ID: 1128960020

View in Genome Browser
Species Human (GRCh38)
Location 15:71992833-71992855
Sequence TTATAATCTTGGGCTAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128960020 Original CRISPR TTATAATCTTGGGCTAGAAG AGG Intronic
901712938 1:11130031-11130053 TTATTATCTTGGGCTGACAGTGG + Intronic
902824083 1:18960680-18960702 TTAGAAGGCTGGGCTAGAAGGGG - Intergenic
903503668 1:23817203-23817225 TTAGACTTTAGGGCTAGAAGAGG + Intronic
906464570 1:46065138-46065160 TTATAATATTTGGGTAGAAGTGG - Intronic
906718823 1:47990720-47990742 ATATAATCTTGGGCAAGACTTGG - Intronic
908304490 1:62798130-62798152 TTTAAATCTTGGGGTAGAAAAGG - Intronic
909508411 1:76421511-76421533 TTATACTCTTGGGCTTCAGGAGG + Intronic
911366951 1:96950135-96950157 TTATAATGTTTGGCGTGAAGTGG + Intergenic
914019526 1:143853336-143853358 CTATAATCTTGGGATAAAAATGG - Intergenic
916296236 1:163223282-163223304 TTAGAATCCTAGGATAGAAGTGG - Intronic
919505406 1:198391977-198391999 GTATATTCTTGGGCACGAAGAGG + Intergenic
919899548 1:202034098-202034120 TTATACCCTTGGGCTGGATGGGG + Intergenic
920838937 1:209537615-209537637 TTAGAATCTTGGGATAAAAATGG + Intergenic
921137270 1:212272987-212273009 TGAGAATCTTGGGGTAGAAGAGG - Intergenic
922272352 1:224045349-224045371 TTATTGTCTTGAGCCAGAAGTGG - Intergenic
1065242901 10:23725837-23725859 TTATAATTTTGGTCTAGAATTGG - Intronic
1067127933 10:43536048-43536070 TTATAATCTTAGTAGAGAAGGGG - Intergenic
1070107911 10:73453551-73453573 CTATAATGTTTGGCTAGATGTGG - Intronic
1070990729 10:80730042-80730064 TTATTGTCTTGGTCTGGAAGAGG + Intergenic
1070996581 10:80788875-80788897 TTATTATTTTGTGCCAGAAGAGG + Intergenic
1071228282 10:83557202-83557224 TTATCTTTTTGGGCCAGAAGTGG - Intergenic
1075433375 10:122410071-122410093 ATATAATGTTGGGCTAGGCGCGG - Intronic
1077031024 11:467465-467487 ATATATTCTTGGGCTGGACGTGG + Intronic
1077657418 11:4033938-4033960 ATATAATGTTGGGCCAGATGCGG + Intronic
1078125703 11:8560627-8560649 TTATAATCTTGGGGCAGAGAAGG - Intronic
1081271955 11:41095629-41095651 TTCTAACCCTGGGATAGAAGTGG + Intronic
1081444826 11:43120561-43120583 TTCTAATCTAAGGGTAGAAGTGG - Intergenic
1081713147 11:45230859-45230881 CTAAAATCTTCAGCTAGAAGGGG + Intronic
1083127615 11:60587416-60587438 TTATAGTCTTGGGCCAGAGATGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1087863244 11:103190627-103190649 TTATAATATTGGAGTAGAAGTGG + Intronic
1089902847 11:122006130-122006152 TTATAATCTTGGTGTTTAAGAGG + Intergenic
1093306818 12:17530511-17530533 TTGTAATGTTGGGCTAAAACTGG - Intergenic
1093775446 12:23068434-23068456 TTACAATCTTGGGCCAGGTGCGG - Intergenic
1093784389 12:23175651-23175673 TTTTAATCCTGGGCCACAAGAGG + Intergenic
1094573488 12:31662669-31662691 TGATAAGCTTGGGTTAGAATGGG - Intronic
1095635069 12:44423227-44423249 ACATAGTCTTGGGCTAGGAGTGG - Intergenic
1097053387 12:56236802-56236824 TTATCAGCTGGGGCTAGGAGAGG + Intronic
1097745272 12:63294899-63294921 TGATAATCTTGGCCTACAATAGG + Intergenic
1097766863 12:63535969-63535991 TAATAATCTTGGAATAGAACTGG - Intergenic
1097783210 12:63730900-63730922 TAATAATCTTGGAATAGAACTGG - Intergenic
1098119323 12:67219416-67219438 TTATTATCTTGGCCAAGAATGGG + Intergenic
1099980562 12:89596897-89596919 TTATAATCTGGTACTAAAAGAGG - Intronic
1105473016 13:20708493-20708515 TTATAATCTTGGAGTGGAGGAGG + Intronic
1107595229 13:41956681-41956703 TTATATCCTTGGGCTACAATAGG - Intronic
1107775298 13:43833587-43833609 TAATGAACTAGGGCTAGAAGAGG + Intronic
1108632179 13:52295598-52295620 TTAAAATCTTGGGGTAGAGAAGG + Intergenic
1108654522 13:52516996-52517018 TTAAAATCTTGGGGTAGAGAAGG - Intergenic
1108984853 13:56573782-56573804 TTATAATTTCTGGTTAGAAGAGG - Intergenic
1111156630 13:84336540-84336562 TTATTCTCTTGGTCTAGAATCGG - Intergenic
1112185271 13:97122157-97122179 GGATAATCTTGGGCTCCAAGAGG - Intergenic
1112244009 13:97712431-97712453 TTATAATATAGGGTTAGAATGGG - Intergenic
1114056988 14:18978693-18978715 TTAAAATCTTGAGCTAGAGATGG - Intronic
1114105558 14:19423053-19423075 TTAAAATCTTGAGCTAGAGATGG + Intronic
1114338805 14:21721416-21721438 TTTTAATTTTGTGCTAGAAATGG - Intergenic
1115250983 14:31347499-31347521 TGATAGCTTTGGGCTAGAAGTGG - Intronic
1116123180 14:40747609-40747631 TTATACTGTTCAGCTAGAAGAGG - Intergenic
1118851991 14:69591212-69591234 TAATTATCTAGGGCTAAAAGAGG - Intergenic
1119295471 14:73529447-73529469 CTAGGAACTTGGGCTAGAAGGGG + Intronic
1119299116 14:73557174-73557196 CTAGGAACTTGGGCTAGAAGGGG + Intronic
1119594354 14:75920239-75920261 TTTTATTGTTGGGCTACAAGAGG - Intronic
1123498448 15:20855502-20855524 TTAAAATCTTGAGCTAGAGATGG + Intronic
1123555683 15:21429130-21429152 TTAAAATCTTGAGCTAGAGATGG + Intronic
1123591925 15:21866461-21866483 TTAAAATCTTGAGCTAGAGATGG + Intergenic
1126217367 15:46171757-46171779 ATATGATCTTAGGCTAGCAGAGG + Intergenic
1126737090 15:51741420-51741442 TTATAACCTTGGGATAGCAAAGG + Intronic
1127102831 15:55584890-55584912 TTATAATCTAGGTCTATTAGTGG + Intronic
1128960020 15:71992833-71992855 TTATAATCTTGGGCTAGAAGAGG + Intronic
1128998006 15:72310864-72310886 TTAGAATCTTGGGCTTTAACAGG - Intronic
1132336694 15:101052541-101052563 TTATGATCTTGGGTTAGCATAGG - Intronic
1202964024 15_KI270727v1_random:156340-156362 TTAAAATCTTGAGCTAGAGATGG + Intergenic
1137345194 16:47651186-47651208 TTATAACCTTGGGCTTTTAGGGG + Intronic
1138135628 16:54519034-54519056 TTATAATCCAGGCCTAGAAATGG + Intergenic
1138587870 16:57983483-57983505 TTATAATCTTGGGATGGGAAAGG - Intronic
1141833801 16:86525061-86525083 TTATAATGTTGGGATAGGAAAGG - Intergenic
1142070431 16:88088741-88088763 TTATCATTTTGAGCTAGAATAGG + Intronic
1147233208 17:39034778-39034800 ATATAATCATGGGCTGGGAGTGG - Intergenic
1148037773 17:44681065-44681087 TTCTCATCTTGGGCTAGAAAAGG - Intronic
1148085335 17:44990485-44990507 TTTTCTTCTTGGGGTAGAAGGGG - Intergenic
1148970206 17:51473376-51473398 CCATCATTTTGGGCTAGAAGGGG + Intergenic
1150411903 17:64951792-64951814 TTATAGTCTGGGGTCAGAAGAGG - Intergenic
1150581274 17:66476207-66476229 TTCTACTCTTGGACTGGAAGGGG + Intronic
1150789353 17:68188955-68188977 TTATAGTCTGGGGTCAGAAGAGG + Intergenic
1150873165 17:68938132-68938154 TTATAATCTTGAATCAGAAGTGG + Intronic
1153467833 18:5408913-5408935 TTATGCCCTTGTGCTAGAAGAGG + Intronic
1153558138 18:6339525-6339547 TTATCATCATGAGCTAGAAAAGG + Intronic
1154456452 18:14531927-14531949 TTAAAATCTTGAGCTAGAGATGG + Intronic
1155267665 18:24109435-24109457 TTATAAAGTTGGCCTAGAATTGG + Intronic
1155862103 18:30914827-30914849 TTAAAATCTAGGGCTAGACAAGG + Intergenic
1155980655 18:32176522-32176544 TCATAATCTCGGCCTAGAACAGG - Intronic
1156283864 18:35671045-35671067 TTATGATCTTGGGGTAGGAAAGG + Intronic
1156718963 18:40046605-40046627 TTCTAATCTTGAGTTAGCAGGGG + Intergenic
1159370784 18:67525119-67525141 TTATAATCTGTGGATAGAAAAGG + Intergenic
1162315926 19:9937801-9937823 TGATACTGTTGGGCTAGGAGGGG + Intergenic
1165182683 19:33986169-33986191 TTAAAATCATGAGCAAGAAGGGG + Intergenic
1167110942 19:47460755-47460777 CTATTATCTTGGGCTTGCAGAGG + Intronic
926493692 2:13557762-13557784 TTATAATGTTGGCAAAGAAGAGG - Intergenic
929385841 2:41405486-41405508 ATATAATCTTTGGGTAGAAGAGG + Intergenic
929844660 2:45510632-45510654 TTTTAGTCTTGGGCCTGAAGTGG - Intronic
931573537 2:63696166-63696188 TTATAAATTTTGGCTAGGAGGGG + Intronic
932910789 2:75804299-75804321 TAATATTCTTGGGCTTGGAGAGG - Intergenic
935888619 2:107650993-107651015 TTATGAGCTTGGGGTAGCAGAGG + Intergenic
936778765 2:116006279-116006301 TTATAATCTTGGAGTAGAAAAGG + Intergenic
938285317 2:130109442-130109464 TTAAAATCTTGAGCTAGAGATGG + Intronic
938335966 2:130497981-130498003 TTAAAATCTTGAGCTAGAGATGG + Intronic
938353858 2:130622684-130622706 TTAAAATCTTGAGCTAGAGATGG - Intronic
938430283 2:131229453-131229475 TTAAAATCTTGAGCTAGAGATGG - Intronic
938475099 2:131602636-131602658 TTAAAATCTTGAGCTAGAGATGG - Intergenic
939587776 2:144026076-144026098 TTATAATCTAGGGTTAGAAGAGG + Intronic
939639867 2:144627502-144627524 TAAGAATCTTGGGGTAGGAGTGG + Intergenic
939843081 2:147212229-147212251 TGATATTCTTGAGATAGAAGAGG - Intergenic
940562968 2:155325109-155325131 TTATAATATTGGGGAAGAAAAGG + Intergenic
944133452 2:196371788-196371810 TTAAAATCCTGGGTTAGGAGAGG - Intronic
945863228 2:215147765-215147787 TTATAATCTTGGAATATCAGGGG - Intergenic
1169578473 20:6992328-6992350 TTATAAGCTTGTGCTGAAAGGGG + Intergenic
1170901771 20:20470303-20470325 TTATAATATTTAACTAGAAGTGG - Intronic
1174872165 20:54192916-54192938 TTCCAAGGTTGGGCTAGAAGAGG - Intergenic
1176817712 21:13621410-13621432 TTAAAATCTTGAGCTAGAGATGG - Intronic
1176884536 21:14239062-14239084 TTATCACTTTTGGCTAGAAGAGG - Intergenic
1178389873 21:32189449-32189471 TTATAATTTTTGTCAAGAAGGGG + Intergenic
1180475475 22:15701305-15701327 TTAAAATCTTGAGCTAGAGATGG - Intronic
1181949284 22:26542465-26542487 TAATATTCTTGGGCCAGATGGGG - Intronic
1184395211 22:44231469-44231491 TTTTAAACTTTGGCCAGAAGTGG - Intergenic
950413328 3:12853399-12853421 ATATAATCTTGTGCAAGAACTGG + Intronic
951236864 3:20246382-20246404 TTATACTCCTGGGATACAAGAGG - Intergenic
952639891 3:35580428-35580450 TTATAATCTTGGACAAGATGTGG - Intergenic
953113322 3:39965991-39966013 TTATAATCTTGGGCCAGGAAAGG + Intronic
955457761 3:59142884-59142906 GTATAATCTTAACCTAGAAGGGG + Intergenic
955817186 3:62856914-62856936 TTATAATCTTTGGATAGAGAAGG + Intronic
961919426 3:130410459-130410481 TTATATTTTTAGGGTAGAAGTGG + Exonic
963178133 3:142323108-142323130 ATATAATCATGCGCTAGATGCGG - Intronic
966922435 3:184621929-184621951 TTATAACCTTGGGGTAGGAAAGG + Intronic
967127875 3:186441943-186441965 ATATAATTTTAGGCTAGATGCGG - Intergenic
970141552 4:12988027-12988049 TAATCTTCTTTGGCTAGAAGTGG - Intergenic
972400350 4:38696128-38696150 TTTTAATTTTAGGCTGGAAGTGG - Intronic
974660668 4:64884262-64884284 TGGTAATCTTGGGCTCTAAGAGG - Intergenic
978401589 4:108336551-108336573 TAATTATCTTGGGGCAGAAGGGG - Intergenic
984470132 4:180158801-180158823 TTATAATTTTAGGCCAGAAAGGG - Intergenic
984977968 4:185246772-185246794 TTATAATCTTGGAATGGAAAAGG - Intronic
985225579 4:187757780-187757802 TCAAAATCTTGTGCTAAAAGAGG + Intergenic
986670591 5:10139678-10139700 TTCTAGCCTTGGGCCAGAAGTGG + Intergenic
989036824 5:37182343-37182365 TTATACTCTCAGGCCAGAAGAGG - Intronic
989267091 5:39487328-39487350 TAATAATCTTGGTCTAGGAAGGG + Intergenic
992223336 5:74593991-74594013 TTAGAATCTTGTTCAAGAAGGGG - Intergenic
992892655 5:81218181-81218203 TTTTAATCTTGCGGTGGAAGAGG + Intronic
998569373 5:143243779-143243801 TTAGAATCTTGAGGTAGGAGAGG - Intergenic
998779549 5:145641076-145641098 TTACAATATTGGGGTAGAAAAGG + Intronic
1001134843 5:169093832-169093854 TTATAAGCATGGCCTTGAAGAGG + Intronic
1004790911 6:19025571-19025593 TTGTAATCTTGGGGTAAAAAAGG - Intergenic
1020461128 7:8431636-8431658 ATATAATATTGGGGGAGAAGTGG - Intergenic
1027623869 7:80524801-80524823 TTTTATTCTTGAGCTAGCAGTGG - Intronic
1029102445 7:98143262-98143284 TTATCATCTTGGGATACGAGAGG + Intronic
1032183163 7:129699320-129699342 TTCTACTCTTTGGGTAGAAGAGG - Intronic
1033858248 7:145592303-145592325 ATATAATATTGGGCTTGAACAGG + Intergenic
1038764902 8:30418401-30418423 CTGTAATCATTGGCTAGAAGAGG + Intronic
1039236193 8:35505236-35505258 TTATAATTTTGGGATAAATGTGG + Intronic
1039671313 8:39602560-39602582 TTAAAATCTTAGACCAGAAGAGG - Intronic
1040129120 8:43773940-43773962 TTATTATCTTGGGCTATTTGGGG - Intergenic
1043103551 8:76079318-76079340 TTTTAATCCTGGGTTAGGAGAGG + Intergenic
1043407511 8:79952930-79952952 TTATAATCTTGTGCTTTAACTGG - Intronic
1043611747 8:82072696-82072718 TTAGAAACTTGGACTAGAAGTGG - Intergenic
1047258161 8:123232331-123232353 TTATAATTTTTGGCCAAAAGGGG + Intronic
1047511896 8:125521822-125521844 TTATAATCTTGGTAGAGATGGGG - Intergenic
1048818004 8:138352071-138352093 TAATACTCTAGGTCTAGAAGGGG + Intronic
1050080373 9:1909457-1909479 TTATAGTCTAGGTCTAGAACAGG + Intergenic
1050365236 9:4867992-4868014 TGGCATTCTTGGGCTAGAAGGGG + Intronic
1050397346 9:5213580-5213602 CAATAATCTTGGTCTGGAAGTGG + Intergenic
1050423229 9:5488623-5488645 TTAAAATCTCTTGCTAGAAGAGG + Intergenic
1050495388 9:6235445-6235467 TTATAATCTTGGAAGAGAAAAGG + Intronic
1051721706 9:20044064-20044086 TTATAATCTTTTGCTGGTAGAGG - Intergenic
1055176600 9:73325578-73325600 TTCTAATCTTGGTCTACATGAGG - Intergenic
1057435302 9:95034889-95034911 TTATGAACTTGGGAGAGAAGTGG + Intronic
1058042905 9:100323948-100323970 TTATAGTCATGGTCAAGAAGAGG + Intronic
1058213043 9:102197096-102197118 TTATATTCTTGGGTAAGATGGGG - Intergenic
1059462207 9:114439531-114439553 ATGTAATGTTGGCCTAGAAGAGG + Intronic
1059564886 9:115374099-115374121 TTTTCATCGTGGGCCAGAAGGGG + Intronic
1061171317 9:128957427-128957449 ATAGAATCTTGGGCTATTAGAGG + Intronic
1203529648 Un_GL000213v1:128091-128113 TTAAAATCTTGAGCTAGAGATGG + Intergenic
1187589392 X:20699875-20699897 TTGTCTTTTTGGGCTAGAAGAGG - Intergenic
1187690450 X:21860895-21860917 TTATAATCTTGAGGTGGAAAAGG + Intronic
1189208924 X:39266358-39266380 ATATGATCTTGGGCAAGCAGTGG - Intergenic
1192161021 X:68787541-68787563 CTAGATTCTTGGTCTAGAAGAGG + Intergenic
1194480160 X:94412139-94412161 TTATATTTTAGTGCTAGAAGAGG + Intergenic
1195169258 X:102249901-102249923 TTTTAATCCAGGGCTATAAGGGG - Intergenic
1195189599 X:102437187-102437209 TTTTAATCCAGGGCTATAAGGGG + Intronic
1195834774 X:109102198-109102220 TAATACTCTTGGGCAAGAATTGG + Intergenic
1197647587 X:129034745-129034767 TTGTAATCTTCAGCTAGAAAAGG - Intergenic
1199112596 X:143952752-143952774 TTGTCATCTTGGGCTAGTATGGG + Intergenic
1199306502 X:146272970-146272992 TTGTAAAATTGGGATAGAAGAGG - Intergenic
1200152166 X:153956581-153956603 TTATAATCTAGGGGTGGCAGGGG + Intronic
1201691676 Y:16774041-16774063 TTCTAATATGGGGCTATAAGTGG - Intergenic