ID: 1128986775

View in Genome Browser
Species Human (GRCh38)
Location 15:72227944-72227966
Sequence CATCAGTGTCACAACATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128986775 Original CRISPR CATCAGTGTCACAACATTCA AGG Intronic
908423988 1:63987109-63987131 GATCTGTGTGACAGCATTCAAGG - Intronic
909696562 1:78474107-78474129 CCTCAGGGTCACAAAATGCAGGG - Intronic
909698362 1:78491928-78491950 CTTCAGAGTAGCAACATTCAAGG - Intronic
911480038 1:98427236-98427258 CATCAGTTTCCCAACTTCCAAGG - Intergenic
912964251 1:114223680-114223702 TATCAGTGTCAAAACATTCTAGG + Intergenic
917228590 1:172811688-172811710 CATCAGTTTAAAAATATTCATGG + Intergenic
917458179 1:175203757-175203779 CATCAGTGGCAGCAGATTCAAGG - Intergenic
918025418 1:180740033-180740055 TATCAGGGTCACAATATACAAGG - Intronic
919356796 1:196535161-196535183 AATCAGAGTCCCAACATTCTAGG + Intronic
923319852 1:232820383-232820405 CATGAAAGTCACAACTTTCATGG + Intergenic
924393875 1:243595099-243595121 CATCATTGTGACAACATCCTAGG + Intronic
1062813944 10:485491-485513 CATCACTGTCTCAAAAATCAAGG + Intronic
1065042019 10:21706929-21706951 CTTCAGTGACACCACAGTCATGG + Intronic
1073972180 10:109056987-109057009 CATCAGGGTCACCACAGTGAAGG - Intergenic
1076068467 10:127467533-127467555 CATAAGTGATACAACATGCATGG + Intergenic
1076739120 10:132472941-132472963 CATCAGTATTACAGAATTCAAGG + Intergenic
1079272131 11:18998882-18998904 CTTCAGTGTCTAAACATTGAAGG + Intergenic
1082806648 11:57455955-57455977 CTTCAGTGTCCCATCATTGAAGG - Intergenic
1083152092 11:60798272-60798294 CCTCAGTTTCCCCACATTCATGG + Intronic
1091317023 11:134621722-134621744 CATCAGTTTCACAGCCTTGAAGG - Intergenic
1092743604 12:11653067-11653089 CAACAGTGCCACAACCTTCAAGG - Intronic
1093203378 12:16216954-16216976 GAACAGTGTCAGAAAATTCATGG + Exonic
1094593039 12:31839073-31839095 CATCAGTCTCCCAACATGCTGGG - Intergenic
1099484442 12:83211025-83211047 CTTCAGGGTCAGAACATTCTGGG + Intergenic
1099775124 12:87116915-87116937 CAGCAGTCTTCCAACATTCACGG + Intergenic
1101627692 12:106461735-106461757 GAGCAGTGTCACAACATCAAGGG - Intronic
1105356152 13:19661856-19661878 CATCAGTTTCAGAGCTTTCATGG + Intronic
1108228215 13:48312318-48312340 CATCTGTGGCACAACATGAAAGG - Intronic
1108431814 13:50360799-50360821 CATGAGTGTCCCAGCACTCAAGG - Intronic
1109749271 13:66668411-66668433 CATCAATGTCACATCTTTGATGG + Intronic
1113260064 13:108552039-108552061 CATCAGTGTCCCTAGACTCAGGG - Intergenic
1114543895 14:23484182-23484204 CATAAGTGTCACAACTGTCCTGG - Intronic
1116117162 14:40669391-40669413 AATGAGTATCACAAAATTCAGGG - Intergenic
1116118954 14:40696216-40696238 CATAAGTGTAACAGCTTTCAGGG - Intergenic
1118399309 14:65364856-65364878 CCGCAGTGTCACATCATTCCTGG + Intergenic
1121966957 14:98318140-98318162 CCTCAGTGTCACAAAATGCTGGG + Intergenic
1125376941 15:39040201-39040223 CATTAGTGCCACCACTTTCAAGG - Intergenic
1128104411 15:65032763-65032785 CTTCAGTTTCAAAGCATTCAAGG - Intergenic
1128986775 15:72227944-72227966 CATCAGTGTCACAACATTCAAGG + Intronic
1133294342 16:4743581-4743603 CACCACTGTCACTACACTCATGG + Intronic
1133658353 16:7889202-7889224 CATCAGAGTCACAATTTTGAGGG + Intergenic
1133669739 16:8006762-8006784 AGTCAGGGTCAGAACATTCAGGG - Intergenic
1137780565 16:51094752-51094774 GGTCCGTGTCCCAACATTCACGG + Intergenic
1141045427 16:80712403-80712425 CGTCAATGTCACAACATTGCTGG + Intronic
1141295733 16:82767449-82767471 CATCGGTGCAACAACATGCAAGG - Intronic
1141966064 16:87444373-87444395 CATCAGAGTAACGACATTAATGG + Intronic
1143291799 17:5837177-5837199 CATCAGTGCCAGCACATTCCTGG - Intronic
1146534535 17:33638889-33638911 CATCAGTTGCAAAACCTTCAAGG + Intronic
1152133369 17:78490551-78490573 CACCAGTGTCACAGCAGTGAAGG - Intronic
1153211805 18:2774922-2774944 CAACAGTGTAACAAGGTTCAAGG - Intronic
1162102884 19:8351109-8351131 CCTCAGCCTCACAACATTCTGGG - Intronic
1162306542 19:9877926-9877948 CATCACAGTCTCAACATTCCAGG + Intronic
1162603941 19:11692961-11692983 AATCAGAGTCACAAAATGCAGGG + Intergenic
1165878458 19:39026079-39026101 CATCATTTTCACCACATTCTTGG - Intronic
925655843 2:6148120-6148142 CATCATTGGCTCAATATTCAAGG + Intergenic
929745835 2:44657390-44657412 CTTCAGGTTCACAATATTCATGG - Intronic
930843632 2:55876685-55876707 CAGCAGTGCTACAACATTCTTGG - Exonic
931777816 2:65555222-65555244 CATCACTGTCACTAAATCCAGGG - Intergenic
932394757 2:71434935-71434957 CATCAGTCTCTCTACATTTAGGG - Exonic
935257538 2:101324813-101324835 CAACAGAGTCCCAACATACATGG + Intergenic
935463333 2:103364999-103365021 CTTCAGTGTCAACACATCCAAGG - Intergenic
935655814 2:105421840-105421862 CATCAGGGACTCAACATTCTAGG + Intronic
941659825 2:168184383-168184405 GATCATTGTCACAACATGGATGG + Intronic
943296113 2:186141931-186141953 CATCAGTGACATACCATCCATGG - Intergenic
944473867 2:200084481-200084503 AATCAGTGAGACAACAGTCAGGG - Intergenic
946138482 2:217667768-217667790 CATCAGTGTTTCAATATTCAAGG + Intronic
946867767 2:224057997-224058019 ATTCAGTATCACAACAATCATGG + Intergenic
1173135219 20:40433362-40433384 CATCAATGACACAACAGTCAGGG + Intergenic
1174160911 20:48549793-48549815 CCCCAGGATCACAACATTCAAGG + Intergenic
1174945195 20:54977451-54977473 CATCAGTGTCATGAAAGTCAAGG - Intergenic
1175101838 20:56584850-56584872 CATCAGTATCCCAAAATTCCTGG + Intergenic
1175879184 20:62246891-62246913 CATCAGAGTCACAAAGTTTAAGG - Intronic
1179521889 21:41951098-41951120 CATCACTGTCACAACAGCGATGG + Intronic
1180127794 21:45803897-45803919 CAGCACAGTAACAACATTCATGG - Intronic
951602781 3:24395008-24395030 CATCAATGTGACAAACTTCATGG - Intronic
953353172 3:42231181-42231203 CATCGATGTGACAAGATTCAGGG + Intergenic
955734194 3:62019114-62019136 CATCTGTTTCACATAATTCAGGG + Intronic
956237981 3:67096295-67096317 CCTCAGGGTTACAACTTTCATGG + Intergenic
956732461 3:72209138-72209160 TATCAGTGTCACAAAACACAAGG + Intergenic
958525328 3:95251504-95251526 CATCAGAGTCAAAACGTTGACGG - Intergenic
960488993 3:118287222-118287244 CATTTGTGTTACAACATTTAAGG - Intergenic
962983003 3:140507585-140507607 GATGAATGTCACAGCATTCAAGG - Intronic
963440107 3:145330044-145330066 TATCAATGTCAAAACATTTAAGG - Intergenic
966484865 3:180456871-180456893 CATCAGTGTGACATGATGCAAGG - Intergenic
969122124 4:4918457-4918479 CAACAATGTCACATCCTTCAAGG + Intergenic
972214835 4:36884723-36884745 CATCAGTGTAAAAATATTCATGG + Intergenic
972700347 4:41488314-41488336 CATCAGTGGCAGAAAAATCATGG + Intronic
972812588 4:42606954-42606976 CATCAGACTGACAAAATTCAAGG - Intronic
975579241 4:75891970-75891992 CATCGGTGTCATAGCCTTCAAGG - Exonic
976510513 4:85903459-85903481 CATCAGTGTCATTAGATTCTGGG - Intronic
981722344 4:147814415-147814437 CATTGGAGTAACAACATTCACGG - Intronic
981763050 4:148215201-148215223 CATAAGGGTAACACCATTCAGGG - Intronic
982104816 4:152002642-152002664 CATCAGTATCACATCATTGCTGG - Intergenic
982495146 4:156081666-156081688 TATCAGTGGGATAACATTCAAGG - Intergenic
983388410 4:167096918-167096940 CAACAGTGTCAAAACATGTAAGG - Intronic
983520869 4:168707591-168707613 CATCACTTTCACCACATTCTAGG + Intronic
983677795 4:170316655-170316677 CATCAGTGTCCCAATTTTCCAGG - Intergenic
984685088 4:182658266-182658288 CATCATTGCCAAAACAGTCAGGG - Intronic
986354786 5:6913111-6913133 CATCATTTTCATAACCTTCATGG - Intergenic
986354968 5:6914964-6914986 CATCATTGTAACGACATTAATGG - Intergenic
988842815 5:35099368-35099390 CACCAGTGTCACCACAAACACGG - Intronic
990478278 5:56183512-56183534 CTTCACTGTCACAGCATTCTAGG + Exonic
995835917 5:116399476-116399498 CTTCAGTGACACTCCATTCAGGG + Intronic
997154349 5:131537271-131537293 AATTAGTGTCACACCATTAAGGG + Intronic
1004115759 6:12766076-12766098 CATCACTGTGACAAAAATCATGG + Intronic
1005440188 6:25859268-25859290 CATGAGTCTCTGAACATTCATGG + Intronic
1010247500 6:73675220-73675242 CCTCAGTGTCCCAAAATGCAGGG + Intergenic
1012598701 6:101069460-101069482 CCTCAGTGTCACACCAATCCAGG - Intergenic
1013261110 6:108443418-108443440 CATCATAGTCACAACATTCAAGG + Intronic
1014346694 6:120279403-120279425 TCTCAGTGTCATAGCATTCAAGG + Intergenic
1016197671 6:141365724-141365746 CATCAAAGTCACAACAATGATGG - Intergenic
1016832372 6:148446557-148446579 CTTTAGTGTCATTACATTCAAGG + Intronic
1021817029 7:24457148-24457170 CATCTGTGTGACAAAGTTCAGGG + Intergenic
1028689941 7:93640746-93640768 CAGAGGTGTCACACCATTCAGGG + Intronic
1030536780 7:110777151-110777173 TATCATTGGCACACCATTCAGGG + Intronic
1030795998 7:113788849-113788871 CATCAGTGTGGCATCCTTCAAGG - Intergenic
1032932118 7:136684874-136684896 CATAAATGTTACAAAATTCAAGG - Intergenic
1033359207 7:140626261-140626283 CCTCGGTGTCACAGCATGCATGG - Intronic
1036476735 8:9100132-9100154 CATCAGTCTCTCTACATTTAGGG - Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037560563 8:20070740-20070762 CACCAGTGTCACCACAAACATGG + Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1039247949 8:35630534-35630556 CTTCACTGTCACAATATTCTTGG - Intronic
1043199905 8:77353948-77353970 CATAAGTCTCACCACACTCAAGG - Intergenic
1044690770 8:94875773-94875795 CAAAAGTGTCATGACATTCAAGG - Intronic
1046416108 8:113915620-113915642 CATCTGTGTCATCACATTGAGGG - Intergenic
1048480022 8:134780938-134780960 CATGAGTGTCATCACAGTCAGGG + Intergenic
1049012102 8:139894085-139894107 CAGCAGTGTCACAGCACGCAGGG - Intronic
1049250351 8:141585288-141585310 CTTCAGGGTCACAGCAATCAGGG + Intergenic
1049599287 8:143499596-143499618 CAGCATTTTCACAGCATTCAGGG + Intronic
1051071916 9:13180003-13180025 GATCAGTGTCAAAACAATAAAGG - Intronic
1051832231 9:21292744-21292766 CATCACTGTCACAAGAAGCAAGG + Intergenic
1053260109 9:36655328-36655350 AAGAAGTGGCACAACATTCAGGG + Intronic
1053561201 9:39196118-39196140 TTTCACTGTCATAACATTCAGGG + Intronic
1053825298 9:42016353-42016375 TTTCACTGTCATAACATTCAGGG + Intronic
1054135918 9:61422829-61422851 TTTCACTGTCATAACATTCAGGG - Intergenic
1054605269 9:67171004-67171026 TTTCACTGTCATAACATTCAGGG - Intergenic
1055194857 9:73577498-73577520 CAGCACTGTCAAAACATTTAGGG + Intergenic
1060018541 9:120108455-120108477 CACCAGTGACACAACATTAGCGG + Intergenic
1060182696 9:121545394-121545416 CATAAGTGTCACAACAGTCCTGG + Intergenic
1060747034 9:126144203-126144225 AATCAGAGAAACAACATTCAAGG - Intergenic
1061731748 9:132620309-132620331 CTTCTGTGTCACAACTGTCAGGG + Intronic
1186005437 X:5065820-5065842 TAGCAGTGTGAGAACATTCATGG - Intergenic
1186159546 X:6762331-6762353 CATCACAGTTACAACATTGAGGG + Intergenic
1186878167 X:13837759-13837781 CAACAGTGTCTGAAAATTCATGG + Intronic
1187926701 X:24257410-24257432 CACCATAGTCACAAGATTCAAGG - Intergenic
1188844313 X:35054588-35054610 CATCAATGTGGCAACTTTCATGG - Intergenic
1189890542 X:45597555-45597577 CTTCAGTGTTACCACCTTCAGGG - Intergenic
1192086896 X:68108148-68108170 CATCAGTGTCAGCCCTTTCAAGG + Intronic
1196016129 X:110942545-110942567 CAATAGTGTCCCAACATTGAGGG - Intergenic
1198608221 X:138368168-138368190 CACCAGTGCCACAACATGGATGG + Intergenic
1201293000 Y:12440104-12440126 CATCAGTGTCACCACCACCATGG + Intergenic
1201316296 Y:12650108-12650130 CATTATTGTCGCAATATTCAAGG - Intergenic
1201553254 Y:15240816-15240838 CATCATACTCACAACATTGAGGG + Intergenic