ID: 1128977675

View in Genome Browser
Species Human (GRCh38)
Location 15:72165438-72165460
Sequence TTGTCCATCTGGAACAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128977675 Original CRISPR TTGTCCATCTGGAACAGGCA AGG Intronic
903243817 1:22001515-22001537 TTGTCCATCTGCAGCAGGCGAGG + Intergenic
903375449 1:22863038-22863060 TTGTCCATCTGGGACTTTCAAGG + Exonic
905526047 1:38640691-38640713 CTGTCGATCTGGGACAGACATGG - Intergenic
907451085 1:54546349-54546371 TTAGCCATCTGTAACATGCAGGG + Intronic
908736673 1:67283774-67283796 TTCTCATGCTGGAACAGGCAAGG + Intergenic
910707474 1:90145350-90145372 ATGTGCATGTGCAACAGGCAAGG - Intergenic
910927148 1:92409307-92409329 TTTTTCATCTAGAACAGGTAAGG + Intergenic
913059965 1:115195721-115195743 TTGTCCATCTGGGAAACGGACGG - Intergenic
913138244 1:115913523-115913545 TTGTTCATCAGGGACAGCCATGG + Intergenic
914449063 1:147774583-147774605 GTGATCATCTGGAACAGCCAGGG + Intergenic
915071493 1:153272581-153272603 TGGTCCTTCTGGAACAAGCCTGG + Intergenic
915224684 1:154403908-154403930 TGGGACAGCTGGAACAGGCATGG - Intergenic
915246102 1:154557570-154557592 ATATCCATAGGGAACAGGCAGGG + Intronic
920916370 1:210261283-210261305 TGGTTTATCTGGAACAGGCCTGG + Intergenic
1063364630 10:5482162-5482184 TTAACCACCTGCAACAGGCAGGG + Intergenic
1070956819 10:80469238-80469260 TTCTCCAGCTGGAACAGGGCAGG - Intronic
1071249435 10:83802229-83802251 GTGCCCATCTGGAATAGGTAAGG + Intergenic
1072268829 10:93755732-93755754 TTCTCCATCTGTAATATGCAGGG + Intergenic
1074936736 10:118189469-118189491 TTCTCAATCTGAAACAGGAAAGG + Intergenic
1080470620 11:32542197-32542219 ATGTCTATCTGGGTCAGGCATGG + Intergenic
1080723683 11:34873715-34873737 TAAGCTATCTGGAACAGGCATGG - Intronic
1081580503 11:44348543-44348565 TTCCCCATCTGGAACGGGGAGGG + Intergenic
1083231792 11:61326218-61326240 TTGTCAATCATGGACAGGCATGG + Intronic
1083826005 11:65204548-65204570 TTGAGCACCTGGAACATGCAGGG - Intronic
1088365146 11:109032549-109032571 TTGGCCTTCTGTAACAGCCATGG + Intergenic
1088769577 11:113020279-113020301 TTGACCATCAGGAAGAGGCTGGG + Intronic
1092145814 12:6213897-6213919 TTGTCAAGCTGCAGCAGGCAGGG + Intronic
1092218032 12:6695875-6695897 TTGTCGATCTGGATCAGGTTTGG - Intronic
1097026881 12:56063300-56063322 TTTTTCACCTGGAACAGGGAAGG - Intergenic
1100645313 12:96523087-96523109 ATATCCATCTAGAACAGTCAGGG - Intronic
1101407885 12:104444882-104444904 TTTTCCACCTGGAAAATGCAAGG - Intergenic
1101757444 12:107632010-107632032 TTGTCCATTTGGAACAAGCATGG + Intronic
1106771050 13:32960895-32960917 TGGTCCATCTCTATCAGGCAGGG - Intergenic
1107490000 13:40872577-40872599 TGGCCCATCTGGAAGGGGCATGG + Intergenic
1107817238 13:44255070-44255092 TTGTCCAGCAGGAACAAGGATGG - Intergenic
1108555809 13:51591091-51591113 TTGTCCATCTGGCAAAGGAGGGG + Intronic
1110236180 13:73220315-73220337 TTTTTCACCTGGTACAGGCAAGG + Intergenic
1111894768 13:94127631-94127653 TTGTACATCTGGACCAGCCCTGG + Intronic
1117429961 14:55647459-55647481 TTGTACATTTGGTACAGACAGGG - Intronic
1118043504 14:61941716-61941738 TTGTCCATTTGGGAAAGGGATGG - Intergenic
1119182949 14:72616600-72616622 GTGTCACTCTGGAATAGGCAGGG + Intergenic
1120280697 14:82434217-82434239 TTGGCGATTTGGAACACGCAGGG - Intergenic
1120543155 14:85776697-85776719 TTGTTCATCTGAAACAGGGATGG + Intergenic
1124013631 15:25859258-25859280 GTGTCCAGCTGGAACAGGGTGGG - Intronic
1124899932 15:33812978-33813000 TCTTCCACCTGGAACAGGTAAGG + Exonic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128616531 15:69114809-69114831 TGGGTGATCTGGAACAGGCAGGG - Intergenic
1128977675 15:72165438-72165460 TTGTCCATCTGGAACAGGCAAGG + Intronic
1130825964 15:87546647-87546669 CTGTCCCTCTGGATCCGGCAGGG - Intergenic
1131064277 15:89423608-89423630 TTCCTCATCTGGAACAGGGAGGG - Intergenic
1131671784 15:94627432-94627454 TTGTCAATCCAGAACAGGCCAGG + Intergenic
1132162745 15:99557821-99557843 TTGTCCCTTTTGAACAGGAAGGG + Intergenic
1133292243 16:4730076-4730098 TTGTCCATGTGGCACGGGCTCGG - Exonic
1133353260 16:5117058-5117080 GAGTCCATCTGGAACAGGCTCGG - Intergenic
1135463135 16:22662350-22662372 CTGTACCTCTGGAAAAGGCAAGG - Intergenic
1138082497 16:54104002-54104024 TTGTACATCAGGTACTGGCAGGG + Intronic
1139375265 16:66492947-66492969 GTGTACATCTAGAACAGACAAGG - Intronic
1140342675 16:74180509-74180531 TTTTGAATCTGGAAAAGGCAAGG + Intergenic
1141436160 16:84001059-84001081 TTGTCCTCCTGGAACAGCCCTGG + Intronic
1141627522 16:85269066-85269088 TTGTCCATCTGTAAAATGCAGGG - Intergenic
1142785979 17:2223082-2223104 TTCTCCAGCTGGAGCTGGCAGGG - Intronic
1148228174 17:45913948-45913970 TGGATCAACTGGAACAGGCAGGG + Intronic
1148732304 17:49844914-49844936 TTCTCCATCTGTAAAATGCAGGG - Intronic
1149039504 17:52171189-52171211 TTGTCCATATGGAAAAGCAATGG + Intergenic
1151965075 17:77426898-77426920 CTGTCCAACTGGAGCAGTCAGGG + Intronic
1152029979 17:77836217-77836239 ATGTCCAGCAGGAACAGGGAGGG + Intergenic
1153400782 18:4682092-4682114 CTGTCCCTCTGGATCTGGCAGGG + Intergenic
1157244204 18:46039295-46039317 TAGTCCATGGGGAACTGGCATGG - Intronic
1157462546 18:47912648-47912670 TTGTGGAGCTGGAACAGGCCTGG - Intronic
1158665849 18:59431895-59431917 TTCTCCCTCTGGAACTGGGAAGG + Exonic
1161703850 19:5808664-5808686 CTGGTCATCTCGAACAGGCACGG + Intergenic
1162309946 19:9900301-9900323 TTCTCCAGCTGGAGCAGGGAAGG + Intronic
1165008494 19:32825346-32825368 TTCTCAATCTCCAACAGGCAAGG - Intronic
1166372602 19:42310479-42310501 TTCGCCATCTGGAACAGCCTGGG + Exonic
925217634 2:2110941-2110963 TTGTCCCTGTGGAGCACGCAGGG + Intronic
926176725 2:10599796-10599818 TTTTTCATCTGTAACATGCAAGG - Intronic
931814555 2:65887984-65888006 TTCTCCATCTGGAAGAGACTGGG - Intergenic
936501708 2:113072087-113072109 TTTTCCATCTGGAACAGAATGGG + Intronic
939000502 2:136728481-136728503 CTGCCCATCTGGGACAGGCATGG - Intergenic
941555568 2:166976043-166976065 TTATCTATCTGGGACAGTCAAGG - Intronic
941971608 2:171356799-171356821 TCATCCATCTGGAACAGGCAAGG + Intronic
942026020 2:171911772-171911794 TTGTCCTTAAGGATCAGGCAGGG + Intronic
942126571 2:172831557-172831579 TTTTCTATCTGGGCCAGGCACGG - Intronic
947088951 2:226488545-226488567 TTGTCCATCTGGTTCTGGTAGGG - Intergenic
948269969 2:236666724-236666746 TTGAGAATCTGGAAAAGGCAGGG + Intergenic
1169662990 20:8000803-8000825 TTCTCCATTTGGAACTGGGAAGG + Intronic
1173642862 20:44615816-44615838 TTGTCCATCTGTAACATGAGAGG - Intronic
1174201626 20:48810223-48810245 TTTTCCATCTGATACACGCAAGG + Intronic
1175063053 20:56261146-56261168 TTCCCCATCTGTAACAGGAATGG + Intergenic
1175879438 20:62248553-62248575 CTGTCCATCAGAAACAGGCAGGG - Intronic
1178679729 21:34663713-34663735 TTTTTCATCTGGAACAGTGAGGG - Intergenic
1179073123 21:38091671-38091693 CTGTCTATCAGGAACAGCCAGGG + Intronic
1181655748 22:24296715-24296737 TTCTCCATCTCGACCAGGTAGGG + Intronic
1181709629 22:24674332-24674354 TTCTCCATCTCGACCAGGTAGGG + Intergenic
1182795012 22:32985538-32985560 TTCTCCATCTGGAACACGTTGGG - Intronic
949271504 3:2223196-2223218 TTGTCCACCTAGAACAGTAAAGG - Intronic
950163427 3:10776514-10776536 TTCCCCATCTGGAAAACGCAGGG + Intergenic
955033262 3:55241321-55241343 TTATGCATCTGGTACAGTCAGGG + Intergenic
955471253 3:59288703-59288725 TTGTACTGCTGGACCAGGCAGGG - Intergenic
955860573 3:63325566-63325588 TTCTCCATCTGGACCTGGCAGGG + Intronic
957057227 3:75453065-75453087 GAGTCTATCTGGAACAGGCTCGG - Intergenic
958180573 3:90055203-90055225 TTGTCCCTTTGGGCCAGGCACGG + Intergenic
960333099 3:116386804-116386826 TTTTCCATCTGGAGCCTGCAGGG + Intronic
961296227 3:125886670-125886692 GAGTCTATCTGGAACAGGCTCGG + Intergenic
961762393 3:129181328-129181350 TTGAACATCTGGAACAGGCAGGG - Intronic
964912898 3:161803437-161803459 TAGTCCATGTGGAAAAGGAATGG + Intergenic
967789076 3:193527842-193527864 TTGTCCATCTGTAACAGAGAGGG + Intronic
967980826 3:195064333-195064355 CTGGCCATCTTGGACAGGCAAGG - Intergenic
969094861 4:4724717-4724739 TTTCCCATCTGGAAAAAGCATGG + Intergenic
970055482 4:11966596-11966618 TTTTCCATCTAGAATAAGCAGGG - Intergenic
974919875 4:68225601-68225623 TTTTCCCTCTGGAAGAAGCAAGG + Intergenic
975320729 4:73007705-73007727 TTGGACAGCTGAAACAGGCATGG - Intergenic
978560586 4:110029580-110029602 TTGGCCATCTGGTCCAGGCCTGG + Intergenic
982357399 4:154486079-154486101 CTGTCCACCTGAGACAGGCAGGG + Intronic
989293966 5:39802237-39802259 ATGCCCATCTGGAACAGGACTGG - Intergenic
991016687 5:61940806-61940828 CAGTCCATCTGAAAGAGGCAGGG - Intergenic
993000252 5:82373840-82373862 TCGTCCATCTAGGCCAGGCAAGG - Intronic
994108265 5:95970571-95970593 TTATGCATCTGGAAAAGGAAAGG + Intergenic
994441713 5:99814631-99814653 TTGACCAACTGGAACAGAAATGG + Intergenic
996830234 5:127732681-127732703 TTGTCCTTCAGGAACATGGATGG + Intergenic
997192637 5:131952620-131952642 TTGTGCCTCTGAAAAAGGCATGG - Exonic
997982191 5:138475221-138475243 TTTTCCGGCTGGAACATGCAGGG - Intergenic
999133409 5:149301267-149301289 CTGTCCCTCTGGAGGAGGCAAGG + Intronic
999158384 5:149474631-149474653 TTGTCCAAGTGGAAAAAGCAAGG - Intergenic
1000491343 5:161917931-161917953 TAGTCCATCTGGGACATGAATGG - Intergenic
1001130927 5:169062821-169062843 TTCTCCATATGGGAAAGGCAGGG - Intronic
1001857429 5:175025152-175025174 TTGTCCTTTAGGAACAGGGAAGG - Intergenic
1002833793 6:848446-848468 ATGTGCATTTGGGACAGGCATGG - Intergenic
1010927967 6:81766535-81766557 TGGTTCATCTGGCACAGGAATGG - Intergenic
1012082156 6:94773614-94773636 TTGTACATCTGGAGCAGTTAGGG + Intergenic
1014074647 6:117222326-117222348 TGGTACTCCTGGAACAGGCATGG - Intergenic
1014828818 6:126077376-126077398 TTGCACATCTGGAACAGGGCAGG - Intergenic
1016744481 6:147563551-147563573 TTGTCCATCTAGATCTGTCAAGG + Intronic
1016986563 6:149900020-149900042 TTGAGCAGCTGGAAAAGGCAAGG - Intergenic
1018050897 6:160006554-160006576 TTCTCCATCTGCAACACCCAGGG - Intronic
1018581441 6:165311410-165311432 TTGTCTCTCTGGAACGTGCATGG + Intergenic
1021069859 7:16222999-16223021 TTGTCAATCTTGGCCAGGCATGG + Intronic
1021829550 7:24590693-24590715 TTTTTCATCTTGAACAGGCCAGG + Intronic
1024102903 7:46050973-46050995 TTGTCCATCTGGGCTTGGCAGGG + Intergenic
1027694520 7:81392963-81392985 TTGAACATCTGGAACAGTCTTGG - Intergenic
1028990662 7:97045765-97045787 CTGTTCATCTGGGACAGGCTTGG - Intergenic
1030545214 7:110885809-110885831 TTTTCCTCCTGGTACAGGCAAGG - Intronic
1031228692 7:119075706-119075728 ATCTCCATCTGGAACTGGAACGG - Intergenic
1032240103 7:130153614-130153636 TTGTGCGCCTGGACCAGGCAGGG - Intergenic
1033233601 7:139620733-139620755 CTGTGCATTTGCAACAGGCACGG + Intronic
1034038903 7:147855916-147855938 TAGTCCATGTGGAAAGGGCAAGG - Intronic
1036445986 8:8822365-8822387 CTGTCCCTCTGCATCAGGCATGG - Intronic
1038719449 8:30020824-30020846 TTTGCCATCTGTAACAAGCAGGG + Intergenic
1041808130 8:61876762-61876784 TTGTACATGTGGAACTGGGATGG - Intergenic
1043872375 8:85448019-85448041 TTGGCCATCTGCAAAGGGCAGGG - Exonic
1045511353 8:102814373-102814395 TGGCCCACCTGGAACAGCCATGG + Intergenic
1048971220 8:139645884-139645906 TTGGGCTTCTGGCACAGGCAGGG - Intronic
1050491254 9:6190298-6190320 TTATCCTTCTGGAACAGTCTTGG + Intergenic
1053566967 9:39263222-39263244 TTTTCCATCTCAAACAGTCATGG + Intronic
1053832742 9:42101064-42101086 TTTTCCATCTCAAACAGTCATGG + Intronic
1054130176 9:61355785-61355807 TTTTCCATCTCAAACAGTCATGG - Intergenic
1054597811 9:67086346-67086368 TTTTCCATCTCAAACAGTCATGG - Intergenic
1055896448 9:81181884-81181906 CTGTTCATCTGGAACAAGCATGG + Intergenic
1056721010 9:89071917-89071939 TTGTGCATCTGGATCAAGCCAGG + Intronic
1059434309 9:114267018-114267040 TTTTCCCTCTGGATAAGGCAGGG - Intronic
1060051227 9:120379839-120379861 TTTCCCATCTGGACCAGGAAGGG + Intergenic
1062413159 9:136434747-136434769 GTGGCCACCTGGAACATGCAGGG - Exonic
1185663261 X:1743804-1743826 TTGGCCATCTGGAAGATGCATGG + Intergenic
1186781595 X:12917346-12917368 TTGCCCATTTGTAACAGCCAAGG - Intronic
1188307303 X:28573626-28573648 ATGTCCATCTGGGCCAGGCGCGG - Intergenic
1188989436 X:36799894-36799916 TTTTCCATCAGGAACAGTCAGGG + Intergenic
1190107463 X:47570444-47570466 TTGTGCTTCTGGAATAGTCATGG + Intronic
1191890186 X:65931836-65931858 TAGGCCTTCCGGAACAGGCAAGG - Intergenic
1195716206 X:107820698-107820720 TTTTCCTTCTGGAACAGTCTGGG + Intergenic