ID: 1128987445

View in Genome Browser
Species Human (GRCh38)
Location 15:72231434-72231456
Sequence CCTGATGACCAATGGGGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1128987445 Original CRISPR CCTGATGACCAATGGGGACG CGG Intronic
900143617 1:1148821-1148843 CCTGCCTACAAATGGGGACGAGG + Intergenic
907257627 1:53191725-53191747 CATGAGGACAGATGGGGACGGGG + Intergenic
907898391 1:58714890-58714912 ACTGATGACCAATGGGGAGCAGG + Intergenic
908647626 1:66296013-66296035 CCTGATGAACAAAGGGGAATTGG - Intronic
911035030 1:93533455-93533477 AGTGATGACCAATGAGGAGGAGG + Intronic
915443561 1:155961835-155961857 GCTGCTGTCCAATGTGGACGAGG - Exonic
916290878 1:163165047-163165069 CCTGATAACCAGTGGTGACCTGG + Intronic
917611776 1:176695890-176695912 CCTGGTGACCACTGAGGATGGGG + Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
921944802 1:220879319-220879341 CCTCGTGACCAATGGGAGCGGGG - Intergenic
922532882 1:226357798-226357820 CCTGATTACCAAGGGGAAAGTGG - Intergenic
1067226035 10:44376293-44376315 CCTGATTCCCACTGGGGACAAGG + Intronic
1071360007 10:84837273-84837295 CCTGCTGAGCAATGAGGACCTGG - Intergenic
1072238314 10:93472112-93472134 CCTGCTGATCACTGAGGACGAGG + Intronic
1077096760 11:802251-802273 CATGAGGACCCAGGGGGACGAGG + Exonic
1077417959 11:2433671-2433693 CCTGAGGACCAGCGGGGCCGGGG + Intergenic
1080215689 11:29837425-29837447 TATGATGACTAATGGGGATGAGG - Intergenic
1084001257 11:66296404-66296426 CCTGATGATCCATGGGGCCCAGG + Exonic
1084556836 11:69880570-69880592 CCTGAGGACAATTGGGGAGGAGG - Intergenic
1089214973 11:116829803-116829825 CCTGCTGACCAGTGGAGATGAGG - Intronic
1089393198 11:118116017-118116039 CCTGATGGCCAATGAGGCCGGGG - Intronic
1089623996 11:119739837-119739859 CCTGATGATGAATGGAGAAGTGG + Intergenic
1092488414 12:8922704-8922726 CCTGATGCCTAATGGGGCGGTGG + Exonic
1092760640 12:11807981-11808003 GCTGATGATCATTGGGGAAGGGG - Intronic
1092864561 12:12748795-12748817 CCTAAAGATCAAAGGGGACGTGG + Intronic
1092924038 12:13257863-13257885 CCTGAGGAACAAAGGGGAAGAGG - Intergenic
1096946557 12:55414187-55414209 CCTGATGCCTAATGGGGCAGTGG - Intergenic
1100661459 12:96703467-96703489 CCTGGTGACCAAGGGGGATGAGG + Intronic
1101958921 12:109233692-109233714 GCTGCTGACCCATGGGGATGAGG - Intronic
1103792060 12:123478841-123478863 CCTGGTGTTCACTGGGGACGAGG + Intronic
1110364755 13:74669408-74669430 CCTGTAGAGCAATGGGGATGAGG + Intergenic
1112816928 13:103283540-103283562 ACTGATGAGGAATGGGGAAGGGG - Intergenic
1117965166 14:61199773-61199795 CCTGAAGACCAAAGGGGAGGGGG - Intronic
1118447967 14:65868833-65868855 CCAGTTGACCAATGAGGATGGGG + Intergenic
1119854838 14:77891734-77891756 CCTGATGATCCATGGGGTGGTGG - Intronic
1122346853 14:101066189-101066211 GCTGATGAGCAATGGTGACGGGG + Intergenic
1202896808 14_GL000194v1_random:15119-15141 TCTGATGACCACTGGGGCCCAGG - Intergenic
1128987445 15:72231434-72231456 CCTGATGACCAATGGGGACGCGG + Intronic
1138657845 16:58501081-58501103 CCTGAGGAAGAATGGGGCCGGGG - Intronic
1139426793 16:66885532-66885554 CATGCTGAGCAATGAGGACGTGG + Exonic
1141755498 16:85987983-85988005 CCTGGGGTCCACTGGGGACGTGG + Intergenic
1143355401 17:6324151-6324173 CCAGATGACCAAATGTGACGGGG - Intergenic
1143964480 17:10747204-10747226 TCTGAAGACCAAAGGGGACGTGG - Intergenic
1149895525 17:60425916-60425938 CCTCCTGACCAATGGGGAAAAGG - Intronic
1150121789 17:62609552-62609574 ACTGTTGAACAATGGGGACAGGG - Intronic
1159873112 18:73780526-73780548 CCTGATGTGTAATGGCGACGTGG + Intergenic
1160183565 18:76657090-76657112 CCTGATGACAGATGGGGGCCAGG + Intergenic
1160422456 18:78756220-78756242 ACTGATGACCACTGGGCACCAGG - Intergenic
1160708805 19:541348-541370 CCTGGGGACCAAGGTGGACGCGG + Exonic
1160976808 19:1796786-1796808 CGTGCGGACCAACGGGGACGAGG - Exonic
1161907847 19:7170543-7170565 CCTGAAGACCAATGGGGACCAGG - Exonic
1162497425 19:11031029-11031051 CCTGATGACCTATGGAGATATGG - Intronic
1162922216 19:13909855-13909877 CCTGATGATCCCTGAGGACGGGG + Exonic
1163332547 19:16649982-16650004 CGTGACTGCCAATGGGGACGCGG + Intronic
1163391637 19:17034705-17034727 CCTGAAGAACAATGGGGTTGGGG - Intergenic
1163400574 19:17089903-17089925 AGTGATGGCTAATGGGGACGGGG - Intronic
1165138686 19:33686542-33686564 CCTGATGAACAAAGGGGACTCGG - Intronic
927656193 2:24948724-24948746 GATGATGACCAGTGGGGACAGGG - Intronic
928102006 2:28444192-28444214 GCTGATTACCAAGGGGGAAGTGG + Intergenic
932302105 2:70674789-70674811 GCTGATGTCCAAGGGAGACGAGG - Exonic
935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG + Intergenic
936760138 2:115768348-115768370 CCTGTTAAGCAAGGGGGACGTGG + Exonic
938491521 2:131763667-131763689 TCTGATGACCACTGGGGCCCAGG + Intronic
938496045 2:131798675-131798697 TCTGATGACCACTGGGGCCCAGG - Intronic
939976573 2:148723454-148723476 CCTGAAAACCAATGGGGGAGAGG - Intronic
941231089 2:162913400-162913422 CCTGATGGCCAAGGAGGTCGAGG - Intergenic
942254778 2:174085919-174085941 GCAGATGACAAATGGGGACAGGG - Intronic
944121079 2:196241492-196241514 ACTGATCTCCAGTGGGGACGTGG + Intronic
948627616 2:239278823-239278845 CATGAGGACCATTGGGGCCGGGG + Intronic
1170918075 20:20648368-20648390 CGGGATTACCAAGGGGGACGAGG + Intronic
1172944242 20:38675147-38675169 CCAGAGGACCAAGGAGGACGAGG + Intergenic
1173643755 20:44621047-44621069 CCAGATGACCAAACGGGACATGG - Exonic
1176247900 20:64105944-64105966 ACTGATGACCAGTGGGGTCTGGG + Exonic
1176616496 21:9031115-9031137 TCTGATGACCACTGGGGCCCAGG - Intergenic
1176708633 21:10132516-10132538 TCTGATGACCACTGGGGCCCAGG + Intergenic
1183883389 22:40856396-40856418 CCTGAGGACCGTTGGGGGCGGGG - Intronic
1183929080 22:41225811-41225833 CCTGATGATCTGTGTGGACGGGG + Exonic
949600109 3:5588926-5588948 TCTGATGAGAAATGGGGATGGGG - Intergenic
952191290 3:31025957-31025979 CATGATGAACAATGGGGAGGGGG - Intergenic
961792639 3:129387276-129387298 GCTGTGGACCCATGGGGACGTGG - Intergenic
962900174 3:139755062-139755084 CGTGATGACAAATGGGGTGGAGG + Intergenic
969350638 4:6596225-6596247 CGTGATGACCACTGAGGATGTGG + Intronic
970837191 4:20423555-20423577 CCTGATTACAAATGGAGAAGTGG + Intronic
985621733 5:959634-959656 CCCGCTGACCACTGGGGCCGTGG - Intergenic
992114371 5:73525308-73525330 CCTGCTGACCAAGGAGGACTTGG + Intergenic
992625617 5:78633701-78633723 CCTGTGGACCAATGGGGTAGGGG + Intronic
992889754 5:81193393-81193415 ACTGATGACCATTTGAGACGGGG - Intronic
995567710 5:113449047-113449069 CCTGATGACCAGTAGAGACTGGG - Intronic
1002451210 5:179319849-179319871 CGTGCTGACCAGTGGGGACCTGG - Intronic
1009226606 6:61025522-61025544 CCTAATATCCAATGGGGAAGAGG - Intergenic
1035350120 7:158239536-158239558 CAGCAGGACCAATGGGGACGTGG + Intronic
1037389995 8:18383477-18383499 CATGGTGGCCAAAGGGGACGAGG - Intergenic
1037460584 8:19104463-19104485 GCTGATGAGCACTGGGCACGGGG - Intergenic
1037513182 8:19604183-19604205 CCTGATTACCAAGGGGGTCTTGG - Intronic
1039081758 8:33740434-33740456 CCTGATGAGCAAAGAGGACCTGG - Intergenic
1041003594 8:53477361-53477383 TCTGATTACCAAAGTGGACGTGG - Intergenic
1046742625 8:117845230-117845252 CCTCACAACCACTGGGGACGTGG + Intronic
1047858765 8:128941528-128941550 CCTGATGACCAACTGGGAGATGG + Intergenic
1052781464 9:32784627-32784649 CCTGATGCCCATTCTGGACGAGG - Exonic
1053645603 9:40118012-40118034 TCTGATGACCACTGGGGCCCAGG + Intergenic
1053760107 9:41345497-41345519 TCTGATGACCACTGGGGCCCAGG - Intergenic
1054326618 9:63715913-63715935 TCTGATGACCACTGGGGCCCAGG + Intergenic
1054538970 9:66257960-66257982 TCTGATGACCACTGGGGCCCAGG - Intergenic
1057161851 9:92894810-92894832 CCTGATGACTGATGGAGAGGAGG - Intergenic
1059188456 9:112300014-112300036 CCTGATGACCAATGAGGATGCGG - Intronic
1202793394 9_KI270719v1_random:101485-101507 TCTGATGACCACTGGGGCCCAGG + Intergenic
1185649381 X:1637531-1637553 CCTGATGATCCATGAGGATGTGG + Intronic
1185649410 X:1637696-1637718 CCTGATGATCCATGAGGATGTGG + Intronic
1185649454 X:1637944-1637966 CCTGATGATCCATGAGGATGTGG + Intronic
1185649498 X:1638192-1638214 CCTGATGATCCATGAGGATGTGG + Intronic
1185649527 X:1638357-1638379 CCTGATGATCCATGAGGATGTGG + Intronic
1185649616 X:1638850-1638872 CCTGATGATCCATGAGGATGTGG + Intronic
1185649644 X:1639015-1639037 CCTGATGATCCATGAGGATGTGG + Intronic
1185649674 X:1639180-1639202 CCTGATGATCCATGAGGATGTGG + Intronic
1185649760 X:1639673-1639695 CCTGATGATCCATGAGGATGTGG + Intronic
1185649788 X:1639838-1639860 CCTGATGATCCATGAGGATGTGG + Intronic
1185649818 X:1640003-1640025 CCTGATGATCCATGAGGATGTGG + Intronic
1185649847 X:1640168-1640190 CCTGATGATCCATGAGGATGTGG + Intronic
1185649878 X:1640333-1640355 CCTGATGATCCATGAGGATGTGG + Intronic
1185649936 X:1640661-1640683 CCTGATGATCCATGAGGATGTGG + Intronic
1185649966 X:1640826-1640848 CCTGATGATCCATGAGGATGTGG + Intronic
1185649995 X:1640991-1641013 CCTGATGATCCATGAGGATGTGG + Intronic
1185650026 X:1641156-1641178 CCTGATGATCCATGAGGATGTGG + Intronic
1185650194 X:1642059-1642081 CCTGATGGCCCATGAGGATGTGG + Intronic
1185650269 X:1642475-1642497 CCTGATGGCCCATGAGGATGTGG + Intronic
1185650301 X:1642642-1642664 CCTGATGATCGATGAGGACGTGG + Intronic
1189546295 X:42045824-42045846 CCAGATAAACAATGGGGACTTGG - Intergenic
1200118939 X:153781421-153781443 CCAGATGGTCAATGGGGCCGAGG + Intronic
1200360812 X:155604374-155604396 CCTGGTGATGAATGGGGAGGGGG - Intronic
1201149872 Y:11089839-11089861 TCTGATGACCACTGGGGCCCAGG - Intergenic