGCAGAGGTGG + Intergenic
1093656412 12:21699689-21699711 TATATATTTCTGAGCAGATATGG + Intronic
1095635590 12:44429483-44429505 TATAAATTTAGGAGCAGTGAGGG + Intergenic
1095854434 12:46844588-46844610 TTTAGATTTCAGAGCAGTGGAGG + Intergenic
1097803237 12:63938227-63938249 TTTACATTTAGAAGCAGAGGAGG - Intronic
1100081571 12:90858458-90858480 TATACATGTCTGAGAAGGGGAGG + Intergenic
1100104497 12:91152626-91152648 TAAACTTTTCAGAGAAGAGGGGG + Intronic
1104831164 12:131752727-131752749 TGTGCATTTAGGAGCATAGGTGG + Intronic
1116659901 14:47696711-47696733 TATGAATTTGGGGGCAGAGGTGG - Intergenic
1119142429 14:72279490-72279512 TATATATTTCTGAGCAGAGTAGG - Intronic
1120680856 14:87479047-87479069 TGTCCATTTAGGATCAGAGGAGG - Intergenic
1128638494 15:69318274-69318296 AATGCATCTCGAAGCAGAGGGGG + Intronic
1128957945 15:71969463-71969485 TATACATTTCGGAGCAGAGGGGG - Intronic
1141868170 16:86765427-86765449 TGTACTTTTCGAAGCTGAGGTGG - Intergenic
1146288294 17:31589756-31589778 TATACATTTCAAAGTTGAGGGGG - Intergenic
1146777732 17:35636819-35636841 TATACATTTCTGAGAAGAAAAGG - Intronic
1147940128 17:44040682-44040704 TATACATTTCCGGCCAGGGGAGG + Intronic
1148834669 17:50459759-50459781 TATCCATTTCAGTGCACAGGTGG - Intronic
1158142584 18:54270407-54270429 AATACTTTTCGAAGCTGAGGTGG - Intronic
1161373935 19:3929289-3929311 CATTCATTTCGGGGCACAGGGGG + Intergenic
1167140498 19:47647520-47647542 TATGCATAGCGGGGCAGAGGTGG - Intronic
1167986191 19:53318618-53318640 TATACTTTTATGAACAGAGGTGG - Intergenic
928563533 2:32517572-32517594 TATACATTTTGGGGGTGAGGTGG + Intronic
931363591 2:61599515-61599537 TATACATTTTGCAGGGGAGGGGG - Intergenic
933544337 2:83691494-83691516 TATAAATTTGGGGGGAGAGGTGG + Intergenic
937648738 2:124296763-124296785 TATACATTTATGGGGAGAGGGGG - Intronic
1169556684 20:6758631-6758653 AATACATTCAAGAGCAGAGGAGG - Intergenic
1169968878 20:11247452-11247474 TCTAGATTTGGGGGCAGAGGGGG + Intergenic
1169993813 20:11534218-11534240 TATCCCTTTCAGTGCAGAGGAGG - Intergenic
1177814979 21:25966340-25966362 TATACATTGGTGAGCAAAGGGGG - Intronic
1178230364 21:30776729-30776751 TATGAATTTGGTAGCAGAGGTGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178693908 21:34776321-34776343 TTTACATTTGGTAGCAGAGGGGG - Intergenic
1178936406 21:36866184-36866206 TGTATGTTTCGGGGCAGAGGTGG + Intronic
1179406689 21:41132159-41132181 TATCCACTTCTGAGAAGAGGTGG - Intergenic
950063921 3:10095840-10095862 TATAAATTTAGAACCAGAGGAGG - Intronic
956841338 3:73142867-73142889 AATATATTTAGGAGCAGAGAAGG + Intergenic
957314207 3:78556841-78556863 TATACATTTCTGTGCAAAGAGGG - Intergenic
958483018 3:94668430-94668452 CATACATTTCAGAACACAGGTGG - Intergenic
967105010 3:186248624-186248646 TTTACATTTCTGATAAGAGGTGG + Intronic
974263354 4:59553569-59553591 GAAACATTTAGGAGCACAGGTGG - Intergenic
978855351 4:113388054-113388076 TATACCTTTGGGAGCAGCTGGGG - Intergenic
979385302 4:120057834-120057856 TACACATTTTGGAGCTGAGTGGG - Exonic
987106828 5:14647736-14647758 TATACATTTTTTAGTAGAGGCGG + Intergenic
990057592 5:51603444-51603466 TTTACATGTCGGAGCAAGGGTGG - Intergenic
993659737 5:90618248-90618270 TGTACATTTGGTAGCAGGGGAGG - Intronic
994812081 5:104532867-104532889 AAGACATTTCACAGCAGAGGTGG + Intergenic
995072653 5:107942268-107942290 TAGAAAGTTCAGAGCAGAGGTGG + Intronic
995752461 5:115467866-115467888 TATACACTGCTGAGCAGAAGAGG + Intergenic
1012643801 6:101654823-101654845 GAAAGATTTCAGAGCAGAGGTGG - Intronic
1015740742 6:136450807-136450829 GATACATTTCTGTGAAGAGGAGG + Intronic
1016315418 6:142780319-142780341 TAGACATTGTGGATCAGAGGAGG - Intronic
1018367691 6:163138338-163138360 TGTCCATTTGGGGGCAGAGGTGG - Intronic
1022041584 7:26586893-26586915 AAGACATTTAGGAGCAGAGGTGG - Intergenic
1024536717 7:50440940-50440962 TCTACATTTCTGAGCAGAAATGG + Intergenic
1033881786 7:145893220-145893242 TATACAGTTCCCAGCAGAGAAGG + Intergenic
1036089674 8:5652006-5652028 GATTCATTTTGGCGCAGAGGAGG - Intergenic
1044884945 8:96767033-96767055 GATACATTTAGTAGCAGATGAGG - Intronic
1047478837 8:125261062-125261084 TTTACATTTCGGTGAAAAGGGGG + Intronic
1050579261 9:7033658-7033680 TCTCCATTACAGAGCAGAGGTGG - Intronic
1053448210 9:38169708-38169730 TATACATTTCCTTGAAGAGGGGG - Intergenic
1186091426 X:6052755-6052777 TATACATTTAGAAGCAGTTGCGG - Intronic
1197982195 X:132228689-132228711 TGTTCATTTCTGAGGAGAGGTGG - Intergenic
1200878203 Y:8182186-8182208 TATACATTTCTAAGCTGATGTGG + Intergenic