ID: 1128966136

View in Genome Browser
Species Human (GRCh38)
Location 15:72060532-72060554
Sequence AGAGATAGCACAGAGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 8, 3: 78, 4: 421}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128966130_1128966136 14 Left 1128966130 15:72060495-72060517 CCATGTTGTCCAGAGACAGAATC 0: 1
1: 0
2: 4
3: 26
4: 232
Right 1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG 0: 1
1: 0
2: 8
3: 78
4: 421
1128966129_1128966136 27 Left 1128966129 15:72060482-72060504 CCTCTAGCAGCAGCCATGTTGTC 0: 1
1: 1
2: 4
3: 49
4: 570
Right 1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG 0: 1
1: 0
2: 8
3: 78
4: 421
1128966131_1128966136 5 Left 1128966131 15:72060504-72060526 CCAGAGACAGAATCTGTGTACCT 0: 1
1: 0
2: 1
3: 17
4: 214
Right 1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG 0: 1
1: 0
2: 8
3: 78
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128966136 Original CRISPR AGAGATAGCACAGAGATTGT GGG Intronic
903143178 1:21352274-21352296 AGAGAAAGGGCAGAGGTTGTGGG + Intergenic
904486060 1:30825097-30825119 AGAGGGAGCACGGAGGTTGTGGG + Intergenic
904950850 1:34237556-34237578 AGAGATAGGTGAGAGATTGAGGG - Intergenic
905397659 1:37677426-37677448 GCAGTTAGCACAGAGATTGATGG - Intergenic
905705763 1:40056104-40056126 AGAGAAATCAGAGAGATTGGAGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906390931 1:45415433-45415455 AGCGAAAGCACAAAGATTATGGG - Intronic
907263019 1:53236239-53236261 AGAGACAGCACAGAGGCTGTTGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908212317 1:61913551-61913573 AGAGCTAGCACAGATAATCTTGG - Intronic
908276464 1:62477699-62477721 AGAGATATCTCACAGATTGGAGG - Exonic
909575388 1:77170310-77170332 GGAGGTAGCATAGAGAATGTGGG - Intronic
910010540 1:82456033-82456055 AAACATAGCACAAAGATTGGTGG + Intergenic
910328104 1:86034438-86034460 AGTTAAAGCACAGAGAGTGTAGG + Intronic
910560149 1:88581621-88581643 GGAGATTGCCCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913982631 1:143536045-143536067 AGAGATCGCATTGAGTTTGTGGG + Intergenic
914639020 1:149584482-149584504 AGCAAGAGCACAGAGATTCTAGG - Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917722254 1:177796892-177796914 AGAGAAACCACAGAAATTGAGGG - Intergenic
917920464 1:179745324-179745346 AGAGAAAAAACAGAGATTCTTGG - Intronic
917970978 1:180207517-180207539 AGAGAGAGGACAGAGAATATAGG + Intergenic
918686005 1:187416469-187416491 AGAAAAAGCACAAAGATTGCAGG - Intergenic
919501191 1:198340149-198340171 ATAGATATCACAGAGATAGATGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922447857 1:225712619-225712641 AGAGATAGAAAGTAGATTGTTGG - Intergenic
922865897 1:228861413-228861435 TGAGATAGCACAGAAATATTTGG + Intergenic
924135861 1:240966079-240966101 AGAGATAAGACAAAGATGGTAGG - Intronic
924681191 1:246235778-246235800 AGAGAGAGCTTAGAGCTTGTAGG - Intronic
1063629673 10:7722089-7722111 AAAGAAAGCACAGAGATTACGGG + Intronic
1064278039 10:13925184-13925206 AGAGATATCACAGGGATGGTGGG + Intronic
1064416518 10:15154689-15154711 AGTGAGAGCACAAAGATTCTAGG + Intronic
1064717586 10:18192670-18192692 AGAGACAGAACACAGATTGGTGG - Intronic
1065374462 10:25024090-25024112 AGAAAGAGCACAGATACTGTTGG + Exonic
1065883473 10:30058152-30058174 ATAGATAACCCAGAGATTGAGGG - Intronic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1067406061 10:46024420-46024442 AGAGAGAGAACAGAGACCGTTGG - Intronic
1068059149 10:52045240-52045262 CTAGATAGGACAGATATTGTGGG - Intronic
1068741700 10:60480796-60480818 AGAGTTTGCACAGAGCTTGGGGG - Intronic
1069723421 10:70563393-70563415 AGAGATTTCCCAGAGAGTGTGGG - Intronic
1069905864 10:71731731-71731753 AGAGATAGGACAGAAAGAGTTGG - Intronic
1070286752 10:75089134-75089156 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1070658651 10:78289167-78289189 ATAGATAGCACACTGATGGTGGG - Intergenic
1071185544 10:83039883-83039905 AAAGAGAGCAAATAGATTGTAGG + Intergenic
1071253127 10:83841304-83841326 AGAAATTGCACAGAGATGGTCGG - Intergenic
1071721396 10:88150060-88150082 ATAGATAGCTCACAGATTTTAGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072927547 10:99629705-99629727 AGAGACAGAACACAGATTGGTGG + Intergenic
1073618844 10:105026115-105026137 ACAGATAGCTCTGAGACTGTGGG - Intronic
1073820305 10:107254440-107254462 AGAGAAAGGAAAGAGAATGTAGG + Intergenic
1074669145 10:115768111-115768133 AGAGGTAGCACACAAATTATAGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075830076 10:125401359-125401381 ATACCTAGCAGAGAGATTGTTGG + Intergenic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078660299 11:13280336-13280358 ATAAATTCCACAGAGATTGTTGG - Intronic
1078791360 11:14545890-14545912 AAAGATAGGGCAGAGATTGGGGG + Intronic
1079312209 11:19377103-19377125 AGAAAAAGGACAGAGATTGCTGG - Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080040250 11:27752647-27752669 GGAGACTGCACAGAGATCGTGGG + Intergenic
1080393539 11:31870201-31870223 AAAGATAGCACAGAGAGGCTGGG + Intronic
1080562898 11:33480260-33480282 AGAGATAGAAAGGAGATTGGCGG - Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081978954 11:47254327-47254349 AGAGATGTCACAGAGATGGCTGG - Intronic
1082844998 11:57717925-57717947 AGTGAGAGCACAAAGATTCTAGG + Intronic
1083276212 11:61598450-61598472 GGAGACAGCACATAGATTCTGGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1085549008 11:77349449-77349471 AGAGGTAGTACAGAGAATGTAGG + Intronic
1086790303 11:91029112-91029134 AAAGATAGGACAGAGATTTCTGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1086964534 11:93014120-93014142 AGAGATAGAACACAGATTTTTGG - Intergenic
1086998157 11:93383424-93383446 AGAGATAGAACATAGATTAGTGG + Intronic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089971782 11:122699390-122699412 AGAGATAGCATAGAGGTTGCAGG - Intronic
1090177760 11:124666334-124666356 AGAGATACCACAGAGAATATTGG - Intronic
1090381963 11:126333685-126333707 GGAGACAGCACTGAGATGGTAGG + Intronic
1092029544 12:5272794-5272816 GGAGATAGGCCAGAGATGGTGGG + Intergenic
1092029555 12:5272881-5272903 GGAGATAGGCCAGAGATGGTCGG + Intergenic
1092029566 12:5272968-5272990 AGAGATAGGCCAGAGATGGTGGG + Intergenic
1092112099 12:5971117-5971139 AGAAATAGCAGAGGGACTGTGGG + Intronic
1092473909 12:8802923-8802945 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1093418907 12:18951813-18951835 AAAGATAGCACAGAGGTTAGAGG - Intergenic
1094478637 12:30862273-30862295 AGTGAGAGCACAAAGATTATAGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095450129 12:42321927-42321949 AGAGATAGCTTGGAGATCGTTGG - Intronic
1095869641 12:47012210-47012232 AGAGACAGGACAGATATTATTGG + Intergenic
1095902394 12:47341499-47341521 AGTGAGAGCACAAAGATTATAGG + Intergenic
1096152614 12:49323928-49323950 AGAGACATCACAAAGATTGGTGG + Exonic
1096860258 12:54521479-54521501 AGTGAGAGCACAGATTTTGTTGG - Intronic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098113404 12:67148268-67148290 AGAGGTAGTCCAGAGATTTTGGG + Intergenic
1098698363 12:73589573-73589595 AAAGATAGAACAGAGATTCTAGG + Intergenic
1098785917 12:74755486-74755508 AGAGACAGAACACAGATTGGTGG - Intergenic
1098976765 12:76910560-76910582 AGAGAAAGTACAGAGAGTGAAGG - Intergenic
1099199612 12:79660099-79660121 AAACATACCACAGACATTGTCGG + Intronic
1099526013 12:83720341-83720363 AGAGAAAGAGCAGAAATTGTGGG + Intergenic
1099781570 12:87202330-87202352 TGAGATAATACAGTGATTGTGGG + Intergenic
1100145176 12:91668862-91668884 AGAGATAGTAGAAAGATTGATGG - Intergenic
1100838644 12:98590613-98590635 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1101010156 12:100441149-100441171 AGAGAGAGCACAGAGAAGGTAGG - Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1104180853 12:126379113-126379135 AGAGATGACACAGAAAATGTAGG + Intergenic
1104384797 12:128341198-128341220 AGAAAGAGCACAGAGTTTTTGGG - Intronic
1106630394 13:31466158-31466180 AAAGATAGCTCAGACATGGTAGG - Intergenic
1107089880 13:36467103-36467125 AGAGATTGCACTGAGACTGTAGG + Intergenic
1107417315 13:40212583-40212605 AGAGTAAGCACAGAGTCTGTCGG - Intergenic
1107947951 13:45436725-45436747 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1108686261 13:52821408-52821430 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1109630366 13:65037254-65037276 AGAGAGAGAAAAGAGATGGTTGG + Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110277955 13:73660922-73660944 TGAGAGGGCACAGAAATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114191170 14:20440434-20440456 AGAGATAGAAAAGAGGTTTTAGG - Intergenic
1114820428 14:26011235-26011257 AGAGAGAGTAAAGAGATTGGAGG + Intergenic
1115986600 14:39108808-39108830 AGTGAGAGCACAAAGATTATAGG - Intronic
1116046179 14:39745900-39745922 AGAGACAGAACTGAGAGTGTAGG - Intergenic
1116288655 14:43004920-43004942 AGTGATAGCAGACATATTGTTGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117858457 14:60061660-60061682 AAAAATAGGAAAGAGATTGTAGG - Intronic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118699739 14:68421590-68421612 AGCGAGAGCACAAAGATTCTAGG + Intronic
1119855795 14:77899722-77899744 AGAGAAACCACAGAGCTTATGGG + Intronic
1119930871 14:78544906-78544928 AGAGACAGCAGGGAGATTCTGGG + Intronic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120499859 14:85282710-85282732 AGAAATACCCCAGAGAATGTTGG - Intergenic
1121351443 14:93176490-93176512 AAAGAGAGCACAGATTTTGTAGG + Intergenic
1125214264 15:37252144-37252166 AGAGACAGAAAGGAGATTGTTGG + Intergenic
1126856968 15:52848035-52848057 AGAGTTAGCACAAGGAATGTGGG + Intergenic
1127135078 15:55911346-55911368 AGAGAAATCAAAGAGATTCTAGG - Intronic
1127856419 15:62957378-62957400 AGAGCTTGCACAGAGTTTGGAGG - Intergenic
1128698559 15:69787684-69787706 AGAGGTAGGGGAGAGATTGTGGG - Intergenic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129260206 15:74362132-74362154 AGCGAGAGCACAAAGATTCTAGG - Intronic
1129469947 15:75747348-75747370 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1131472196 15:92707201-92707223 AGAGATATCACAGATTTTGTTGG - Intronic
1132138603 15:99369240-99369262 AGTGATAGAAAAGAGATTATTGG - Intronic
1133855321 16:9544211-9544233 AGAGAGGGCACAGAGATTTCTGG - Intergenic
1134893218 16:17860105-17860127 AGAAATATCAAAGAGATTTTAGG - Intergenic
1135029647 16:19028143-19028165 AGATATAGCAGAAACATTGTAGG - Intronic
1136938319 16:34497253-34497275 AGAGATGGCAGTGAGTTTGTGGG - Intergenic
1136961500 16:34851304-34851326 AGAGATGGCAGTGAGTTTGTGGG + Intergenic
1137455922 16:48617815-48617837 AGTGCTACTACAGAGATTGTCGG + Intronic
1137507911 16:49071628-49071650 AGTAATAGCACAAAGATTGGGGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139267356 16:65652477-65652499 AGAGACAGAAGAGAGATTATGGG + Intergenic
1139845977 16:69921742-69921764 AGAGATGCCCCAGAAATTGTCGG - Intronic
1140548960 16:75842763-75842785 AGAGATATCAGAGTTATTGTGGG + Intergenic
1141137454 16:81475601-81475623 AGTGAGAGCACAAAGATTCTAGG + Intronic
1141361463 16:83398905-83398927 AGAGATAGGACAAAAAATGTTGG + Intronic
1143727064 17:8856226-8856248 AGAAATAGCACAGAGTTTCTGGG + Intronic
1144484094 17:15650852-15650874 AGAGATCGCACAGAGACAGTGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146127477 17:30240299-30240321 AGAGATTGCAGATAGATCGTGGG - Intergenic
1146147215 17:30430318-30430340 AGAGACAGAACAAAGATTGGTGG - Intronic
1148293571 17:46478882-46478904 AGGGATGGTAGAGAGATTGTGGG + Intergenic
1148315757 17:46696584-46696606 AGGGATGGTAGAGAGATTGTGGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150216275 17:63472180-63472202 AGAGATAGCACAAAGATTAGAGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150863315 17:68823478-68823500 AGAGGTAGCAAATAGATTGGAGG - Intergenic
1151120856 17:71791265-71791287 AGAGAAAGCCCAGGGATTGGAGG - Intergenic
1151168898 17:72229001-72229023 AGAGTTGGTAAAGAGATTGTTGG - Intergenic
1153322199 18:3784558-3784580 AGAGAACGCACTGACATTGTGGG - Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156071070 18:33210155-33210177 AGACATAGTACTGAGATTTTAGG + Intronic
1159034606 18:63264771-63264793 AGAGATAGCCAAGAGATTTGTGG + Intronic
1164655961 19:29922058-29922080 AGTGAGAGCACAAAGATTATAGG - Intergenic
1165193718 19:34084872-34084894 AGAGGTAGCACACAGGTTATGGG + Intergenic
1165393197 19:35549950-35549972 AGAGAAAGCCCAGAGGTGGTAGG + Intergenic
1167204686 19:48093088-48093110 AGATTTAGCAAAGAGATGGTGGG + Intronic
1167586904 19:50380520-50380542 AGAGGTCCCCCAGAGATTGTGGG - Intronic
1167681691 19:50926970-50926992 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1168177637 19:54636095-54636117 AGAGAAAGGGCAGAGAGTGTGGG + Intronic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925815504 2:7744114-7744136 TGAGATGGCTCAGGGATTGTTGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926686022 2:15698278-15698300 AGAGCTAGCACAGTGATGCTGGG - Intronic
927474109 2:23399203-23399225 AGTGACAGCACAAAGATTCTAGG - Intronic
927791257 2:26011545-26011567 AGCTATAGCACAGAGAACGTGGG + Intergenic
928099454 2:28427429-28427451 AGAGACAGAACACAGATTGGTGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928591062 2:32815785-32815807 AGAGTTAGCCCAGAGATAGCGGG - Intronic
929031562 2:37654150-37654172 AGACATAGCCCACAGATGGTTGG - Intronic
930072169 2:47375432-47375454 AAGAATAGCACAGAGATTCTGGG + Intronic
930139767 2:47939623-47939645 AGTGACAGCACAAAGATTATAGG + Intergenic
930207368 2:48601683-48601705 AAAGAGATCAGAGAGATTGTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933720195 2:85392752-85392774 AGAGATAGCAGGGAGATTGCTGG + Intergenic
934197166 2:89848189-89848211 GGAGAGAGCACAGGGAATGTAGG - Intergenic
936168871 2:110150097-110150119 ATAAATAGCACAGAGTATGTGGG - Intronic
936542542 2:113363899-113363921 AGAGAGAGCACACAGTCTGTCGG - Intergenic
937426117 2:121800576-121800598 AGAGATAGAAAAGAGATTAGTGG + Intergenic
938042666 2:128088839-128088861 AGTGGTAGCACAGAGCTTCTAGG - Intergenic
938129435 2:128699092-128699114 ACTGATACCACAGAAATTGTAGG + Intergenic
939666490 2:144958941-144958963 ATAGATAGCAATGATATTGTAGG + Intergenic
940777101 2:157896560-157896582 AGACAGAGAACAGAGGTTGTGGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942343845 2:174980176-174980198 AGAGATAGCAGAGGGTGTGTTGG - Intronic
942477121 2:176339166-176339188 AGTGAGAGCACAAAGATTATGGG - Intergenic
943044814 2:182847935-182847957 AGAGAAAGCAAAGAAATTGAGGG + Intronic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
944550159 2:200838331-200838353 AGAGAGGGCGCAGAGTTTGTGGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169671444 20:8106947-8106969 AAAGATAACACAGAAATTGGGGG - Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170016022 20:11783158-11783180 AGAGATATCACAGAGGTAGTGGG + Intergenic
1170099114 20:12679031-12679053 AGAGATAGCCCAGAAAGTGAAGG - Intergenic
1171248089 20:23629363-23629385 AGAGAAGGCACAGAGCCTGTGGG + Exonic
1171361940 20:24592438-24592460 AGACATTGCTCAGAGAGTGTGGG + Intronic
1171959355 20:31482718-31482740 CAGGATAGCACAGAGACTGTAGG - Intronic
1172745263 20:37202855-37202877 AGAGATAGAACATAGATTGCTGG + Intronic
1172794989 20:37530629-37530651 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176718018 21:10370563-10370585 ATAGATAGTAGAGAGATGGTAGG - Intergenic
1177091111 21:16769713-16769735 AGAGATAGGACACAGAATGTAGG - Intergenic
1177271832 21:18858362-18858384 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1178113953 21:29398132-29398154 AGAGACAGGAAAGAGAATGTGGG - Intronic
1178712665 21:34933046-34933068 AGAGTTTGCACAAAAATTGTGGG + Intronic
1179215200 21:39361515-39361537 AGACAGAGCACAGAGACTTTTGG + Intergenic
1180299246 22:11023473-11023495 ATAGATAGTAGAGAGATGGTAGG - Intergenic
1181541063 22:23573609-23573631 AGAGATGGCAGAGGGAGTGTGGG + Intronic
1181550964 22:23638966-23638988 AGAGATGGCAGAGGGAGTGTGGG + Intergenic
1181797318 22:25319721-25319743 AGAGATGGCAGAGGGAGTGTGGG - Intergenic
1182385457 22:29936097-29936119 AGAGATAGCAGAAGGATAGTTGG - Intronic
1182389373 22:29978957-29978979 GGAGAGAGCACAGAGTTTGTGGG + Exonic
1184744578 22:46448892-46448914 AGAGAAAGCACACAGATAGGAGG + Intronic
949334093 3:2954577-2954599 AGAGAAAAATCAGAGATTGTTGG - Intronic
949407307 3:3728094-3728116 ACAGATAGCTAAGAGATTGTAGG - Intronic
949602252 3:5612872-5612894 AGAGAGAGCACAGATATTCCTGG - Intergenic
949774534 3:7617750-7617772 AGAGATAGGAAAGAGTTTGGAGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951153066 3:19315372-19315394 AGAGCTATCACAGAGAGTGCAGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951884837 3:27514147-27514169 AGAGACAGAAAAGAGATTATTGG - Intergenic
952419630 3:33119360-33119382 AGACGTACCACTGAGATTGTAGG + Intronic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
952935725 3:38397007-38397029 AGAGGGAACACAGACATTGTGGG - Intronic
953358260 3:42272682-42272704 AGAAAAAGCACAGAGATCATGGG + Intergenic
953658637 3:44873943-44873965 AGCGAGAGCACAAAGATTCTAGG - Intergenic
954210789 3:49095915-49095937 AGAGATAACACACAGACTCTAGG + Exonic
955523726 3:59799901-59799923 GGAGATTGCTCAGATATTGTGGG + Intronic
955604809 3:60690114-60690136 AGTGAAAGCACAAAGATTCTAGG + Intronic
956159567 3:66334959-66334981 AGAGATAGAAAATAGAATGTAGG - Intronic
956416163 3:69032278-69032300 AGGAATAGCACAGAGATAGTTGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957181861 3:76888842-76888864 AGAGGTTGCACAGAGATTAGAGG - Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957954772 3:87172174-87172196 TGAAACAGCACAGAGAATGTTGG - Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958818075 3:98939733-98939755 AGAGAAAGTACAGAGGTTTTTGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959719553 3:109471218-109471240 AGCGAGAGCACAAAGATTCTAGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960380990 3:116961435-116961457 AGTGTTAGCACAGAGATTATAGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960939437 3:122923701-122923723 GGAGATAGCACTGAGGTTGAAGG + Exonic
961075156 3:123975557-123975579 AGACACAACACAGAGGTTGTGGG + Intronic
961308539 3:125976965-125976987 AGACACAACACAGAGGTTGTGGG - Intronic
961378153 3:126480644-126480666 AGAGACAGGACAGAGTGTGTAGG - Intergenic
961638172 3:128347123-128347145 AGTGTTAGCACAGAGACAGTGGG - Intronic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962365876 3:134780434-134780456 AGAGATAGCAAATAGATTAGTGG - Intronic
962774185 3:138643406-138643428 AGTGAGAGCACAAAGATTATAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963828798 3:149984886-149984908 AGAGATAGCACAAAGATTATAGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964520286 3:157558953-157558975 AGAGATAGAAAACAGATTGGTGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965107102 3:164370870-164370892 AGAGATAATACTGAGATTTTAGG + Intergenic
965248894 3:166315546-166315568 AGAGATAGTACAGACAGTTTGGG + Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965490408 3:169328185-169328207 AGAGACAACAAAGAGATAGTTGG - Intronic
966041029 3:175488212-175488234 AGAAATTGAACAAAGATTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
972090614 4:35277234-35277256 AGACATAGGACAGCAATTGTGGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972789030 4:42352904-42352926 TGAGAGAGCAGAGAGATTGAAGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975778533 4:77816774-77816796 AAAGACAGGACAGAGAATGTGGG - Intronic
975950377 4:79763103-79763125 AGAGATACCACAGAGCTTTCTGG - Intergenic
976391557 4:84510309-84510331 AGAGATAGAACATAGATTAGTGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978472264 4:109082004-109082026 AGAGATAGAAAAGAGATTAGTGG - Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979734257 4:124063076-124063098 AGTGAGAGCACAAAGATTCTAGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980103454 4:128564900-128564922 AGAGAAAGCAGAGAGATTGGAGG + Intergenic
980275654 4:130646787-130646809 AGAGATAGCACAGAGAAAGAGGG - Intergenic
980327486 4:131366878-131366900 AAAGATTGCACAGAGGTTATTGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981160998 4:141498436-141498458 AGAGATAGGAAAGAGAGAGTGGG - Intergenic
981360660 4:143842052-143842074 AGAGATTACATAGAGATTATAGG + Intergenic
981371417 4:143963110-143963132 AGAGATTACATAGAGATTATAGG + Intergenic
981380502 4:144066316-144066338 AGAGATTACATAGAGATTATAGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982443444 4:155462750-155462772 ATAGGTAGCACAGAGAATTTTGG + Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982969154 4:161958925-161958947 AGAGATAGAACTGAGAATCTAGG - Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
984408246 4:179362534-179362556 AGAGAATACACAGAGTTTGTTGG + Intergenic
986091491 5:4512561-4512583 AGCGACAGGACAGAGACTGTAGG - Intergenic
986588643 5:9345934-9345956 AGAGAAGGCAGAGAGATTCTAGG + Intronic
988269799 5:28999292-28999314 ACAGATGGCACACAGATTTTAGG + Intergenic
989121652 5:38010304-38010326 AGAAAGAGAACAGACATTGTTGG - Intergenic
989432794 5:41375184-41375206 AGAGAGAGCCCAGAGAAAGTAGG + Intronic
989564872 5:42892205-42892227 AGCGAGAGCACAAAGATTATAGG + Intergenic
990301965 5:54458439-54458461 AGAGATTGCAGAGAGATTAGTGG + Intergenic
991495048 5:67218312-67218334 TGAGTTAGCACAGGGATTTTGGG + Intergenic
991958483 5:72018998-72019020 AGAGATAGGAGAGAAATTGCAGG - Intergenic
992185009 5:74235466-74235488 AGAGAAAGCACAGAGAGTTGGGG - Intergenic
992562953 5:77970728-77970750 AGAGATAGCAGAGCCAGTGTTGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
992966663 5:82009488-82009510 AGCGAGAGCACAAAGATTCTAGG + Intronic
993826685 5:92696361-92696383 AGAGGTAGCTGAGAGATTGGGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994806422 5:104452739-104452761 GGACAAAGCACAGAGCTTGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995259531 5:110085913-110085935 AGAGGCAGCACAGAGAGGGTTGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997516416 5:134492993-134493015 AGCGCTGGCAAAGAGATTGTGGG + Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999077324 5:148808714-148808736 AGAAATATCACAGAGGTAGTAGG - Intergenic
999126086 5:149247255-149247277 AGAGACAGAACATAGATTGCTGG + Intronic
999392218 5:151201748-151201770 AGAGCTGGCAGAGAGAGTGTGGG + Intronic
1000260205 5:159580874-159580896 ATAGCTAGCTCAGAAATTGTTGG + Intergenic
1001281941 5:170392289-170392311 AGAGAGAGCACAGAGCAGGTGGG - Intronic
1003550795 6:7100620-7100642 AGAGAAACCACACAGAATGTGGG - Intergenic
1004989971 6:21125865-21125887 CGGGGAAGCACAGAGATTGTGGG - Intronic
1007642392 6:43352513-43352535 AGAAATAGAAAAGAGAATGTTGG - Intronic
1008730697 6:54479387-54479409 AGAGAAAGAACAAAGATTGGGGG - Intergenic
1009629534 6:66176536-66176558 AGTGATAGAATAGAGATTGATGG + Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011558224 6:88590462-88590484 AGAGACAGCACAGAACTTGATGG + Intergenic
1011812917 6:91153968-91153990 AGAGGTAGCAGAGAGCTTATAGG - Intergenic
1012241774 6:96880822-96880844 AGAGATGAGACAGAGAATGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013347000 6:109270298-109270320 AGAGATAGGAAAGAGAAAGTAGG - Intergenic
1013885734 6:114963991-114964013 ATAGATAGAACACAGATTGGGGG - Intergenic
1014234515 6:118939592-118939614 AGGGATAGCATAGAGATTATGGG + Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1015350031 6:132207628-132207650 AAAAATAGCAGAGAGATTCTGGG - Intergenic
1015702944 6:136056058-136056080 AGAGGTGGCACAGAGAATGAGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016106434 6:140170172-140170194 AGAGATAGAACAGAGATAATGGG - Intergenic
1016152844 6:140765629-140765651 AGAGACAGAACACAGATTGGTGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018564747 6:165139422-165139444 TGAGATGACACAGAGACTGTGGG + Intergenic
1018675432 6:166217698-166217720 AGAGATAGGCCACAGATTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021372776 7:19870589-19870611 AGAGATGGCACAGAAAGTGCAGG - Intergenic
1021685893 7:23185350-23185372 AGAGAAACAACAAAGATTGTAGG - Intronic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023945728 7:44801508-44801530 AGCGAGAGCACAAAGATTCTAGG - Exonic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024725712 7:52191734-52191756 AGAGACAGAACATAGATTGCTGG + Intergenic
1024882096 7:54098743-54098765 ATAGGGAGCACAGAGATTTTGGG + Intergenic
1024945193 7:54800916-54800938 AGAAATGGCACAGTGAGTGTGGG - Intergenic
1025291690 7:57731521-57731543 TGAGATAGCAAAGAGAGTGAGGG - Intergenic
1025474919 7:60907339-60907361 AGAGATCGCAGTGGGATTGTGGG + Intergenic
1025512084 7:61582535-61582557 AGAGATCGCAGTGGGATTGTGGG - Intergenic
1025563285 7:62398705-62398727 AGAGATAGCAGTGGGTTTGTGGG + Intergenic
1026608628 7:71837492-71837514 AGAGATATCACTGAGTTTTTAGG + Intronic
1026613236 7:71879499-71879521 TGAGAAAGAGCAGAGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028180581 7:87717553-87717575 ATATATAACAGAGAGATTGTAGG - Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028516854 7:91687399-91687421 TGAGCTAGAACAGAAATTGTGGG - Intergenic
1028904995 7:96143525-96143547 AGTTATAGCACAGAGGATGTAGG - Intronic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029049465 7:97669473-97669495 GCAGCTAGCACAGAGATTCTGGG - Intergenic
1030327015 7:108230363-108230385 AGAGAGAGTAGAGAGACTGTTGG - Intronic
1030362664 7:108611097-108611119 AGAGAAAGCACAAGGATTCTGGG - Intergenic
1031259169 7:119494593-119494615 ATATATAGCAGAGAGATTGTAGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1032302546 7:130701322-130701344 AAAGATAGAACACAGATTGGTGG - Intergenic
1033236027 7:139638373-139638395 AGAGCCAGCACAGAGACAGTGGG - Intronic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034821712 7:154222251-154222273 AGAGAAAGCACAGAGGCGGTGGG - Intronic
1035264410 7:157683289-157683311 AGAGCTTGCACAATGATTGTCGG + Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035822007 8:2603314-2603336 TAAGATTGCACAGAGATTGTGGG - Intergenic
1037030051 8:14093426-14093448 AGAGATAGGCCAGATCTTGTAGG - Intronic
1040462614 8:47663253-47663275 AGAGATAGCACTGGGGTGGTGGG - Intronic
1041243433 8:55869083-55869105 AACGATGGCACAGAGACTGTTGG + Intergenic
1041469565 8:58193677-58193699 AGTGATAGCACAAAGAAGGTTGG + Intronic
1041704008 8:60825993-60826015 TGAAATAGCCCAAAGATTGTGGG - Intronic
1043540061 8:81251818-81251840 AGAGACAGAACACAGATTGGTGG + Intergenic
1044046098 8:87434415-87434437 AGACATACCACAGGCATTGTGGG - Intronic
1044368953 8:91385631-91385653 AGGGATAGCACAGAGGAAGTTGG + Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046204708 8:110978248-110978270 AGAGCTTGCAAAGAGGTTGTGGG - Intergenic
1046268878 8:111866798-111866820 AGAGACAGGGTAGAGATTGTAGG - Intergenic
1046328940 8:112688173-112688195 GGAGATGGCAAACAGATTGTGGG - Intronic
1046557192 8:115789941-115789963 AGAGATGGCACAGTGGCTGTGGG + Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049272331 8:141702572-141702594 AGAGGTAGAGCAGGGATTGTGGG - Intergenic
1051088144 9:13376018-13376040 AGAGGTAGAACAGAGATGTTTGG - Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052602771 9:30658748-30658770 GGAAATAGCACTGAGAGTGTGGG - Intergenic
1053499321 9:38571008-38571030 AGACACAGCACAGAGACTGCAGG + Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055292047 9:74792362-74792384 AGAGTTAGCACTGTTATTGTGGG - Intronic
1056057187 9:82838195-82838217 AGAGACAGAACACAGATTGGTGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059496202 9:114711331-114711353 AGAAATAGCACAAAACTTGTGGG + Intergenic
1059737005 9:117110930-117110952 AGAGATTATACACAGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1061677528 9:132226805-132226827 AGAGATGTCAGAGAGCTTGTGGG - Intronic
1185625464 X:1478365-1478387 AGAGATTGCAGAGAGGTTGTAGG + Intronic
1186037527 X:5441006-5441028 AGAGATAACAAAAAGATTGGAGG + Intergenic
1186485574 X:9932251-9932273 TGAGATAGTTCAGAGAATGTGGG - Exonic
1187018259 X:15351738-15351760 AGACTTAGCACAAAGAATGTAGG + Intronic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1188071920 X:25727688-25727710 AGAGACAGCATAGTGATTATGGG - Intergenic
1188082059 X:25855266-25855288 AGTGATAACACATAGCTTGTGGG - Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188750606 X:33901215-33901237 AGAAATAGAACAGAAATTCTAGG + Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189666630 X:43362095-43362117 TGAGAGAGGACAGAGAATGTTGG - Intergenic
1190009474 X:46771597-46771619 AGAGACAGAACACAGATTGGTGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192065289 X:67878842-67878864 AGAGAGAACACAAAAATTGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192880935 X:75283625-75283647 ATAGATAGCTCATAGCTTGTAGG + Intronic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194942289 X:100025827-100025849 AGAGATAGAAAGGAGATTGATGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195363541 X:104106987-104107009 GGAGATAGGAATGAGATTGTGGG - Intronic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196379447 X:115073299-115073321 AGAGACAGAACATAGATTGATGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196657250 X:118231505-118231527 ACAGATTGTACAGAGATGGTAGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197843086 X:130771153-130771175 AAAGATGGCACAGAGATTTCTGG - Intronic
1198419328 X:136453607-136453629 AGATATAGCACAGAGATGTGAGG - Intergenic
1198620159 X:138499153-138499175 AGAGATAGCACAGGCCTTGAGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200895524 Y:8372135-8372157 ATAGGTAGCACAGAGAATTTTGG - Intergenic