ID: 1128973754

View in Genome Browser
Species Human (GRCh38)
Location 15:72132813-72132835
Sequence AAATGATAGTAGGAATGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128973754_1128973757 -10 Left 1128973754 15:72132813-72132835 CCTCCACATTCCTACTATCATTT 0: 1
1: 0
2: 1
3: 27
4: 274
Right 1128973757 15:72132826-72132848 ACTATCATTTCTCCTGCTTTAGG 0: 1
1: 0
2: 1
3: 19
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128973754 Original CRISPR AAATGATAGTAGGAATGTGG AGG (reversed) Intronic
906068659 1:43001476-43001498 AAAACATAGTAGGAAAATGGAGG - Intergenic
907891630 1:58642077-58642099 AATGGAGAGTAGGGATGTGGAGG - Intergenic
908013958 1:59813240-59813262 CAATGATCTTAGGAATGTGGAGG + Intergenic
908311317 1:62887536-62887558 AAATGATGGTAGGAATTTATGGG + Intergenic
908559064 1:65286633-65286655 AAAAGATGGTAGGAGTGTGTTGG + Intronic
909150505 1:71996959-71996981 GAATTATAGTAGGGAGGTGGAGG - Intronic
909181598 1:72430747-72430769 AAATGATGGTGAGGATGTGGAGG + Intergenic
909951145 1:81721868-81721890 ACCTGATAGTAAGAAGGTGGAGG + Intronic
911419930 1:97628011-97628033 TAATGATAGTAGGAATGAAAGGG + Intronic
911522900 1:98949647-98949669 AGTTGATAATAGGAATGTTGGGG - Intronic
913687751 1:121249301-121249323 AAATGAAAGTAAGAATTTAGTGG + Intronic
914039609 1:144036949-144036971 AAATGAAAGTAAGAATTTAGTGG + Intergenic
914149847 1:145030988-145031010 AAATGAAAGTAAGAATTTAGTGG - Intronic
915192588 1:154164157-154164179 AAAAAAGAGTAGGAAAGTGGTGG - Intronic
915389020 1:155524120-155524142 AAATGATAGTGGGTGTGTGTTGG - Intronic
916291143 1:163167567-163167589 AATTGACAGGAGGAATGTGTAGG + Intronic
916431782 1:164736890-164736912 AAAGGAGAGTGGGAATATGGTGG + Intronic
916607887 1:166361037-166361059 AAATGAGAGCAGGAATTTGGGGG + Intergenic
917243997 1:172980751-172980773 AAATGATAATGGGAATGTTGTGG - Intergenic
918428311 1:184433159-184433181 CCATGATTGTAGGGATGTGGTGG + Intronic
919175547 1:194014315-194014337 AAATTAAAGAAGTAATGTGGTGG + Intergenic
919497853 1:198298646-198298668 AAATGATAGCAAGAATGTCAGGG + Intronic
919578895 1:199346759-199346781 TAATTCTAGTAGGAATCTGGAGG - Intergenic
920237060 1:204515124-204515146 AAATGAAATTAGGTATTTGGGGG - Intergenic
920475076 1:206267823-206267845 AAATGAAAGTAAGAATTTAGTGG + Intronic
920628453 1:207627198-207627220 AAGAGAGACTAGGAATGTGGGGG - Intronic
920917154 1:210267044-210267066 ACCTGATAGTAAGAAGGTGGAGG - Intergenic
921574105 1:216814145-216814167 AAATGACAATAGCATTGTGGTGG - Intronic
924072410 1:240295132-240295154 AAATAATAGTACTGATGTGGGGG + Intronic
924279955 1:242426527-242426549 ATATTATAGTTGTAATGTGGTGG - Intronic
924537092 1:244944890-244944912 AAATGTTGGTGGGGATGTGGAGG + Intergenic
1062951014 10:1503516-1503538 AAATGATACAATGAATGTGAAGG - Intronic
1063292387 10:4762549-4762571 AAATGATATTATGAATTTAGGGG + Intergenic
1063403997 10:5775291-5775313 AAAAGATAGTAATAAAGTGGGGG + Intronic
1063613216 10:7580673-7580695 AGAAGACAGCAGGAATGTGGAGG + Intronic
1063768515 10:9170754-9170776 GAATGATAGTAGCAATGAGTAGG + Intergenic
1067686344 10:48468160-48468182 AAATAAAGGCAGGAATGTGGTGG - Intronic
1067833596 10:49624324-49624346 AAATGTTTGTAGCAATGTGATGG - Intronic
1067908119 10:50315546-50315568 AAATGATAGTGGGCAGATGGAGG - Intronic
1068659442 10:59608662-59608684 AAATGCTGGTGAGAATGTGGAGG + Intergenic
1071149341 10:82615744-82615766 AAGAGATAGTAAAAATGTGGAGG + Intronic
1072185438 10:93033524-93033546 AAATGAGAGTAGGAAAGATGAGG - Intronic
1072341110 10:94451014-94451036 AAAGGGTAGGAGGAAGGTGGTGG + Intronic
1072416203 10:95248947-95248969 GAGTGATAGTGGGGATGTGGCGG - Intronic
1073395742 10:103215884-103215906 ACTTGATAGTAGGAAGGTAGAGG + Intergenic
1073904966 10:108267879-108267901 AAATGCTAGTGAGGATGTGGAGG - Intergenic
1073947613 10:108769004-108769026 ATATGAAAGTAGGGATGAGGAGG - Intergenic
1074446785 10:113527275-113527297 AAATGCCAGCAGTAATGTGGAGG - Intergenic
1075163887 10:120049051-120049073 TAATGAAAGTAGTAAAGTGGAGG + Intergenic
1077711100 11:4537856-4537878 AAATGAAAGTGGGACTGAGGAGG + Intergenic
1078632549 11:13016419-13016441 AAATGGGAGTGGGAATGGGGAGG - Intergenic
1079001393 11:16760044-16760066 AAATGAAAGTGGGAATGATGGGG - Intergenic
1079189009 11:18262158-18262180 ACCTGATAGTAAGAAGGTGGAGG + Intergenic
1082234206 11:49803135-49803157 AAAGGATAGTAGGAAGATGGTGG + Intergenic
1082756285 11:57079757-57079779 AAATGGTAGAAGGGATGTGGTGG + Intergenic
1083108832 11:60385333-60385355 CAATGATAGAAGGAAAGTCGAGG - Intronic
1084644824 11:70450025-70450047 ATATTATACTAGGAATGAGGGGG + Intergenic
1087588182 11:100149587-100149609 AAATGATATTAGGAATCTCATGG + Intronic
1087809546 11:102595410-102595432 AAGTGATATTTGGAATGGGGGGG - Intronic
1088683790 11:112268173-112268195 ACCTGATAGTAAGAAGGTGGAGG - Intronic
1093216914 12:16373249-16373271 GAAGGATAGTAGGGATGTGGGGG + Intronic
1094450563 12:30579109-30579131 AAATGATGGCAAGAATATGGAGG + Intergenic
1097297648 12:57984569-57984591 ATCTGGTAGTAAGAATGTGGAGG - Intergenic
1098216068 12:68221277-68221299 AAAGGAAAGGAGGAATGGGGTGG + Intronic
1098351871 12:69571340-69571362 AAATAATAGTATAAATGTGGTGG + Exonic
1098582411 12:72115688-72115710 AAATGCTAGTGAGGATGTGGAGG - Intronic
1098713081 12:73792140-73792162 AAGTGTTAGTGAGAATGTGGTGG - Intergenic
1099082925 12:78208937-78208959 ACATGAAAGTAGGAAGGTAGGGG + Intronic
1099569823 12:84303022-84303044 AAATTATGGTAGGAATCTGCAGG - Intergenic
1101312762 12:103598731-103598753 AAAAGGTAGCAGGAATGTGGGGG - Intronic
1101638336 12:106566198-106566220 AAATTAGAGTATGATTGTGGTGG + Intronic
1101688390 12:107049357-107049379 AAAAGATAGTAAGAATTTGTGGG - Intronic
1102879458 12:116473167-116473189 AAATGTTAGTGAGGATGTGGAGG + Intergenic
1104446383 12:128836945-128836967 AAATGCTGGTGAGAATGTGGAGG + Intergenic
1105395599 13:20030869-20030891 AAATTATAGTAGGGATGCAGTGG + Intronic
1106818040 13:33430909-33430931 AAAGGATAGAAGGGAGGTGGAGG + Intergenic
1108475166 13:50809095-50809117 AAATGATAATAGCAACTTGGTGG + Intronic
1108596189 13:51951682-51951704 AAATGAGAGTGGGGATGAGGAGG + Intronic
1108646881 13:52439329-52439351 AAATGAAAACAGTAATGTGGTGG + Intronic
1109071851 13:57779442-57779464 ATATGACAGTGAGAATGTGGGGG - Intergenic
1110153773 13:72288194-72288216 TAAACATAGTAGGAATGAGGAGG + Intergenic
1111357926 13:87134478-87134500 AAATTATTGTAAGAATGTAGAGG + Intergenic
1116306177 14:43259222-43259244 AAATTACAGTATAAATGTGGGGG - Intergenic
1116631787 14:47344972-47344994 AAATGAAAGTAGAAATGTCTGGG + Intronic
1116664305 14:47755107-47755129 AATTGTTTGTAAGAATGTGGAGG + Intergenic
1117004204 14:51402195-51402217 AAATGGCAGTAGGAAGGTTGGGG + Intergenic
1118651245 14:67897601-67897623 AAAAGATAGTAGGAGTGGGCAGG + Intronic
1118874207 14:69768885-69768907 AAATGATAGACGGTATGTGAAGG + Exonic
1120822708 14:88927719-88927741 GGATGATAGTAGCAATGGGGAGG + Intergenic
1121230267 14:92352416-92352438 AAATGACAGGAGGAATGAGCTGG + Intronic
1123172534 14:106388107-106388129 AAATGTTGGCAAGAATGTGGGGG + Intergenic
1125386322 15:39140819-39140841 AAATGTTTGTAGGAATGTAGTGG - Intergenic
1127033061 15:54885305-54885327 AGATAATAGGAGGAATCTGGGGG - Intergenic
1128973754 15:72132813-72132835 AAATGATAGTAGGAATGTGGAGG - Intronic
1130970635 15:88729304-88729326 AAATGTTAGTGAGAATTTGGGGG + Intergenic
1131787668 15:95930691-95930713 CAATAATAGAAGGGATGTGGGGG - Intergenic
1133596128 16:7294498-7294520 AAATGATGATAGGAAAGTGTTGG + Intronic
1135078709 16:19415769-19415791 AAATGAGAGGAGGAGGGTGGTGG - Intronic
1139033483 16:62914280-62914302 AATTGATTGTAAGAATATGGGGG - Intergenic
1140676754 16:77339728-77339750 AAATGTTAATAGAAATGTTGGGG - Intronic
1143164211 17:4889858-4889880 AAAAGATAGGAGGAATCTGGGGG - Intronic
1143705851 17:8697254-8697276 AAATCCCAGAAGGAATGTGGGGG - Intergenic
1146094458 17:29915515-29915537 AAATCATAGAATGAATGTGTTGG - Intronic
1146748754 17:35356397-35356419 AAATGAGAGTAGGAGTGTTTGGG - Intronic
1149040634 17:52184389-52184411 AAATTATAGTAACAATGTGGTGG + Intergenic
1149952484 17:61004658-61004680 AAATGATATTTTGAATTTGGAGG + Intronic
1151424368 17:74021070-74021092 AAGTGAATGGAGGAATGTGGAGG + Intergenic
1151454695 17:74218818-74218840 AAATGATAGTGGGACTGTTCAGG + Intronic
1152013168 17:77733242-77733264 AAAAGATGGTGGGAAGGTGGAGG - Intergenic
1154051043 18:10958014-10958036 AAATGTTGGAAAGAATGTGGAGG + Intronic
1154296573 18:13156016-13156038 AAATAAAAGTTGAAATGTGGGGG - Intergenic
1157181203 18:45499835-45499857 AAATGAAATAATGAATGTGGAGG + Intronic
1158037516 18:53051321-53051343 AAATGAGAGGAGGAATGAGAAGG - Intronic
1159767362 18:72506801-72506823 AAATGATATTAGGAGTCAGGAGG - Intergenic
1162059072 19:8083782-8083804 AAAAAATAGTAGGACTGGGGAGG - Intronic
1164591843 19:29511783-29511805 AAATGAGAGGGGGAATGAGGAGG + Intergenic
1168388175 19:55983491-55983513 AAATGAAAGACGAAATGTGGTGG + Intronic
926991451 2:18685070-18685092 AAATAATGGTAGGAATCTGCTGG + Intergenic
927697880 2:25250535-25250557 AATTGATAGTAGGAAGGGGAGGG - Intronic
928569075 2:32584764-32584786 ATATGATAGTAGGCAAGTAGAGG - Intronic
928721083 2:34122154-34122176 AAAAGAAAGTAGGAATGAAGAGG + Intergenic
928881779 2:36104875-36104897 AAATGATTTTAGGAAAGTAGTGG + Intergenic
929265498 2:39914461-39914483 TACTGCTAGTAGCAATGTGGTGG - Intergenic
930711844 2:54557575-54557597 AAATCAGAGTAGGAATTTGAGGG + Intronic
932204094 2:69862457-69862479 AAATAATAGTAAGATTGTTGAGG + Intronic
932431375 2:71675754-71675776 AAATGTTAGTAGAAATTGGGTGG - Intronic
933025248 2:77249668-77249690 AAATGCTGGCAGGAATGTGGTGG + Intronic
933396683 2:81740970-81740992 AAATGATAGTGGACAGGTGGGGG - Intergenic
933570709 2:84007549-84007571 AAATGATACAAGGAATGGGAGGG + Intergenic
934584680 2:95480606-95480628 AAATAAAAGAAGGAATGAGGAGG - Intergenic
934594774 2:95596109-95596131 AAATAAAAGAAGGAATGAGGAGG + Intronic
934788002 2:97029510-97029532 AAATAAAAGAAGGAATGAGGAGG - Intergenic
934904429 2:98186519-98186541 AATTGATAGGAGGAAGGTTGTGG - Intronic
936445787 2:112594099-112594121 AAAGAAGAGTAGAAATGTGGAGG - Intergenic
936843070 2:116797447-116797469 AAATAACAGTAGGGATGTGGGGG + Intergenic
937615715 2:123920120-123920142 AAATGCTGGTAGGAATGAAGAGG - Intergenic
937620814 2:123983247-123983269 AAATGATAGCAAGAATATTGGGG + Intergenic
937653739 2:124350497-124350519 AATTAATAGTACGAATGTGAAGG - Intronic
938139834 2:128786424-128786446 GACAGAAAGTAGGAATGTGGGGG - Intergenic
939709210 2:145494747-145494769 AAATGAGTGTAGGACTGGGGAGG + Intergenic
943099309 2:183469297-183469319 AAAGGGTAGTAGGGATGTGGGGG - Intergenic
944105144 2:196071546-196071568 CAATGACAGTAGGAATGGAGTGG + Intergenic
945229336 2:207568917-207568939 AAACGACAGAAGGAATGGGGAGG - Intronic
945682419 2:212930168-212930190 AAGTGAGAGTAGGGATGGGGAGG - Intergenic
947511393 2:230757699-230757721 AAATAATAGCAGTGATGTGGAGG - Intronic
947697807 2:232207149-232207171 ACATGGTAGTAGGAATGTTTGGG - Intronic
1168984105 20:2033031-2033053 AAATTATAGTGAGAGTGTGGAGG - Intergenic
1169755179 20:9035814-9035836 ATCAGATAGTAGGAATGTGGTGG + Intergenic
1169823266 20:9737832-9737854 AAGTGTTAGTAAGAATGTGGAGG + Intronic
1170390560 20:15868397-15868419 AAATGATACCAGGAGTGGGGTGG - Intronic
1172042710 20:32057230-32057252 AAATGACTATAGGGATGTGGAGG - Intronic
1173325507 20:42029595-42029617 AAATGATAGCTGGGATGGGGTGG - Intergenic
1175616135 20:60400022-60400044 AAATGTTGGTAAGTATGTGGAGG - Intergenic
1175686846 20:61036713-61036735 AAATAATAGTAGCAATGTATTGG - Intergenic
1178215033 21:30586373-30586395 AAGTGATGGTGAGAATGTGGAGG + Intergenic
1181267529 22:21639486-21639508 AAATTATAGTTGGTAGGTGGAGG + Intergenic
1183882674 22:40848339-40848361 ACCTGATAGTAAGAAGGTGGAGG - Exonic
1184961311 22:47930851-47930873 AAATGGGGGTAGGTATGTGGTGG - Intergenic
949778694 3:7661448-7661470 AAATGTTAGAAGGGATTTGGAGG + Intronic
950812405 3:15661311-15661333 AAATGCTAGTGTGGATGTGGAGG - Intergenic
951266537 3:20574490-20574512 AAATGAAAGCCGGAATGCGGTGG + Intergenic
952005132 3:28834983-28835005 AAATGATAGTATGAAGAGGGTGG - Intergenic
952674680 3:36013331-36013353 AAATATTAGGAGGAAGGTGGAGG + Intergenic
952750127 3:36818092-36818114 AACTGAAAGGAGGAAAGTGGTGG + Intergenic
953046473 3:39297711-39297733 AAATGAGACAAGGAAGGTGGAGG + Intergenic
953097949 3:39797417-39797439 AAATAAAAATAGAAATGTGGAGG - Intergenic
955165839 3:56510310-56510332 AAATGCTGGCAGGGATGTGGAGG + Intergenic
956244255 3:67163961-67163983 AGATGCTGGTAAGAATGTGGAGG + Intergenic
957299102 3:78367676-78367698 AAATGATAGTAGGATGGGTGTGG - Intergenic
957887639 3:86309746-86309768 AAGTGTTAGTAAGGATGTGGAGG - Intergenic
958517417 3:95135685-95135707 AAATAATAGTAAAAATGTGTTGG - Intergenic
959348662 3:105232438-105232460 AAATAATAGTATGAATCTGAAGG - Intergenic
959548582 3:107627051-107627073 AAATGATAGTAAGAATTCTGAGG - Intronic
960536162 3:118816575-118816597 ATATGATAGTAGGTGTGTGTTGG - Intergenic
960873837 3:122276984-122277006 AAATGCAAATAGAAATGTGGTGG - Intronic
961072854 3:123952297-123952319 AAATTATAGTAGGCATCTAGTGG - Intronic
962186200 3:133262442-133262464 AAATGAAAGTAGGGAGGAGGAGG - Intronic
962308014 3:134305990-134306012 AAATGATAGTAGGGACATGGTGG - Intergenic
964589677 3:158346580-158346602 AAATTCTAGTAGGTATGTGGTGG - Intronic
965028440 3:163332000-163332022 AAATGATAGGAGTATTGTGATGG - Intergenic
965411533 3:168337793-168337815 TAATGATGGTAGTGATGTGGTGG - Intergenic
965555708 3:170016429-170016451 AAATGTTAGTGAGAATGTGAAGG - Intergenic
965671080 3:171148520-171148542 TGATGACAGTAGGAATTTGGGGG - Intronic
966570535 3:181437776-181437798 AAATGATAGTAGTGATGATGAGG - Intergenic
966686355 3:182699891-182699913 AAATGATGGTAACAAAGTGGTGG - Intergenic
968475158 4:801856-801878 ACATTTGAGTAGGAATGTGGTGG - Intronic
970243555 4:14034603-14034625 AAATGAGAGTCGGATGGTGGAGG + Intergenic
972431530 4:38987627-38987649 AAAGGACAGTAGTATTGTGGTGG - Intronic
972857854 4:43129644-43129666 AAATACTAGTGGGAATGTGGAGG + Intergenic
974287599 4:59890028-59890050 AAATGATATTTTGAATATGGAGG - Intergenic
974808852 4:66919781-66919803 TAATGATAGTAGGAAAACGGAGG - Intergenic
976471975 4:85439456-85439478 AAATGATGGCAAGGATGTGGAGG - Intergenic
976472220 4:85442702-85442724 AAATGATAATAGGCATGTCCAGG - Intergenic
977501720 4:97848461-97848483 AAATGACAGTAGGAATCTAGGGG + Intronic
977522196 4:98098960-98098982 AAATGCTGGTGGCAATGTGGAGG + Intronic
977544363 4:98359514-98359536 AAATGATGGTAGGAAGTTTGTGG + Intronic
978326868 4:107567991-107568013 GATTTATCGTAGGAATGTGGGGG + Intergenic
979638188 4:122980126-122980148 AAATGAGGGGAGGAATGAGGTGG - Intronic
980453267 4:133005097-133005119 AAATGATAGTATGAATGTGTTGG + Intergenic
980608062 4:135119723-135119745 AAATGATTCTATGGATGTGGTGG + Intergenic
987380941 5:17285434-17285456 AAATGTTAATGAGAATGTGGAGG + Intergenic
987663124 5:20903595-20903617 AAATGTTAGCAAGAATGTGGAGG - Intergenic
987842808 5:23242453-23242475 AACTGATCGTAGGAATGAGAGGG - Intergenic
988759563 5:34298587-34298609 AAATGTTAGCAAGAATGTGGAGG + Intergenic
989734498 5:44687648-44687670 AAATTTTAGTAGAAATGTTGGGG + Intergenic
990077445 5:51867084-51867106 AAAGTAGAGTAGGAAGGTGGGGG - Intergenic
990365581 5:55066930-55066952 AGATGATAAGAGGAATTTGGGGG - Intergenic
990759864 5:59116806-59116828 AAATGACAGCAGGAATGAGAAGG + Intronic
991077458 5:62556878-62556900 CAATTACAGTAGGAATCTGGGGG - Intronic
991194535 5:63917169-63917191 AAAGGAGAGTAGGAAGGGGGAGG - Intergenic
991692555 5:69239217-69239239 AAATGATGTTGAGAATGTGGTGG - Intronic
993054766 5:82969069-82969091 AACTGATAGTAAGAAGGTGGAGG + Intergenic
993336486 5:86665970-86665992 AAATTATAGTAGATATGTAGAGG - Intergenic
995590841 5:113698478-113698500 AAATGGTGGTAGGCATGTGCAGG + Intergenic
997417298 5:133738903-133738925 GAGTGAGAGTAGGAATGAGGAGG - Intergenic
1001293008 5:170478154-170478176 AAATGATAGAAGGCCTGGGGCGG + Intronic
1002579971 5:180202403-180202425 AAATGATCTTAGGTACGTGGGGG - Intronic
1006392569 6:33767223-33767245 AAGTAATAATAGGAATTTGGTGG + Intergenic
1008333013 6:50265096-50265118 GAATGGGAGTAGGGATGTGGGGG - Intergenic
1008412342 6:51194281-51194303 AAATGCTGGTAAGGATGTGGAGG - Intergenic
1010545825 6:77154354-77154376 AAATGATGGTGAGGATGTGGAGG - Intergenic
1010584742 6:77643781-77643803 GAATAATAATAGGAATGTAGGGG + Intergenic
1011740516 6:90355052-90355074 AAATGATAGTTGAAAGGGGGAGG + Intergenic
1012951612 6:105523903-105523925 AAGTGATGGTAGAAATGTAGAGG - Intergenic
1013060952 6:106633488-106633510 AAATGATGGCAGCAATTTGGGGG + Intronic
1018262757 6:161986688-161986710 AAATGTTAGGAGGAATATGTAGG - Intronic
1018441244 6:163815359-163815381 AAATGTTGGAAGGAATGTGGGGG - Intergenic
1018461701 6:164004853-164004875 CAATGACAGTAGGAATCTGCAGG - Intergenic
1020438278 7:8189485-8189507 AAATGTTAGAATGACTGTGGGGG - Intronic
1020469264 7:8517338-8517360 AGAGGATTGTAGGCATGTGGAGG + Intronic
1020819512 7:12948769-12948791 AAATGATCGTATGAATCTGTAGG + Intergenic
1021654334 7:22860255-22860277 AAATTATTTTGGGAATGTGGTGG - Intergenic
1021823840 7:24527278-24527300 AAATATTGGTATGAATGTGGAGG + Intergenic
1021931396 7:25584791-25584813 AAAAGATTGTAGGAGTGGGGGGG + Intergenic
1022294969 7:29042275-29042297 AAGTGACAGTAGTAATGTTGGGG - Intronic
1023018838 7:35991755-35991777 AAGTGTTAGTGAGAATGTGGAGG + Intergenic
1023195166 7:37629253-37629275 AAATGCTGGCAGGGATGTGGAGG - Intergenic
1023631224 7:42166341-42166363 AAATAATTGAATGAATGTGGTGG + Intronic
1027445606 7:78270066-78270088 AAATGCTGGTAGATATGTGGTGG + Intronic
1027514153 7:79121056-79121078 AAGTTATAGAAGAAATGTGGGGG - Intronic
1028182349 7:87740784-87740806 ACATGATAGATGGAATGTGAAGG + Intronic
1029231685 7:99075002-99075024 CAATTCTAGTAGGTATGTGGTGG - Intronic
1030441066 7:109590665-109590687 AAATGATGATAGTAATTTGGAGG + Intergenic
1030690312 7:112525917-112525939 AAATGAAGGTAGAGATGTGGTGG - Intergenic
1030956503 7:115858944-115858966 AAATGAGAACAGGAATTTGGAGG - Intergenic
1031512785 7:122670131-122670153 AAATGGTAGTGGGAATAGGGTGG - Intronic
1031862738 7:127000241-127000263 GAATGGTAGTGGGGATGTGGTGG + Intronic
1032588455 7:133170317-133170339 ACCTGATAGTAAGAAGGTGGAGG - Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035039497 7:155917167-155917189 AAAGGACACTAGGAAGGTGGAGG - Intergenic
1035858189 8:2999605-2999627 AGCTGATAGTAGGAGGGTGGAGG - Intronic
1038894798 8:31770390-31770412 AAATGGTCTTAGGAAAGTGGAGG + Intronic
1039730823 8:40275164-40275186 AAATGCTAGTAAGGATGTGGAGG - Intergenic
1040642199 8:49349085-49349107 AAATGATGGTAGAAATGAGATGG - Intergenic
1042470008 8:69176263-69176285 TTATGATATTAGAAATGTGGAGG - Intergenic
1043417237 8:80063885-80063907 AAAGGAGAGGAGGAATGGGGGGG + Intronic
1044236544 8:89837696-89837718 CAATGAAAGCAGAAATGTGGTGG + Intergenic
1044269905 8:90229962-90229984 AAATTCTAGTAGAAAAGTGGTGG + Intergenic
1044794604 8:95884340-95884362 CAAAGATAGTAGGAATTTAGTGG - Intergenic
1044826727 8:96205691-96205713 AAATGTTGGTGAGAATGTGGAGG - Intergenic
1044942918 8:97361531-97361553 AAATTATAGTGGGTGTGTGGGGG - Intergenic
1045278628 8:100729169-100729191 AAATAACATCAGGAATGTGGTGG + Intergenic
1045789365 8:105964059-105964081 AAATTTTAGTGGAAATGTGGGGG + Intergenic
1046201534 8:110934193-110934215 AAATAACAGTAGGAAAGGGGGGG + Intergenic
1048322142 8:133408182-133408204 ACCTGATAGTAAGAAGGTGGAGG + Intergenic
1048956345 8:139540026-139540048 CCATAATAGTAGGAATATGGAGG + Intergenic
1050285728 9:4099850-4099872 AAATAATATTAGGAATTTGAAGG - Intronic
1050468281 9:5956333-5956355 AAATGTTATTAGGAAATTGGAGG + Intronic
1051871594 9:21744225-21744247 TAATGAAAGAAAGAATGTGGTGG + Intergenic
1052447582 9:28584392-28584414 AAGTGTTAATAGGAATTTGGGGG - Intronic
1053186683 9:36022325-36022347 AATTAAAAGTAGAAATGTGGGGG - Intergenic
1055500331 9:76896594-76896616 AAAGGAAAGAAGGAAGGTGGAGG - Intronic
1055566704 9:77576630-77576652 TAATGATGTAAGGAATGTGGAGG - Intronic
1057718891 9:97517031-97517053 AAAAGATAGTGGGCCTGTGGGGG + Intronic
1058126160 9:101197407-101197429 AAATGATAGTAGGAAAGACATGG - Intronic
1058167718 9:101638991-101639013 AAATGAGATGACGAATGTGGAGG - Intronic
1058256450 9:102771508-102771530 AAATGCTGGTGAGAATGTGGTGG - Intergenic
1058653548 9:107199148-107199170 AAATAATAGTTGGAAAGTGTTGG - Intergenic
1058898979 9:109425008-109425030 AGATGAGAGAAGGAATGGGGAGG - Intronic
1059370937 9:113834674-113834696 AAGTGTTAGCAAGAATGTGGAGG + Intergenic
1060235820 9:121862012-121862034 AATTGACAGGAGGATTGTGGGGG + Intronic
1060718102 9:125953482-125953504 AAAAAAAAGTAGGACTGTGGTGG + Intronic
1062475808 9:136726611-136726633 AAGGGATAGTGGGAAGGTGGAGG - Intergenic
1185665100 X:1759413-1759435 AAAGGAAAGAAGGAATTTGGAGG + Intergenic
1186334020 X:8567036-8567058 AAATGAGAGTAGGAGGGAGGAGG - Intronic
1186830648 X:13386808-13386830 AAAGGAAAGTAGCCATGTGGAGG + Intergenic
1187643113 X:21316456-21316478 AAATGATGGTAGAAAGATGGTGG + Intergenic
1188360000 X:29241496-29241518 AGATGATGTTAGGCATGTGGTGG - Intronic
1189088890 X:38056601-38056623 AAATGCTGGTGAGAATGTGGAGG - Intronic
1189667503 X:43372694-43372716 AGATGATAAAGGGAATGTGGAGG - Intergenic
1190103498 X:47541526-47541548 AAATGAGAATAGGAATCTGAGGG - Intergenic
1191000094 X:55650592-55650614 AAATGAAAGGTGGAAAGTGGTGG + Intergenic
1193681880 X:84531148-84531170 AAATTATGGTAAGAATTTGGAGG + Intergenic
1194249446 X:91556361-91556383 AAATGAAAGCATGAATGTGGTGG + Intergenic
1194388623 X:93288644-93288666 ACCTGATAGTAAGAAGGTGGAGG - Intergenic
1195058220 X:101167579-101167601 AATTGAAAATTGGAATGTGGGGG + Intergenic
1195633238 X:107082896-107082918 AATTAATAATAGGAATGTGTTGG - Intronic
1197923383 X:131620186-131620208 TAATGGTAGTAGGTATGTGGAGG + Intergenic
1198220972 X:134601883-134601905 AAATTAGAGTAGGAATGGAGAGG + Intronic
1198692718 X:139301896-139301918 ATATAACAGTGGGAATGTGGTGG + Intergenic
1199712792 X:150482836-150482858 AAATGATAATACGTAGGTGGGGG + Intronic
1200568403 Y:4797580-4797602 AAATGAAAACATGAATGTGGTGG + Intergenic
1201888724 Y:18917791-18917813 AATTGGAAGTAGGAAGGTGGGGG - Intergenic