ID: 1128982171

View in Genome Browser
Species Human (GRCh38)
Location 15:72196203-72196225
Sequence CCTGATCAGAAGACTATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128982165_1128982171 10 Left 1128982165 15:72196170-72196192 CCTAAGAGTGTCTGCAGCATGGT 0: 1
1: 1
2: 1
3: 8
4: 131
Right 1128982171 15:72196203-72196225 CCTGATCAGAAGACTATGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128982171 Original CRISPR CCTGATCAGAAGACTATGGA GGG Intronic
900217873 1:1491233-1491255 CCTGATCAGAGCTCTCTGGATGG - Intronic
901172621 1:7271413-7271435 CCTGAGCAGACAACTATAGAAGG + Intronic
902074253 1:13770095-13770117 TCTTATCAGAGGACTAAGGAGGG - Intronic
903742167 1:25564640-25564662 CCTCACCAGAAGGCCATGGAGGG + Intronic
904579449 1:31530340-31530362 CCAATTCAGAAGACTGTGGATGG + Intergenic
904605740 1:31696667-31696689 CCTCATCAGAAGAGTCTGGATGG + Intronic
905642005 1:39596539-39596561 CCTGAGCAGAAGATTGAGGAAGG + Intergenic
908261028 1:62339306-62339328 CCTGATGAGAGGTGTATGGATGG + Intergenic
909544340 1:76828391-76828413 CCTGATCGTAAGACTTTGAAAGG - Intergenic
911332785 1:96544400-96544422 TCTGATCATAAAATTATGGAAGG - Intergenic
916951920 1:169789284-169789306 CCTGAAGAAAATACTATGGACGG + Intronic
917168839 1:172145983-172146005 TTTGATCAGAATCCTATGGAGGG - Intronic
921352488 1:214250324-214250346 CCCAATCAGAAGGCCATGGAGGG + Intergenic
1063864770 10:10352161-10352183 CCTGATTAGAAGACTATAAAGGG + Intergenic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1073974781 10:109087676-109087698 CCTGAACAGAAAAGCATGGAAGG + Intergenic
1074792755 10:116907738-116907760 TCTGATCAAAAGATTATGTATGG - Intronic
1076560693 10:131361446-131361468 GGTGATCAGCAGAGTATGGAAGG - Intergenic
1078319249 11:10318942-10318964 CTTTATAAGAAGACTATGGGAGG + Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1081195905 11:40160372-40160394 CCTCATCACAAGACTAAAGATGG + Intronic
1085149727 11:74240460-74240482 CATGAACAGCAGACTAGGGATGG + Intronic
1086162886 11:83743214-83743236 CTGGTTTAGAAGACTATGGAGGG - Intronic
1094273313 12:28641188-28641210 CCTGATAATAAGATTAAGGATGG + Intergenic
1098855677 12:75650802-75650824 CCTGCTCAGAAGAACAGGGAAGG - Intergenic
1104619231 12:130298342-130298364 CTTGACCAGTAGACTATGGTGGG + Intergenic
1106192577 13:27466598-27466620 CCTCAGCAGAGGACCATGGATGG - Intergenic
1108413104 13:50169949-50169971 GCGGACCAGAAGACAATGGATGG - Intronic
1110863573 13:80370318-80370340 TCTGACCAGAAGGGTATGGAGGG - Intergenic
1111772983 13:92622674-92622696 GCTACTCAGAAGACTAAGGAAGG - Intronic
1112960888 13:105124551-105124573 CCTGACCAGAAAATTCTGGAGGG + Intergenic
1120345113 14:83278354-83278376 GCTGCTCAGAAGACTAAGGCAGG + Intergenic
1120474948 14:84975026-84975048 CCTGATCAGAAGGCAAAGCATGG + Intergenic
1128982171 15:72196203-72196225 CCTGATCAGAAGACTATGGAGGG + Intronic
1129523210 15:76198621-76198643 ACTGGACAGAAGACTATGGTTGG - Intronic
1129854590 15:78814178-78814200 CCTGCTCAGGAGAATGTGGAGGG + Intronic
1130563079 15:84973917-84973939 CTTGAAGAGAAGACTGTGGAGGG - Intergenic
1132403282 15:101527028-101527050 CCTGACCAGGAGCCTAAGGAAGG - Intergenic
1134439016 16:14286359-14286381 CCTGTGCAGAAGAATGTGGATGG - Intergenic
1139658949 16:68407078-68407100 CTTGATCAGGAGAATATTGAAGG + Intronic
1146590623 17:34125382-34125404 CTTGATCAGAAGACAACTGAAGG + Intronic
1148172435 17:45533863-45533885 CCTGTACAGAAGAATTTGGAGGG - Intergenic
1148276834 17:46311590-46311612 CCTGTACAGAAGAATTTGGAGGG + Intronic
1148298950 17:46529174-46529196 CCTGTACAGAAGAATTTGGAGGG + Intronic
1148363487 17:47033701-47033723 CCTGTACAGAAGAATTTGGAGGG + Intronic
1149511062 17:57242209-57242231 CCTGCTCAGAAGAGCATGAAAGG - Intergenic
1151223202 17:72629092-72629114 CCTCCACAGAAAACTATGGAAGG + Intergenic
1155862297 18:30918451-30918473 CTACTTCAGAAGACTATGGAGGG + Intergenic
1157667058 18:49496498-49496520 CATGATCAGAAGACTGTGATAGG - Intergenic
1163108049 19:15138798-15138820 CATGATCAGAAGAGTATTGATGG + Intergenic
1163611957 19:18306297-18306319 CCTGAAGAGAAGGCTATGCAGGG + Exonic
925701377 2:6641861-6641883 CATGAGCAGAAGCCTATGGGAGG - Intergenic
926422063 2:12709635-12709657 TCTACTCAGTAGACTATGGATGG - Intergenic
928163018 2:28946442-28946464 CCTCTTCAGAAGACTCTGTAAGG - Exonic
933565136 2:83940975-83940997 GCTGAGCAGAACACTATAGATGG + Intergenic
940765463 2:157785371-157785393 CCGGATTAGGAGACGATGGAAGG - Intronic
946679401 2:222197020-222197042 CCTGCTCAGAAGATCATGTAGGG + Intergenic
1172970999 20:38872991-38873013 GCTGATCAGAAAACTGTGCATGG + Intronic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1176517589 21:7797626-7797648 ACTGATCAGAGGCCTAAGGAAGG - Intergenic
1178651617 21:34427638-34427660 ACTGATCAGAGGCCTAAGGAAGG - Intergenic
1181350182 22:22249599-22249621 CCTGGTCAGAAGGCAAGGGAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183107308 22:35623588-35623610 CTTGCTTAGAAGACCATGGATGG + Intronic
1183832977 22:40428827-40428849 CCTGATGAGAAGGCACTGGAAGG - Intronic
949905343 3:8854166-8854188 CCGGTTAAGAAGACTATGTAGGG + Intronic
952813178 3:37423377-37423399 CCTGTTGAGAGGACTATGCAAGG + Intronic
959391019 3:105773774-105773796 CCTGGTCAACAGACTATGAAAGG + Intronic
963272052 3:143294954-143294976 CCTGATCAGAAGATCACTGAGGG + Intronic
966342829 3:178944546-178944568 TCTAACCAGAAGAGTATGGATGG - Intergenic
966632236 3:182090279-182090301 CCTGAAGAGAAGACTAAGTAAGG + Intergenic
967137025 3:186521193-186521215 ACTGCTCAGTAGATTATGGAGGG + Intergenic
967196389 3:187029971-187029993 CCTGAACTCAAGATTATGGAAGG + Intronic
971810005 4:31412780-31412802 CTTGATTAGTAGACTAGGGAAGG + Intergenic
972412886 4:38810793-38810815 CAGGAACAGAAGACTATGGGAGG + Intronic
974881592 4:67765131-67765153 CCATTTTAGAAGACTATGGAAGG + Intergenic
980802414 4:137769403-137769425 CCTTAGAAGAAGACTATCGAAGG + Intergenic
987027253 5:13939963-13939985 CCTGGACAGAAGAAAATGGATGG - Intronic
994768870 5:103955953-103955975 CCTGAGCAGAAGCGTCTGGAGGG - Intergenic
995845653 5:116491059-116491081 TCTGACCAAAAGACTATGGTGGG - Intronic
998646628 5:144069241-144069263 CCTGATCAGCTGAATAAGGAGGG - Intergenic
1001465586 5:171962308-171962330 ACTTAACAGAAGACTTTGGAGGG + Intronic
1012371854 6:98516988-98517010 CCTCATTAAAAGACTATTGATGG + Intergenic
1017412836 6:154187161-154187183 TTTGAGCAGAAAACTATGGAGGG - Intronic
1017583461 6:155893904-155893926 CCTCATCAGAAAACTATGGCTGG + Intergenic
1017673047 6:156785407-156785429 CCTTATCAGGTGACTCTGGAAGG + Intronic
1017928388 6:158930376-158930398 CCTGACCAGAAAACTCTTGAGGG + Intergenic
1019328067 7:448946-448968 CCAGATGAGAAAACTAGGGAAGG + Intergenic
1023034329 7:36117459-36117481 CCAGAGCAGAAGACTGTTGAAGG + Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1031571197 7:123362198-123362220 ACTGATTAGAAGACAAGGGAAGG + Intergenic
1033812942 7:145038672-145038694 CCTGATCATAGAACTATAGATGG - Intergenic
1037882635 8:22580362-22580384 CCTGGGCTGAAGACTAAGGAAGG + Intronic
1044678874 8:94757109-94757131 CCAGATAAGAAGACTATCAAAGG - Intronic
1053546319 9:39026752-39026774 ACTGATCAGAGGACTTTGGAGGG + Intergenic
1054706034 9:68462871-68462893 CATGGTCAGAAGGCTATGGAAGG - Intronic
1054880775 9:70142502-70142524 CCTGAGCAGACTATTATGGATGG - Intronic
1055582851 9:77726143-77726165 GTTGCTCAGAAAACTATGGAAGG - Intronic
1061529825 9:131201921-131201943 CTTTCTCAGAAGACTGTGGAAGG - Intronic
1187474745 X:19601085-19601107 CCATATATGAAGACTATGGAAGG - Intronic
1195273792 X:103258600-103258622 TCAGAACACAAGACTATGGAAGG - Intergenic