ID: 1128984201

View in Genome Browser
Species Human (GRCh38)
Location 15:72207453-72207475
Sequence GCAGAATTGTTGGCCCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128984201_1128984208 17 Left 1128984201 15:72207453-72207475 CCAGAGTGGGCCAACAATTCTGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1128984208 15:72207493-72207515 CAATATGGATGCTTCATTGACGG 0: 1
1: 0
2: 1
3: 7
4: 138
1128984201_1128984206 2 Left 1128984201 15:72207453-72207475 CCAGAGTGGGCCAACAATTCTGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1128984206 15:72207478-72207500 GCTGGGCTTCAACACCAATATGG 0: 1
1: 0
2: 0
3: 6
4: 73
1128984201_1128984210 26 Left 1128984201 15:72207453-72207475 CCAGAGTGGGCCAACAATTCTGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1128984210 15:72207502-72207524 TGCTTCATTGACGGAAGAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 174
1128984201_1128984209 25 Left 1128984201 15:72207453-72207475 CCAGAGTGGGCCAACAATTCTGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1128984209 15:72207501-72207523 ATGCTTCATTGACGGAAGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 137
1128984201_1128984211 27 Left 1128984201 15:72207453-72207475 CCAGAGTGGGCCAACAATTCTGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1128984211 15:72207503-72207525 GCTTCATTGACGGAAGAAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128984201 Original CRISPR GCAGAATTGTTGGCCCACTC TGG (reversed) Intronic
907334500 1:53691423-53691445 TCAGAATCCTGGGCCCACTCTGG + Intronic
910163619 1:84299331-84299353 GCAGAACTGTCGACCCACTTGGG - Intronic
916050838 1:161035789-161035811 GCACAATTCTTGGCCCAGTATGG - Intronic
920946100 1:210529845-210529867 CCTGATTTGCTGGCCCACTCAGG + Intronic
921278152 1:213539499-213539521 GCAGAATTGAGAGCCCAGTCTGG - Intergenic
1063720998 10:8581277-8581299 CCAGACTTGCTGGCCCTCTCTGG - Intergenic
1073092991 10:100959475-100959497 CCAGAACTGTCGGCCTACTCAGG + Exonic
1074955550 10:118384993-118385015 GCAGAATTTTGGCCCCACCCTGG + Intergenic
1075381096 10:122019166-122019188 GCAGACTTGCCGGCCCACCCTGG - Intronic
1076249787 10:128976973-128976995 GCTGAATGGGTGGCCCTCTCTGG + Intergenic
1077968977 11:7167533-7167555 GCAGAATTGTTTGCTCAAACTGG + Intergenic
1081503039 11:43685917-43685939 GCAGAATAGTTGGCACATTTTGG + Intronic
1083552560 11:63600917-63600939 GCAGAATGGTTGCCACATTCAGG - Intronic
1087676965 11:101174778-101174800 GCAGAATTGTAAGCCCAACCTGG - Intergenic
1088858030 11:113773629-113773651 ACAGAAGTTTTGGCACACTCCGG - Exonic
1089319097 11:117612957-117612979 GCAGAATCAGTGGCCCAATCAGG - Intronic
1091301773 11:134512416-134512438 CAAGGATTGCTGGCCCACTCCGG - Intergenic
1092436654 12:8452714-8452736 GCAGAATTGTGGGCAGGCTCAGG - Intergenic
1101778493 12:107815160-107815182 GCAGCACTGCTGCCCCACTCAGG + Intergenic
1106054746 13:26227777-26227799 GCAGCACTGCTGCCCCACTCAGG - Intergenic
1106851354 13:33796461-33796483 GCAGAATGGTTTGACCACTTTGG + Intergenic
1107736952 13:43408861-43408883 GCAGAAAGGTTTGCCCACTCTGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1117035686 14:51726221-51726243 GCAGAAATGTTTCCACACTCTGG + Intronic
1117980051 14:61333965-61333987 GCAGATTTTTTGGTCCTCTCTGG + Intronic
1122825358 14:104368032-104368054 TCGAAATTGATGGCCCACTCAGG + Intergenic
1128984201 15:72207453-72207475 GCAGAATTGTTGGCCCACTCTGG - Intronic
1130539543 15:84812293-84812315 CCAGAAATGTTGGCCAACCCTGG + Intergenic
1132906697 16:2286179-2286201 ACAGAATTTTTGGCCTCCTCTGG + Intronic
1135401975 16:22172205-22172227 GCAGCATTGCTGACCCTCTCTGG + Intronic
1136011749 16:27368022-27368044 GGAAAAGTGTTTGCCCACTCTGG + Intergenic
1144062194 17:11592772-11592794 GCAGAATTCTTGACCCTTTCAGG - Intergenic
1148644833 17:49213741-49213763 GTGGAATTGTTGGCCCAAACAGG - Intronic
1152511711 17:80794471-80794493 GCAGAATGGTGCGGCCACTCTGG + Intronic
1153685513 18:7540947-7540969 ACAGAATTTTTAACCCACTCTGG - Intergenic
1164445287 19:28312401-28312423 GCAGAAATGTTGGACTACTCCGG - Intergenic
1168560135 19:57375371-57375393 CCAGGCTTGGTGGCCCACTCCGG + Intronic
925179657 2:1808779-1808801 GCAGAAATGTGGGCACACTGGGG + Intronic
935462844 2:103359562-103359584 GCAGAATGGTTTGACCACTCAGG - Intergenic
941654186 2:168125647-168125669 GCAGAATATTTGGTCCATTCTGG - Intronic
946049917 2:216853976-216853998 GCAGAATCTTGGGCCCACCCTGG + Intergenic
1173599591 20:44284017-44284039 GCACAATTGGTGGCCCTCTTTGG - Intergenic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1175510847 20:59525084-59525106 ACAGAAATGTTGACCGACTCAGG - Intergenic
1177046500 21:16176720-16176742 TCAGAACTCTTGGCCCAGTCTGG - Intergenic
952835439 3:37598175-37598197 GCAGAATTATTTACCCTCTCAGG - Intronic
959606014 3:108242508-108242530 CCACAACTCTTGGCCCACTCTGG - Intergenic
970433557 4:16011273-16011295 ACAGACTTGTTGTCACACTCTGG - Intronic
991485870 5:67136448-67136470 GCAGAATTTCAGGCCCACTCCGG - Intronic
992907915 5:81365099-81365121 GCAGAAGTGTTGGTAAACTCAGG + Intronic
995940726 5:117580162-117580184 GCAGATCTGTTGTCCCTCTCTGG + Intergenic
999196178 5:149783105-149783127 GAGAGATTGTTGGCCCACTCAGG + Intronic
999424457 5:151475158-151475180 GCTGAAGTATGGGCCCACTCAGG - Intronic
1000472051 5:161655725-161655747 GCAAAAATGTTCCCCCACTCAGG - Intronic
1005810148 6:29509205-29509227 GCAGAATTGTTCTCCTCCTCAGG + Intergenic
1017525718 6:155240017-155240039 GCAGAACTCCTGGCCCACTGTGG + Intronic
1021362815 7:19737434-19737456 GCACAATTGTTGGGCCACATGGG - Intronic
1023054774 7:36282819-36282841 GCAGTATTGTGGGCCCAATGTGG + Intronic
1027540605 7:79459413-79459435 CCAGCATTCTTGGCCCAGTCTGG + Intergenic
1028709816 7:93894099-93894121 GCAGAATCCTCAGCCCACTCAGG + Intronic
1031919380 7:127589653-127589675 ACAGAATTGTTGGCCTAGGCTGG + Intronic
1038162405 8:25052483-25052505 GCAGAATTGAGTGCCCTCTCTGG + Intergenic
1038796352 8:30713776-30713798 GTAGAATTGCTGGGCCAATCAGG - Intronic
1041172269 8:55156244-55156266 GCAGATCTGTTGGAACACTCAGG + Intronic
1044217179 8:89625549-89625571 GCAAGATTGTTGGCATACTCAGG + Intergenic
1052343018 9:27381476-27381498 GCAGAATTCCAGGGCCACTCAGG - Intronic