ID: 1128977558

View in Genome Browser
Species Human (GRCh38)
Location 15:72164689-72164711
Sequence GCCACCACACTCGGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 1, 2: 9, 3: 55, 4: 352}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128977549_1128977558 17 Left 1128977549 15:72164649-72164671 CCTGCTTTGGCCTCCCAAAGTGC 0: 2759
1: 64869
2: 181797
3: 231041
4: 180340
Right 1128977558 15:72164689-72164711 GCCACCACACTCGGCTCCCAGGG 0: 1
1: 1
2: 9
3: 55
4: 352
1128977555_1128977558 3 Left 1128977555 15:72164663-72164685 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1128977558 15:72164689-72164711 GCCACCACACTCGGCTCCCAGGG 0: 1
1: 1
2: 9
3: 55
4: 352
1128977554_1128977558 4 Left 1128977554 15:72164662-72164684 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1128977558 15:72164689-72164711 GCCACCACACTCGGCTCCCAGGG 0: 1
1: 1
2: 9
3: 55
4: 352
1128977548_1128977558 20 Left 1128977548 15:72164646-72164668 CCTCCTGCTTTGGCCTCCCAAAG 0: 1361
1: 29051
2: 79344
3: 153330
4: 158014
Right 1128977558 15:72164689-72164711 GCCACCACACTCGGCTCCCAGGG 0: 1
1: 1
2: 9
3: 55
4: 352
1128977552_1128977558 7 Left 1128977552 15:72164659-72164681 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1128977558 15:72164689-72164711 GCCACCACACTCGGCTCCCAGGG 0: 1
1: 1
2: 9
3: 55
4: 352
1128977547_1128977558 24 Left 1128977547 15:72164642-72164664 CCATCCTCCTGCTTTGGCCTCCC 0: 18
1: 262
2: 859
3: 6577
4: 70077
Right 1128977558 15:72164689-72164711 GCCACCACACTCGGCTCCCAGGG 0: 1
1: 1
2: 9
3: 55
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128977558 Original CRISPR GCCACCACACTCGGCTCCCA GGG Intronic