ID: 1128985687

View in Genome Browser
Species Human (GRCh38)
Location 15:72219264-72219286
Sequence TGCTCCTCATGTTAGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1128985681_1128985687 12 Left 1128985681 15:72219229-72219251 CCACAGGGAAGCCAGACATGATC 0: 1
1: 0
2: 2
3: 18
4: 234
Right 1128985687 15:72219264-72219286 TGCTCCTCATGTTAGAAAAAGGG 0: 1
1: 0
2: 0
3: 25
4: 302
1128985683_1128985687 1 Left 1128985683 15:72219240-72219262 CCAGACATGATCTGGTTATGTGG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1128985687 15:72219264-72219286 TGCTCCTCATGTTAGAAAAAGGG 0: 1
1: 0
2: 0
3: 25
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128985687 Original CRISPR TGCTCCTCATGTTAGAAAAA GGG Intronic
902144023 1:14381744-14381766 TGTTCCTGATCTTAGAGAAAAGG - Intergenic
903283547 1:22263599-22263621 TGCTCCTCATTTTACAAACCAGG + Intergenic
903438610 1:23370504-23370526 TGACCCTCATTTTAGAGAAAAGG - Exonic
905231274 1:36516191-36516213 GGCTCCCCATGTTAGAAACTGGG + Intergenic
906306985 1:44725660-44725682 TGCTCCTCAAGTTAAAAAGCAGG + Intergenic
907478099 1:54720570-54720592 AGATCCTCATGTAAGAAACACGG - Intronic
907845235 1:58199487-58199509 TTATCCTCATTTTACAAAAAAGG - Intronic
908671628 1:66554425-66554447 TGCTCATCATGTTATACCAAGGG - Intronic
909340411 1:74525340-74525362 TTGTCCTCATGGTACAAAAAAGG + Intronic
910066655 1:83161422-83161444 TGCCACTCATGTAAGAAAGAAGG - Intergenic
910206659 1:84754997-84755019 TGTCCCTTATGTAAGAAAAAAGG + Intergenic
910950753 1:92645600-92645622 TGTTCCTCTAGTTAGAAATAAGG - Intronic
912871159 1:113308159-113308181 TGCTCTCCATGTTATAAAACAGG - Intergenic
914425712 1:147573668-147573690 TGCTCCCCATTTTAGAGATAAGG - Intronic
916397690 1:164409983-164410005 TGTTCCTGATCTTAGAGAAAAGG + Intergenic
916401183 1:164450170-164450192 TACTCCTCATGTTACAGATAAGG - Intergenic
916516449 1:165522167-165522189 TTTTCCTCATTTTTGAAAAATGG + Intergenic
917030718 1:170687563-170687585 TAATCCTCATTTTAGAGAAAAGG - Intronic
917686335 1:177419781-177419803 TTCTCCTTATGGTAGACAAAGGG + Intergenic
918560226 1:185856655-185856677 TTATACTCATGTTAGAATAAGGG + Intronic
918867440 1:189921106-189921128 TGCTCTTCATGCTAGCAAGAAGG - Intergenic
918931445 1:190860653-190860675 TGCTCCAGATGTTACTAAAAGGG - Intergenic
918941590 1:191005779-191005801 TGTTCCTGATCTTAGAGAAAAGG + Intergenic
919047217 1:192468282-192468304 TGTTCCACATCTTAGAGAAAAGG + Intergenic
919644346 1:200079050-200079072 TAATCCTCATGTTACAGAAATGG + Intronic
922509042 1:226147547-226147569 TCCTCCCCATTTTAGAAAGATGG + Intronic
923036442 1:230288074-230288096 TCCTCCTCATGTGAGGAACACGG + Intergenic
924223108 1:241898462-241898484 TGCTCTGGATCTTAGAAAAATGG + Intergenic
1063486046 10:6422318-6422340 TGGTCCTCATTTTAGAAAGGAGG + Intergenic
1063934121 10:11059384-11059406 TGCTCCCCACCTTAGTAAAATGG - Intronic
1064917449 10:20476151-20476173 AGCACCTGATGTTGGAAAAATGG - Intergenic
1066781026 10:38944536-38944558 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1066953861 10:42147589-42147611 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1067202587 10:44186184-44186206 TGATGCTCATGTTAAACAAATGG + Intergenic
1068086202 10:52375743-52375765 TTCTCCTCATTTTAAAAAATGGG + Intergenic
1068158172 10:53228235-53228257 TGTTCCTGATCTTAGAGAAAAGG - Intergenic
1068870196 10:61935119-61935141 AGCACCTCCTGTTGGAAAAATGG + Intronic
1070238753 10:74656655-74656677 TGTTCCTCATCTGACAAAAATGG + Intronic
1070721105 10:78757856-78757878 TGGTCCTCCTGTTAGGCAAAAGG + Intergenic
1072323824 10:94276820-94276842 TGTTCCTTATTTTGGAAAAATGG + Intronic
1074198439 10:111209214-111209236 TGCTCCTCTTGTGAGACAAAGGG + Intergenic
1075448789 10:122532766-122532788 TGAGCCTGATGTTTGAAAAATGG + Intergenic
1075837808 10:125470795-125470817 TGCTCTACACGTTAGAACAAAGG - Intergenic
1076428231 10:130382346-130382368 TGCTCCTCATTTTCAAGAAAGGG + Intergenic
1076454517 10:130580567-130580589 TGTACCTCATGTTATTAAAAAGG - Intergenic
1077778377 11:5296579-5296601 TCCTCATCATGTTACAATAACGG - Intronic
1078074737 11:8148062-8148084 TGCTCCTGAGGTAAGAAAGAAGG + Intronic
1078827625 11:14945150-14945172 TGTTTCTCATGAAAGAAAAAAGG - Intronic
1081326003 11:41745065-41745087 TGTTTCTGATTTTAGAAAAAAGG - Intergenic
1081736998 11:45411138-45411160 TTTTCCTCATTTCAGAAAAATGG - Intergenic
1082738693 11:56886259-56886281 TGCTCTTTATGGTAAAAAAATGG - Intergenic
1082770398 11:57203361-57203383 AGCTGCTGAGGTTAGAAAAAGGG - Intergenic
1085633286 11:78137853-78137875 AGCACATGATGTTAGAAAAATGG + Intronic
1085879729 11:80452055-80452077 TGCTCTTCATGTTGGTAACATGG - Intergenic
1085926605 11:81031378-81031400 TGTTCCACATCTTAGAAGAAAGG - Intergenic
1087720457 11:101659328-101659350 TGTTCCACATCTTAGAGAAAAGG + Intronic
1088098002 11:106122131-106122153 TTCTTCTCTTCTTAGAAAAATGG - Intergenic
1089085315 11:115812201-115812223 AGGTCCTCCTGTTAGAAAAAGGG - Intergenic
1089862449 11:121602028-121602050 TGCTCCAGATGTTAAAAATATGG - Intronic
1090954906 11:131505118-131505140 TTCTCCTCATCTAAGAAATAGGG + Intronic
1091154944 11:133363425-133363447 TTCTCCTTATGTGAGAAAATGGG + Intronic
1091540192 12:1453439-1453461 TGCTCAACATTTTAGAACAAGGG - Intronic
1093556862 12:20486541-20486563 TGTTCCTCATGTTTTTAAAAAGG + Intronic
1095042810 12:37462383-37462405 TGATCCTGATCTTAGAATAAGGG + Intergenic
1096118960 12:49074202-49074224 TCATCCTAATGTTAGATAAATGG + Intergenic
1096988176 12:55775926-55775948 GGCTCCTCATGTGAGAGCAATGG - Intronic
1097798663 12:63889495-63889517 TGCTGCTGCTGTTAGAAAATGGG + Intronic
1098006339 12:66000514-66000536 TGCTCCCAATGTTGGAAATAAGG + Intergenic
1098667108 12:73178406-73178428 TGTTCCTGATCTTAGAAGAAAGG + Intergenic
1098798221 12:74921134-74921156 TACTCCTCATTTTTGACAAATGG - Intergenic
1099344789 12:81484657-81484679 TGCTTCTCTTGCTAGAATAAGGG - Intronic
1100329138 12:93569410-93569432 AGCCCTTCATGTTATAAAAAGGG + Intergenic
1100629359 12:96371948-96371970 TGCTTATCATGTTAAAAAGAGGG + Intronic
1101041501 12:100760517-100760539 TACTCCTCATTTTAGAGAACAGG - Intronic
1101562633 12:105873072-105873094 TGTTCCAGATCTTAGAAAAAAGG - Intergenic
1102168822 12:110826701-110826723 TTCTCCTCATTTTACAAAAGAGG - Intergenic
1103409110 12:120698249-120698271 TGCTCCTTATGTGACAAAATAGG + Exonic
1103860262 12:124006819-124006841 TCCTCCTCAGGTCAGAAAGAGGG + Intronic
1105589625 13:21779236-21779258 AGCCCATGATGTTAGAAAAATGG - Intergenic
1106293900 13:28392384-28392406 TACTCCTCATGCTTGGAAAATGG - Intronic
1106907221 13:34421499-34421521 TGCCCCTTCTGGTAGAAAAAGGG - Intergenic
1109200424 13:59424767-59424789 TGCTGCTCTTTTTAAAAAAAAGG + Intergenic
1110084158 13:71356085-71356107 TTCTCATTATTTTAGAAAAATGG + Intergenic
1110321935 13:74170690-74170712 TGCTTCACATGTTTGAAAAAGGG + Intergenic
1110903590 13:80856727-80856749 TGTTCCTCATCTTGGAAACAAGG - Intergenic
1112137059 13:96591768-96591790 TGTTCCTGATCTCAGAAAAAAGG + Intronic
1112302358 13:98241475-98241497 AGCTTCTCTTTTTAGAAAAATGG + Intronic
1114069176 14:19094599-19094621 TTCTCCTCATCTTATAAAATTGG + Intergenic
1115208736 14:30942910-30942932 TGATCCTCATTTTACAAATAAGG + Intronic
1115805451 14:37046060-37046082 TGATCCTCATTTTACAAATAAGG + Intronic
1117755010 14:58965596-58965618 AGCTCTTCATGTTAGAACATAGG + Intergenic
1118521765 14:66593743-66593765 TGTTCCTCATCTTAGGAAAAAGG - Intronic
1118613381 14:67558576-67558598 AGCTCCTTAGGTCAGAAAAAAGG + Intronic
1120221152 14:81735268-81735290 TGTTCCACTTGTGAGAAAAAGGG + Intergenic
1120324297 14:83005845-83005867 TGCTTCACATTTTAAAAAAATGG - Intergenic
1120428525 14:84382522-84382544 TGTTCCTTATCTTAGAAGAAAGG - Intergenic
1120537287 14:85712673-85712695 TGCTTCTCATGGTGGCAAAAAGG - Intergenic
1122194883 14:100077478-100077500 GGCTCCACATTTTAGAAGAAAGG + Intronic
1125452426 15:39823396-39823418 GGTTGCTCATGTTAGAAACATGG + Intronic
1125766303 15:42138781-42138803 AGCCCCTCATGAGAGAAAAAGGG - Intergenic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1127406460 15:58653289-58653311 TGTTCCCAATCTTAGAAAAAAGG + Intronic
1128985687 15:72219264-72219286 TGCTCCTCATGTTAGAAAAAGGG + Intronic
1129508447 15:76102529-76102551 TGCTTGACATGTTGGAAAAATGG + Intronic
1131059278 15:89394658-89394680 TTATCTTCATGTTAGAAATAAGG - Intergenic
1133185541 16:4094782-4094804 TGCTCATCATTTGAGCAAAAAGG + Intronic
1136695984 16:32082545-32082567 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1136715873 16:32280821-32280843 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1136752039 16:32648944-32648966 TTATCCTGAAGTTAGAAAAATGG + Intergenic
1136771335 16:32844260-32844282 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1136796477 16:33025798-33025820 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1136822550 16:33331522-33331544 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1136829113 16:33388061-33388083 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1136834179 16:33486843-33486865 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1136868224 16:33772965-33772987 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1136899243 16:34017193-34017215 TTATCCTGAAGTTAGAAAAATGG - Intergenic
1137083935 16:36099428-36099450 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1137972664 16:53001271-53001293 TGGTCCTTATGTGAGAAAGAGGG + Intergenic
1139060528 16:63245304-63245326 TCCTTCCCATGTTAGAGAAATGG + Intergenic
1139559741 16:67734499-67734521 TACTCCCTATGGTAGAAAAAGGG + Intronic
1203010737 16_KI270728v1_random:237677-237699 TTATCCTGAAGTTAGAAAAATGG + Intergenic
1203054181 16_KI270728v1_random:908930-908952 TTATCCTGAAGTTAGAAAAATGG + Intergenic
1203073760 16_KI270728v1_random:1106370-1106392 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1203103950 16_KI270728v1_random:1343311-1343333 TTATCCTGAGGTTAGAAAAATGG + Intergenic
1203129564 16_KI270728v1_random:1619057-1619079 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1144222286 17:13111062-13111084 AGTGCCTCATGTTGGAAAAATGG + Intergenic
1145690495 17:26733674-26733696 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1145710266 17:26964839-26964861 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1145921962 17:28616346-28616368 TGCCCCTGATGATAGAAAAATGG - Intronic
1146231370 17:31113900-31113922 TGCTCCTCATTTTGGGAAGAGGG - Intronic
1150594130 17:66589513-66589535 TGCTCCTTATAGTAAAAAAATGG - Intronic
1150871300 17:68914213-68914235 TGTTCCAGATCTTAGAAAAAAGG - Intronic
1152456273 17:80418197-80418219 TCATCCTCAAGTCAGAAAAAAGG - Intronic
1153707742 18:7763599-7763621 TTCTCCTCATGATAGGAAATTGG + Intronic
1154230935 18:12555738-12555760 TGTTCCTGATCTTAGAAGAAAGG - Intronic
1155291390 18:24345862-24345884 TGCTCCTCTTTTATGAAAAAAGG + Intronic
1155321891 18:24627503-24627525 TACTCTTAATTTTAGAAAAAGGG - Intergenic
1155534246 18:26800017-26800039 TGTTCCAGATTTTAGAAAAAAGG - Intergenic
1157176160 18:45454244-45454266 AGATCCTCATGTTAAAAAAAAGG - Intronic
1157999794 18:52604477-52604499 TTTTCCTCATGTTTGAAAAGTGG + Intronic
1158555776 18:58473551-58473573 TGCTCTTCATGTACGAAAATGGG - Intergenic
1159082540 18:63752167-63752189 TGCTTCACTTGTTTGAAAAATGG - Intergenic
1159319494 18:66829151-66829173 TGTTCCTGATCTTAGAAGAAAGG + Intergenic
1159375450 18:67586542-67586564 TGTTCCTCATGGGAGAAAATTGG + Intergenic
1159395429 18:67849281-67849303 TTCTCATCATGTTCAAAAAAGGG + Intergenic
1166249482 19:41557874-41557896 TTATCCTCATGTTAGAGATATGG + Intronic
1166326838 19:42056291-42056313 TCCTCCTCCTGTTTAAAAAATGG - Intronic
1168215020 19:54919015-54919037 TTCTACTCCTGTTAGAATAATGG + Intergenic
925761109 2:7185551-7185573 TGCTCCTCAATTTAAAGAAATGG + Intergenic
926966845 2:18424452-18424474 CCCACCTCATGTTAGAAAGAAGG + Intergenic
927556481 2:24037329-24037351 TACTCCTCCAGTTATAAAAAAGG - Intronic
928635585 2:33242582-33242604 GGCTCCTAATCTAAGAAAAAAGG - Intronic
930475747 2:51879319-51879341 TGTTCTACATGTTAGAGAAATGG - Intergenic
930785545 2:55268582-55268604 AGCTCCTCATTTTACAGAAAAGG + Exonic
932566333 2:72913399-72913421 TGCCCATCATATTAGGAAAATGG - Intergenic
933610157 2:84425537-84425559 TGCTCCTCCTGGGAGAAGAATGG - Exonic
934251273 2:90358074-90358096 TTATCCTGAGGTTAGAAAAATGG + Intergenic
934258287 2:91445326-91445348 TTATCCTGAGGTTAGAAAAATGG - Intergenic
936415211 2:112301527-112301549 TGCTTCTCATGTGAAAAAAATGG - Intronic
937062240 2:118989352-118989374 TGTTCCTCGTGTTAGGGAAAGGG - Intronic
938517902 2:132036040-132036062 TTATCCTGAGGTTAGAAAAATGG + Intergenic
938546504 2:132337630-132337652 TTCCCCTCATGTTACATAAAAGG - Intergenic
938844136 2:135191270-135191292 TGTTCCTGATCTTAGAAGAAAGG - Intronic
939214282 2:139215981-139216003 TGCCCTTCCTGTTAGAAAGATGG - Intergenic
940309127 2:152258691-152258713 GGCTTCTCAGGTAAGAAAAATGG - Intergenic
941088817 2:161149758-161149780 TGCACCACATCATAGAAAAATGG - Intronic
941112487 2:161430257-161430279 ATCTCTTCATGTTAGCAAAAGGG + Intronic
941138255 2:161744201-161744223 TGTTTCACATCTTAGAAAAAAGG + Intronic
942475731 2:176318048-176318070 TGCTTTCCATCTTAGAAAAATGG + Intronic
943215837 2:185032880-185032902 TGTTCCTGATCTTAGAGAAAAGG + Intergenic
943467038 2:188240643-188240665 TTCTCCACATGTTAGAGGAAAGG - Intergenic
943516781 2:188898508-188898530 TTATCCTCATTTTAGAAAAAGGG - Intergenic
943918181 2:193665190-193665212 TGATCCTCATTTTAGAAAACAGG + Intergenic
944950102 2:204738820-204738842 TTCTCCTGATGTTAGCAGAAGGG - Intronic
945096556 2:206224635-206224657 TGCTCATGATGTAAGTAAAATGG - Intergenic
945187693 2:207156348-207156370 TGCTCCTCTTACTAGAAAGATGG + Intronic
946697779 2:222378128-222378150 TGTTCCTCATCTTATAAGAAAGG - Intergenic
946803868 2:223450461-223450483 TGCTTCTCATGTTTGAATGAGGG - Intergenic
947789835 2:232858850-232858872 TGATCCACATGTTAGCAGAAAGG - Intronic
948101923 2:235381877-235381899 TGCTCTCCATATTAGAAATATGG + Intergenic
1168972813 20:1942424-1942446 TGCTCCTGATGTTCAAAAACAGG + Intergenic
1169697285 20:8404517-8404539 TGCTTCTCAGGGGAGAAAAAAGG - Intronic
1171875364 20:30570362-30570384 TTCCCCTCATGTTACATAAAAGG - Intergenic
1173048918 20:39540285-39540307 TGCACCTCCTGATACAAAAAGGG - Intergenic
1174101453 20:48129303-48129325 TGTCACTCATGTTAGAAAAGGGG - Intergenic
1174594474 20:51672920-51672942 TGCTTTTGATTTTAGAAAAAGGG - Intronic
1176690826 21:9906437-9906459 TTCTTCCCATGTCAGAAAAAAGG + Intergenic
1177027683 21:15940555-15940577 TGATCCTCCTGTTCAAAAAAAGG + Intergenic
1177759353 21:25385361-25385383 TGCAAATAATGTTAGAAAAATGG + Intergenic
1180089928 21:45528709-45528731 TTTTCCTCGTGTAAGAAAAATGG + Intronic
1180745122 22:18083212-18083234 TGCTCCTGATCTTAGAGGAAAGG + Intronic
1203235833 22_KI270732v1_random:315-337 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1203288930 22_KI270735v1_random:15769-15791 TTATCCTTAGGTTAGAAAAATGG + Intergenic
1203324702 22_KI270738v1_random:2960-2982 TCATCCTGAGGTTAGAAAAATGG + Intergenic
951016335 3:17736465-17736487 TGTTCCTCATGGAAGTAAAAGGG + Intronic
951423484 3:22515321-22515343 TGCTCCAGATCTTAGAAGAAAGG - Intergenic
953986735 3:47449632-47449654 TGCTCCTCAAACTAGAAAGATGG + Intronic
956462802 3:69488363-69488385 TTCACATCATGTTAGAAAGATGG + Intronic
958915413 3:100044931-100044953 AGCACCTCATATCAGAAAAATGG - Intronic
959500122 3:107097499-107097521 TGCTCCTAATGGTAACAAAATGG + Intergenic
960035677 3:113100728-113100750 AGCACATGATGTTAGAAAAATGG + Intergenic
960530591 3:118759734-118759756 AGCTCCTCATGCTAGAAACTAGG - Intergenic
961096631 3:124162200-124162222 TGCTCCACAGGTTAGAAGACAGG + Intronic
962203683 3:133418393-133418415 TACTCCTCATGTGAGAGCAATGG - Intronic
963218941 3:142784545-142784567 TGCTTTTATTGTTAGAAAAAGGG + Intronic
963394734 3:144717010-144717032 TACTCCTGATATTAGAGAAAAGG - Intergenic
964215608 3:154277991-154278013 TACTCAACATTTTAGAAAAATGG + Intronic
967688754 3:192448695-192448717 AGCTCCTCATTTTAAAAACAGGG + Intronic
968765025 4:2463618-2463640 TGCTTCTGATGCTAGAGAAAGGG - Intronic
969220601 4:5756159-5756181 TGCATCTCAGGTTAGAAAGAAGG - Intronic
970052820 4:11934755-11934777 TGTTCTACATGTTAGAAGAAGGG + Intergenic
970667267 4:18352160-18352182 TGTTCCAGATCTTAGAAAAAAGG + Intergenic
972361525 4:38330002-38330024 TGCTCCTCATTTTAAAATAATGG + Intergenic
973805866 4:54525674-54525696 TACTCCTTATCATAGAAAAAAGG - Intergenic
975918096 4:79348358-79348380 TGTTCCCAATCTTAGAAAAAAGG + Intergenic
976913878 4:90345012-90345034 TGCTCATCTGCTTAGAAAAAGGG + Intronic
977151092 4:93512701-93512723 AGCTCCTGGTGTTACAAAAAAGG - Intronic
977273207 4:94943693-94943715 TGCTCTTCGTGTTAAAGAAATGG + Intronic
977861099 4:101960971-101960993 TGCTTCTCAAGTCAGAAAGATGG - Intronic
978361245 4:107932490-107932512 TGGCCCCCATGTTAGAAAGAGGG + Intronic
979064791 4:116116522-116116544 TGATCCTGATGTTAGAGAAAAGG - Intergenic
979232068 4:118357317-118357339 GGCTCCTCATCTGTGAAAAAGGG + Intergenic
979269658 4:118744860-118744882 TGTTCTTCATGTAAGAAAAAAGG - Intronic
981094413 4:140763481-140763503 AGCTCCTCATTTTATATAAAAGG + Intergenic
981276567 4:142905203-142905225 TGTTCCATATCTTAGAAAAAAGG + Intergenic
981453425 4:144926156-144926178 TGTTCCACATCTTAGAAAAAAGG + Intergenic
982371163 4:154634947-154634969 TGCTATTGTTGTTAGAAAAAAGG + Intronic
983300871 4:165923831-165923853 AGCTCATATTGTTAGAAAAATGG - Intronic
983349303 4:166567264-166567286 AGCTCTTCAGGCTAGAAAAAGGG + Intergenic
986884887 5:12221726-12221748 TGCTCCAGATCTTAGAAAGAAGG + Intergenic
988083203 5:26439096-26439118 TGTTCCTCATCTCAGAGAAAAGG - Intergenic
988678184 5:33456176-33456198 GGGTCCTCATGTTAGACACACGG + Exonic
988845843 5:35126979-35127001 TACTCCTCATGTAAGAAGAATGG + Intronic
989212624 5:38871107-38871129 TTCTCCTTTTCTTAGAAAAATGG + Intronic
989454874 5:41631683-41631705 TGTTCCTGATATTAGAAGAAAGG - Intergenic
990068174 5:51744617-51744639 AGCACATGATGTTAGAAAAATGG + Intergenic
990529845 5:56662264-56662286 AGCTCCACATGTTAGATCAATGG - Intergenic
990854119 5:60243872-60243894 TGTTCCTGATCTTAGAGAAAAGG - Intronic
992736006 5:79722337-79722359 GACTTCACATGTTAGAAAAAGGG + Intronic
993408818 5:87548588-87548610 TGTTCCTAATCTTAGAGAAAAGG + Intergenic
995691950 5:114836737-114836759 TGCTCGTCATCTTAGAAGAAAGG - Intergenic
997713514 5:136025891-136025913 TGCTTTTCATGTTTGAAAGAGGG + Intergenic
998005308 5:138652864-138652886 TTATCCTCATTTTAGAAACAGGG - Intronic
998634007 5:143932234-143932256 TACTCCTCCTGTTCGAGAAAAGG + Intergenic
1000247892 5:159464508-159464530 TGCTTCTTAGGTTATAAAAAGGG - Intergenic
1000543425 5:162569338-162569360 TGCTCTACATCTTAGAAACACGG + Intergenic
1001999399 5:176189324-176189346 TGCTCCACATGTTGGGAAGAAGG - Intergenic
1002649776 5:180682580-180682602 TGCTCCACATGTTGGGAAGAAGG + Intergenic
1004069377 6:12284169-12284191 TGCACATCACGTTAGAGAAAAGG + Intergenic
1005387131 6:25296297-25296319 AGCTCCTCATGGCAGAAAAGAGG - Intronic
1005703324 6:28426631-28426653 TGCACATGATGTTGGAAAAATGG + Intergenic
1006119681 6:31796151-31796173 ATCTCCTCATGTATGAAAAAAGG + Intergenic
1007211515 6:40196564-40196586 TGCTCCTAAAGTTGGAAAATTGG - Intergenic
1007258970 6:40548814-40548836 TCCTCCTCATGGTAGCAAGATGG - Intronic
1008053391 6:46922612-46922634 TGATCCTCATTTTACAAAAGAGG + Intronic
1009329344 6:62396905-62396927 TGTTCCAGATGTTAGAAAAAAGG + Intergenic
1009949875 6:70383105-70383127 TGCTCTGCATTCTAGAAAAAGGG + Intergenic
1010011242 6:71050650-71050672 TGATCCTCAAGTTATAATAAAGG - Intergenic
1010790392 6:80057593-80057615 TTCTTCTCATGTTAGGAAAAGGG - Intergenic
1010975479 6:82308119-82308141 TGCTCCAGATCTTAGAGAAAAGG + Intergenic
1012179338 6:96131828-96131850 CTCTCCACATGTTAGAGAAATGG - Intronic
1012770745 6:103431028-103431050 TGTTCCTGATCTTAGAGAAAAGG - Intergenic
1013823723 6:114185616-114185638 AGCACCTGCTGTTAGAAAAATGG - Intronic
1014041005 6:116825154-116825176 TGCTCCACTTCTTAGAGAAAAGG - Intronic
1014073478 6:117210298-117210320 TGCTCCATATCTTAGAGAAAAGG + Intergenic
1016643156 6:146373935-146373957 TGCTCCACATCTTAGAGGAAAGG + Intronic
1018233074 6:161694752-161694774 TCATCCTCATGTTAGCAAACAGG - Intronic
1021382128 7:19980766-19980788 TGTTCCTTATCTTCGAAAAAAGG + Intergenic
1024272103 7:47650442-47650464 TGCTCACAATGTTAGAAAACTGG - Intergenic
1024317210 7:48032473-48032495 TGCTCTGCATGTTAAAATAATGG - Intergenic
1025288709 7:57691971-57691993 TGATCCTGATCTTAGAAGAAGGG + Intergenic
1025320668 7:58089994-58090016 TTATCCTGAGGTTAGAAAAATGG - Intergenic
1026645163 7:72161123-72161145 TTCTCCTCATGGTCAAAAAATGG - Intronic
1027277454 7:76573339-76573361 TGCCACTCATGTAAGAAAGAAGG + Intergenic
1027585468 7:80052707-80052729 TGCTTATCATATTAGAAATATGG - Intergenic
1028823854 7:95246037-95246059 TGCTCCTCCTGTTATGCAAAAGG - Intronic
1031644431 7:124206299-124206321 AGGTCCTAATGTTACAAAAATGG - Intergenic
1033485739 7:141787369-141787391 GGTACCTCATGTTATAAAAAGGG - Intronic
1034061895 7:148099700-148099722 TGCTCCTCATGAGATACAAACGG - Intronic
1035197517 7:157234651-157234673 TGCTCTTCAGGTTTGAGAAAGGG + Intronic
1035349179 7:158232995-158233017 TGCTCCAAATGTTAGAGAAAAGG - Intronic
1036474702 8:9082635-9082657 GGCTCCTCATCTTAGAAAGTAGG + Intronic
1037117476 8:15243861-15243883 TGATCTTACTGTTAGAAAAAAGG + Intergenic
1037635425 8:20697708-20697730 TGCTCTACATTTTAGAGAAAAGG + Intergenic
1038160441 8:25031957-25031979 TGCTCCTAAGGTAACAAAAAAGG - Intergenic
1042417297 8:68536497-68536519 TGCATCTAATGTAAGAAAAATGG - Intronic
1044506765 8:93029611-93029633 TGCACCTCCTGTCAGAATAATGG - Intergenic
1044858191 8:96496017-96496039 TGCTCCTCTTGTTGCAAAACAGG + Intronic
1045640143 8:104240701-104240723 GGCTCCTCATTTATGAAAAAGGG - Intronic
1046318474 8:112538264-112538286 TGTTCCAGATCTTAGAAAAAAGG - Intronic
1047281985 8:123453800-123453822 TTCTCCTCATGTTACAAATTAGG + Intronic
1047394913 8:124488153-124488175 TGCTACTCAAGTTTCAAAAAAGG - Intergenic
1048437327 8:134430717-134430739 TTCTCCTCATTTTACAAATAAGG - Intergenic
1049940375 9:540106-540128 TGCTCCTGATCTTAGAGGAAAGG + Intronic
1050003161 9:1099889-1099911 TTCTCCTCATTTTAGAAATAAGG + Intergenic
1051308119 9:15738121-15738143 TGCTCTTTATGTTGGCAAAAAGG - Intronic
1052119602 9:24695453-24695475 TCCTCCTAAGATTAGAAAAAAGG + Intergenic
1053627560 9:39890953-39890975 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1053778433 9:41575070-41575092 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054216327 9:62359750-62359772 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054671154 9:67795593-67795615 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1055234879 9:74108766-74108788 TGCTCCACCTGATAGAAAACAGG - Intergenic
1055590043 9:77802808-77802830 AGCTATTCATGTTAGAAAATGGG + Intronic
1056039030 9:82641536-82641558 TGCTCCAGATCTTAGAGAAAAGG - Intergenic
1056273366 9:84968685-84968707 TACTTCTCATCTTAGTAAAATGG + Intronic
1056963262 9:91145259-91145281 TGCTCTTCTTGGTAGAGAAAAGG + Intergenic
1057062011 9:92012653-92012675 TCCTCCTCATTTTTGAAAGATGG - Intergenic
1057708241 9:97412774-97412796 TGCTCCTCGTTTGAGAGAAATGG - Intronic
1059007919 9:110423740-110423762 TGCAACTCATGTAATAAAAAAGG + Intronic
1060272386 9:122154740-122154762 TGCTTTTAATTTTAGAAAAAGGG - Intronic
1061712751 9:132499068-132499090 TGCTGCTCACGTTACAAGAATGG + Intronic
1186791200 X:13000730-13000752 TCCTCTTCATGTTTGAGAAATGG - Intergenic
1186969884 X:14830325-14830347 AGCACCTTATGTCAGAAAAATGG + Intergenic
1187262600 X:17700888-17700910 TACCCTTCATGTTAGAAAGAAGG + Intronic
1187675613 X:21713234-21713256 TGCTCCTCATTTTAGAAATTAGG + Intronic
1188149785 X:26657881-26657903 TGTTCCTAATCTTAGAGAAATGG + Intergenic
1189532218 X:41897177-41897199 TCTTCCTAATCTTAGAAAAAAGG + Intronic
1191972835 X:66836787-66836809 TGCTCCAGATCTTAGAGAAAAGG - Intergenic
1194246680 X:91521069-91521091 TGTTCCAGATCTTAGAAAAAAGG + Intergenic
1194834602 X:98666557-98666579 TGTTCCAGATCTTAGAAAAAAGG + Intergenic
1195075076 X:101319157-101319179 TGTTCCACATCTTAGAGAAAAGG + Intergenic
1195853065 X:109304082-109304104 TGCTCCTCATCTTTGAAATAGGG + Intergenic
1197466480 X:126810278-126810300 TGCTCCAGATCTTAGAGAAAAGG + Intergenic
1198457395 X:136829938-136829960 TGGTCCTCATGATGGAGAAAAGG - Intergenic
1198458569 X:136841482-136841504 TGATGCTTATATTAGAAAAAAGG - Intergenic
1198696865 X:139350578-139350600 TGCTCCTGATCTTAGAGGAAAGG + Intergenic
1199257896 X:145737943-145737965 AGCTCCACAAGGTAGAAAAAGGG + Intergenic
1200565639 Y:4762337-4762359 TGTTCCAGATCTTAGAAAAAAGG + Intergenic